ID: 967633155

View in Genome Browser
Species Human (GRCh38)
Location 3:191770657-191770679
Sequence CAGCTCTCACACATTGTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967633155_967633157 11 Left 967633155 3:191770657-191770679 CCCATGACAATGTGTGAGAGCTG No data
Right 967633157 3:191770691-191770713 GCTTTTATTGTCTTGACCATTGG No data
967633155_967633159 28 Left 967633155 3:191770657-191770679 CCCATGACAATGTGTGAGAGCTG No data
Right 967633159 3:191770708-191770730 CATTGGAGCATAAAATAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967633155 Original CRISPR CAGCTCTCACACATTGTCAT GGG (reversed) Intergenic
No off target data available for this crispr