ID: 967633159

View in Genome Browser
Species Human (GRCh38)
Location 3:191770708-191770730
Sequence CATTGGAGCATAAAATAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967633156_967633159 27 Left 967633156 3:191770658-191770680 CCATGACAATGTGTGAGAGCTGC No data
Right 967633159 3:191770708-191770730 CATTGGAGCATAAAATAATATGG No data
967633155_967633159 28 Left 967633155 3:191770657-191770679 CCCATGACAATGTGTGAGAGCTG No data
Right 967633159 3:191770708-191770730 CATTGGAGCATAAAATAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967633159 Original CRISPR CATTGGAGCATAAAATAATA TGG Intergenic
No off target data available for this crispr