ID: 967660696

View in Genome Browser
Species Human (GRCh38)
Location 3:192105844-192105866
Sequence GAATCTATTGGAGGACATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967660696_967660703 11 Left 967660696 3:192105844-192105866 CCTTCATGTCCTCCAATAGATTC No data
Right 967660703 3:192105878-192105900 CTGGAATCCTCACAGCCACAGGG No data
967660696_967660702 10 Left 967660696 3:192105844-192105866 CCTTCATGTCCTCCAATAGATTC No data
Right 967660702 3:192105877-192105899 ACTGGAATCCTCACAGCCACAGG No data
967660696_967660699 -8 Left 967660696 3:192105844-192105866 CCTTCATGTCCTCCAATAGATTC No data
Right 967660699 3:192105859-192105881 ATAGATTCCTTTCCATATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967660696 Original CRISPR GAATCTATTGGAGGACATGA AGG (reversed) Intergenic
No off target data available for this crispr