ID: 967649882

View in Genome Browser
Species Human (GRCh38)
Location 3:191973483-191973505
Sequence AGGGAGGACCTAAAGGCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967649882_967649888 -8 Left 967649882 3:191973483-191973505 CCCCCAGCCTTTAGGTCCTCCCT No data
Right 967649888 3:191973498-191973520 TCCTCCCTGGACTGAAGCTGAGG No data
967649882_967649894 24 Left 967649882 3:191973483-191973505 CCCCCAGCCTTTAGGTCCTCCCT No data
Right 967649894 3:191973530-191973552 AAACCCAACCCCTTTCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967649882 Original CRISPR AGGGAGGACCTAAAGGCTGG GGG (reversed) Intergenic
No off target data available for this crispr