ID: 967633157

View in Genome Browser
Species Human (GRCh38)
Location 3:191770691-191770713
Sequence GCTTTTATTGTCTTGACCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967633155_967633157 11 Left 967633155 3:191770657-191770679 CCCATGACAATGTGTGAGAGCTG No data
Right 967633157 3:191770691-191770713 GCTTTTATTGTCTTGACCATTGG No data
967633154_967633157 19 Left 967633154 3:191770649-191770671 CCTGCAGACCCATGACAATGTGT No data
Right 967633157 3:191770691-191770713 GCTTTTATTGTCTTGACCATTGG No data
967633156_967633157 10 Left 967633156 3:191770658-191770680 CCATGACAATGTGTGAGAGCTGC No data
Right 967633157 3:191770691-191770713 GCTTTTATTGTCTTGACCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967633157 Original CRISPR GCTTTTATTGTCTTGACCAT TGG Intergenic
No off target data available for this crispr