ID: 967648890

View in Genome Browser
Species Human (GRCh38)
Location 3:191961441-191961463
Sequence AAAATGGGGCTCACTCAGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967648890_967648904 30 Left 967648890 3:191961441-191961463 CCTCGCTGAGTGAGCCCCATTTT No data
Right 967648904 3:191961494-191961516 ATTGAGTTCCCAGCCATGATGGG No data
967648890_967648903 29 Left 967648890 3:191961441-191961463 CCTCGCTGAGTGAGCCCCATTTT No data
Right 967648903 3:191961493-191961515 AATTGAGTTCCCAGCCATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967648890 Original CRISPR AAAATGGGGCTCACTCAGCG AGG (reversed) Intergenic
No off target data available for this crispr