ID: 967664887

View in Genome Browser
Species Human (GRCh38)
Location 3:192159085-192159107
Sequence AGGAAGTAGAGAAATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2274
Summary {0: 1, 1: 0, 2: 12, 3: 176, 4: 2085}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967664887 Original CRISPR AGGAAGTAGAGAAATGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr