ID: 967658976

View in Genome Browser
Species Human (GRCh38)
Location 3:192082062-192082084
Sequence AATCCCTGATTCACAAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967658974_967658976 20 Left 967658974 3:192082019-192082041 CCAGTCTATTCTGTAATCTCGGT No data
Right 967658976 3:192082062-192082084 AATCCCTGATTCACAAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967658976 Original CRISPR AATCCCTGATTCACAAAGAA AGG Intergenic