ID: 967649851

View in Genome Browser
Species Human (GRCh38)
Location 3:191973317-191973339
Sequence ATGGGTGACCAGCAGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967649851_967649858 16 Left 967649851 3:191973317-191973339 CCTCTCTGCTGCTGGTCACCCAT No data
Right 967649858 3:191973356-191973378 GCTGAGCCCAGGGCTTCTGTGGG No data
967649851_967649861 25 Left 967649851 3:191973317-191973339 CCTCTCTGCTGCTGGTCACCCAT No data
Right 967649861 3:191973365-191973387 AGGGCTTCTGTGGGCCTCAGAGG No data
967649851_967649856 6 Left 967649851 3:191973317-191973339 CCTCTCTGCTGCTGGTCACCCAT No data
Right 967649856 3:191973346-191973368 CTGAACTCTGGCTGAGCCCAGGG No data
967649851_967649857 15 Left 967649851 3:191973317-191973339 CCTCTCTGCTGCTGGTCACCCAT No data
Right 967649857 3:191973355-191973377 GGCTGAGCCCAGGGCTTCTGTGG No data
967649851_967649855 5 Left 967649851 3:191973317-191973339 CCTCTCTGCTGCTGGTCACCCAT No data
Right 967649855 3:191973345-191973367 GCTGAACTCTGGCTGAGCCCAGG No data
967649851_967649852 -6 Left 967649851 3:191973317-191973339 CCTCTCTGCTGCTGGTCACCCAT No data
Right 967649852 3:191973334-191973356 ACCCATTCTCTGCTGAACTCTGG No data
967649851_967649863 27 Left 967649851 3:191973317-191973339 CCTCTCTGCTGCTGGTCACCCAT No data
Right 967649863 3:191973367-191973389 GGCTTCTGTGGGCCTCAGAGGGG No data
967649851_967649862 26 Left 967649851 3:191973317-191973339 CCTCTCTGCTGCTGGTCACCCAT No data
Right 967649862 3:191973366-191973388 GGGCTTCTGTGGGCCTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967649851 Original CRISPR ATGGGTGACCAGCAGCAGAG AGG (reversed) Intergenic
No off target data available for this crispr