ID: 967633483

View in Genome Browser
Species Human (GRCh38)
Location 3:191774576-191774598
Sequence TAAGTGTGTGGCCAACTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967633483_967633485 -4 Left 967633483 3:191774576-191774598 CCATGCAGTTGGCCACACACTTA No data
Right 967633485 3:191774595-191774617 CTTATGCAAGCCCTCAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967633483 Original CRISPR TAAGTGTGTGGCCAACTGCA TGG (reversed) Intergenic
No off target data available for this crispr