ID: 967632435

View in Genome Browser
Species Human (GRCh38)
Location 3:191760860-191760882
Sequence CTTACAATGTAGTAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967632431_967632435 -9 Left 967632431 3:191760846-191760868 CCTAACCTAAGGAACTTACAATG No data
Right 967632435 3:191760860-191760882 CTTACAATGTAGTAGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967632435 Original CRISPR CTTACAATGTAGTAGGAAGA GGG Intergenic
No off target data available for this crispr