ID: 967629049

View in Genome Browser
Species Human (GRCh38)
Location 3:191721382-191721404
Sequence TGCCATGGCACAAGTATTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967629049_967629054 10 Left 967629049 3:191721382-191721404 CCAGGAATACTTGTGCCATGGCA No data
Right 967629054 3:191721415-191721437 GGCCATTGACGTACCCAGAAAGG No data
967629049_967629059 25 Left 967629049 3:191721382-191721404 CCAGGAATACTTGTGCCATGGCA No data
Right 967629059 3:191721430-191721452 CAGAAAGGCAAAGAAAGGAAAGG No data
967629049_967629056 20 Left 967629049 3:191721382-191721404 CCAGGAATACTTGTGCCATGGCA No data
Right 967629056 3:191721425-191721447 GTACCCAGAAAGGCAAAGAAAGG No data
967629049_967629060 26 Left 967629049 3:191721382-191721404 CCAGGAATACTTGTGCCATGGCA No data
Right 967629060 3:191721431-191721453 AGAAAGGCAAAGAAAGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967629049 Original CRISPR TGCCATGGCACAAGTATTCC TGG (reversed) Intergenic
No off target data available for this crispr