ID: 967602443

View in Genome Browser
Species Human (GRCh38)
Location 3:191405656-191405678
Sequence ATGGCACCTTGAGTTGTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967602439_967602443 5 Left 967602439 3:191405628-191405650 CCAAGACTTATAGCTTGTGCCTT No data
Right 967602443 3:191405656-191405678 ATGGCACCTTGAGTTGTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967602443 Original CRISPR ATGGCACCTTGAGTTGTACC TGG Intergenic
No off target data available for this crispr