ID: 967656083 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:192051484-192051506 |
Sequence | CCTCATATACTGAGGATAAA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
967656079_967656083 | 23 | Left | 967656079 | 3:192051438-192051460 | CCAGTGAATAGTAAGTAAGAAAT | No data | ||
Right | 967656083 | 3:192051484-192051506 | CCTCATATACTGAGGATAAAAGG | No data | ||||
967656078_967656083 | 29 | Left | 967656078 | 3:192051432-192051454 | CCAGGTCCAGTGAATAGTAAGTA | No data | ||
Right | 967656083 | 3:192051484-192051506 | CCTCATATACTGAGGATAAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
967656083 | Original CRISPR | CCTCATATACTGAGGATAAA AGG | Intergenic | ||
No off target data available for this crispr |