ID: 967648119

View in Genome Browser
Species Human (GRCh38)
Location 3:191951664-191951686
Sequence TTAAAATTCTTAAAGGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967648119_967648123 17 Left 967648119 3:191951664-191951686 CCCTCACCCTTTAAGAATTTTAA No data
Right 967648123 3:191951704-191951726 AAACATTTTACTGCTTAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967648119 Original CRISPR TTAAAATTCTTAAAGGGTGA GGG (reversed) Intergenic
No off target data available for this crispr