ID: 967630668

View in Genome Browser
Species Human (GRCh38)
Location 3:191740390-191740412
Sequence ACATTATCACAGCTGGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967630660_967630668 19 Left 967630660 3:191740348-191740370 CCCATGTTTATTATCCAACGCTG No data
Right 967630668 3:191740390-191740412 ACATTATCACAGCTGGGGCATGG No data
967630663_967630668 5 Left 967630663 3:191740362-191740384 CCAACGCTGAAAGGTATTCATCC No data
Right 967630668 3:191740390-191740412 ACATTATCACAGCTGGGGCATGG No data
967630658_967630668 23 Left 967630658 3:191740344-191740366 CCACCCCATGTTTATTATCCAAC No data
Right 967630668 3:191740390-191740412 ACATTATCACAGCTGGGGCATGG No data
967630661_967630668 18 Left 967630661 3:191740349-191740371 CCATGTTTATTATCCAACGCTGA No data
Right 967630668 3:191740390-191740412 ACATTATCACAGCTGGGGCATGG No data
967630659_967630668 20 Left 967630659 3:191740347-191740369 CCCCATGTTTATTATCCAACGCT No data
Right 967630668 3:191740390-191740412 ACATTATCACAGCTGGGGCATGG No data
967630657_967630668 24 Left 967630657 3:191740343-191740365 CCCACCCCATGTTTATTATCCAA No data
Right 967630668 3:191740390-191740412 ACATTATCACAGCTGGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967630668 Original CRISPR ACATTATCACAGCTGGGGCA TGG Intergenic
No off target data available for this crispr