ID: 967656083

View in Genome Browser
Species Human (GRCh38)
Location 3:192051484-192051506
Sequence CCTCATATACTGAGGATAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967656079_967656083 23 Left 967656079 3:192051438-192051460 CCAGTGAATAGTAAGTAAGAAAT No data
Right 967656083 3:192051484-192051506 CCTCATATACTGAGGATAAAAGG No data
967656078_967656083 29 Left 967656078 3:192051432-192051454 CCAGGTCCAGTGAATAGTAAGTA No data
Right 967656083 3:192051484-192051506 CCTCATATACTGAGGATAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967656083 Original CRISPR CCTCATATACTGAGGATAAA AGG Intergenic
No off target data available for this crispr