ID: 967612282

View in Genome Browser
Species Human (GRCh38)
Location 3:191521560-191521582
Sequence GGATTCTACACATGTCAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967612282_967612286 13 Left 967612282 3:191521560-191521582 CCTTACTGACATGTGTAGAATCC No data
Right 967612286 3:191521596-191521618 ATATAACAGAATCTAATGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967612282 Original CRISPR GGATTCTACACATGTCAGTA AGG (reversed) Intergenic
No off target data available for this crispr