ID: 967665641

View in Genome Browser
Species Human (GRCh38)
Location 3:192168728-192168750
Sequence CAACTATTATAGAAGACAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 413}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967665641 Original CRISPR CAACTATTATAGAAGACAAA GGG Intronic
902091994 1:13910957-13910979 CAATCATGATGGAAGACAAAGGG + Intergenic
903269945 1:22181692-22181714 CAACTACTATGAAAGAGAAAAGG - Intergenic
903634487 1:24801316-24801338 CAAGTATGATAGAAGTCAAAGGG + Intronic
905007621 1:34722706-34722728 CAACCATTTTAGAAAACAACTGG + Intronic
905361277 1:37422619-37422641 CAATTATGGTAGAAGGCAAAGGG + Intergenic
906858289 1:49331476-49331498 CAAATAGTACAGAAGAAAAAGGG + Intronic
908795894 1:67831632-67831654 TAACTATTAGAGAAGGCAAAGGG + Intronic
909634285 1:77798417-77798439 CAATTATGGTAGAAGGCAAAAGG + Intronic
909989238 1:82201942-82201964 CAACCAATATATGAGACAAATGG + Intergenic
910149053 1:84119354-84119376 CAACTATTAAAGAAGGAGAATGG + Intronic
910324923 1:85995874-85995896 CAACCATGGTAGAAGGCAAAGGG - Intronic
910697419 1:90035295-90035317 AAACTATTAGAAATGACAAAAGG + Intronic
910785096 1:90988926-90988948 AAACTATTAAAGAAAACATAGGG + Intronic
911451389 1:98066295-98066317 AAACTATTTTACAAGAAAAATGG - Intergenic
912126886 1:106550566-106550588 TAAGTAATACAGAAGACAAATGG + Intergenic
912236101 1:107852563-107852585 TAAATATTTTAGAAGAAAAATGG - Intronic
912644494 1:111379398-111379420 CAACCACTATAGAAAACAATAGG - Intergenic
913392992 1:118334983-118335005 CAGAAATTATAGAAGGCAAAAGG + Intergenic
913423272 1:118697143-118697165 CAACCATTATGGAAGACAGTGGG + Intergenic
914261693 1:146004356-146004378 CAAATCATATAGAAGTCAAAAGG - Intergenic
915258808 1:154659615-154659637 CAACTATTTTATAAACCAAAAGG - Intergenic
915365508 1:155313275-155313297 GAACTGGTATAGAAGACAAGGGG - Intronic
917690566 1:177463990-177464012 AAACTATTATACAAGAAGAAAGG - Intergenic
918424561 1:184395087-184395109 CCACTCTTATAGCAGAAAAAGGG - Intronic
918430465 1:184454710-184454732 CAACTATGGTAGATGGCAAAGGG - Intronic
918830023 1:189383568-189383590 GAATGATTATAGAAGCCAAATGG + Intergenic
918947448 1:191086276-191086298 CAACTAATAAAGAAAACTAAAGG + Intergenic
920769825 1:208872329-208872351 GAAATGTTATTGAAGACAAAAGG - Intergenic
920836061 1:209512214-209512236 CAACTACAATAGGAAACAAAAGG - Intergenic
921299005 1:213732396-213732418 CAACTAATCAACAAGACAAAGGG - Intergenic
921999969 1:221467099-221467121 CAACAGTTAAAAAAGACAAAAGG - Intergenic
922130900 1:222776685-222776707 AAGCTTTTATAGAAGACTAAAGG + Intergenic
923477529 1:234348663-234348685 TAACTATGATTGAAGATAAAAGG + Intergenic
923736445 1:236613096-236613118 CAACAAATGTAGAAGATAAAAGG + Intergenic
924936895 1:248779446-248779468 CAATCATGATGGAAGACAAAGGG + Intergenic
1063990798 10:11560155-11560177 CTGTTATTATAGAAGACAATGGG - Intronic
1064777193 10:18792070-18792092 CAATCATGATGGAAGACAAAAGG + Intergenic
1066274501 10:33855627-33855649 AAACTGTTATAGAAGCCAAAAGG - Intergenic
1066991144 10:42515144-42515166 CAACCATTGTGGAAGGCAAAAGG - Intergenic
1067442985 10:46321933-46321955 CAACTTTTCCAGAAGACAGAGGG + Intronic
1067633379 10:47985729-47985751 CAACTATTAAAAAAAAAAAAAGG + Intergenic
1067673533 10:48347969-48347991 CAACTATTGTGGAAGACAGTTGG - Intronic
1068264710 10:54631757-54631779 CAATTATGGTAGAAGACAAATGG + Intronic
1068284890 10:54921867-54921889 CAACCATTGCAGAAGGCAAAAGG + Intronic
1068655629 10:59572661-59572683 CCAATATTAGAAAAGACAAAAGG + Intergenic
1070679758 10:78440308-78440330 CAATTACGGTAGAAGACAAAGGG + Intergenic
1071204146 10:83254735-83254757 CAATTATGATGGAAGGCAAAGGG + Intergenic
1071999719 10:91183347-91183369 CAAAGATTAAAAAAGACAAAGGG - Intronic
1073942646 10:108715647-108715669 CAATCATAATAGAAGGCAAAGGG + Intergenic
1074748969 10:116565286-116565308 CAAAGAATATAGGAGACAAATGG + Intronic
1075230262 10:120670452-120670474 CATTTGTTTTAGAAGACAAATGG - Intergenic
1075534621 10:123259815-123259837 CAACTATTAAAAAAAAAAAAAGG - Intergenic
1076082110 10:127591616-127591638 CAAATATGGCAGAAGACAAAAGG + Intergenic
1077728022 11:4696227-4696249 CAACTTCTATATGAGACAAATGG + Intronic
1078778221 11:14412763-14412785 CCACTATTATAGAAGATAATGGG - Intergenic
1079179705 11:18179646-18179668 CAACAATTAAAAAAAACAAAGGG + Intronic
1079504377 11:21137032-21137054 CAACTCTTACAGAAGAGAGAAGG + Intronic
1079871690 11:25806319-25806341 CTCATATTATAGAACACAAAGGG + Intergenic
1079877851 11:25882661-25882683 CAAATATAATAGATAACAAAAGG - Intergenic
1080074910 11:28137716-28137738 GAAATATTTTTGAAGACAAATGG - Intronic
1081051871 11:38351259-38351281 CAATCATGATAGAAGGCAAAGGG + Intergenic
1081073221 11:38635841-38635863 CAACCATTATAGAAAACAGTTGG - Intergenic
1081287908 11:41294757-41294779 AAACTATTATAGCAGGAAAAGGG + Intronic
1081438139 11:43050749-43050771 CAACCATTATTGATAACAAATGG - Intergenic
1082692800 11:56326136-56326158 CAATTATGGTGGAAGACAAAAGG - Intergenic
1082751559 11:57023942-57023964 CATGTGTTACAGAAGACAAAAGG + Intergenic
1085069930 11:73534798-73534820 CCCCTAGTATAGAAGACTAAAGG + Intronic
1085976220 11:81659209-81659231 CAATTATGACAGAAGGCAAAGGG + Intergenic
1087326620 11:96731118-96731140 CAAATATTTTAAAACACAAATGG - Intergenic
1087553623 11:99686412-99686434 GAACTAATATAGAAAATAAAAGG - Intronic
1088008812 11:104974042-104974064 CAACTTTTTTTGAAGAGAAAGGG - Intergenic
1088078766 11:105883849-105883871 CAACCATTGTAGAAGACAGTGGG - Intronic
1088387255 11:109273390-109273412 CAACATTTAAAAAAGACAAAGGG - Intergenic
1089415866 11:118290126-118290148 CAATCATGGTAGAAGACAAAGGG + Intergenic
1089636659 11:119818427-119818449 CAACCTTTTTAGAAGACAATTGG + Intergenic
1089765291 11:120758704-120758726 GAAACATTACAGAAGACAAAGGG + Intronic
1090148603 11:124357275-124357297 CATCTTTTCTAGAAGAAAAAAGG + Intergenic
1091155828 11:133371641-133371663 CAATCATTGCAGAAGACAAAGGG - Intronic
1091327950 11:134705991-134706013 CAACTCTTAAAGGAGAGAAAGGG - Intergenic
1093374633 12:18409863-18409885 CAACCATGGTGGAAGACAAAGGG + Intronic
1094214827 12:27929771-27929793 CACCCATTATAGAAACCAAATGG + Intergenic
1094331421 12:29298323-29298345 AAAGTATTATAGCAGAAAAATGG + Intronic
1094432830 12:30388750-30388772 CAATTATGATGGAAGGCAAAGGG + Intergenic
1095121095 12:38420420-38420442 CAATTATTATAGAAATGAAATGG + Intergenic
1095383429 12:41621619-41621641 CAACCATTAGAAAATACAAAGGG - Intergenic
1096209190 12:49749925-49749947 CAAATATTATAGACGCAAAAGGG - Intronic
1098056589 12:66512858-66512880 CAACTTTTCTGGAAGACAATTGG + Intronic
1098756223 12:74366253-74366275 CAACTATGGAAGAAGGCAAAGGG + Intergenic
1099291531 12:80782202-80782224 CAACTAATTGAGAAGAAAAATGG + Intergenic
1099561345 12:84179073-84179095 AAACTAAAATAGAAGACAAAAGG - Intergenic
1099770643 12:87049363-87049385 CAAATATTATAGTAGAAAATGGG + Intergenic
1100073432 12:90750042-90750064 CAACCATTATAGAAGACAGTGGG - Intergenic
1100568844 12:95826430-95826452 AAACTAGCTTAGAAGACAAATGG - Intergenic
1101485270 12:105151365-105151387 CAACCATTATACAAGAGAACTGG - Intronic
1101530460 12:105568717-105568739 CAACAACAATAAAAGACAAATGG + Intergenic
1101786805 12:107891449-107891471 AAAAGATTATAGAAGACACAGGG + Intergenic
1105568857 13:21580091-21580113 CAACTGTTGTAAAAGAAAAATGG - Intronic
1106338178 13:28803604-28803626 GAAATAATATAGAAGGCAAAGGG - Intergenic
1106603902 13:31209845-31209867 CATCTATCATAGAAACCAAACGG - Intronic
1107186886 13:37533117-37533139 CAACTATAACAGAAGACCACAGG - Intergenic
1108334927 13:49430434-49430456 TATCTATTTTAGAAGACAAATGG + Intronic
1110574207 13:77037418-77037440 CAATCATAATGGAAGACAAAGGG - Intergenic
1111226976 13:85287672-85287694 CAATTATGATAGAAGGAAAAGGG + Intergenic
1111370774 13:87313689-87313711 CAATTATTGCAGAAGGCAAAGGG - Intergenic
1111815678 13:93149736-93149758 TAACTATTGGAGCAGACAAAAGG + Intergenic
1112223404 13:97514118-97514140 CAATTATAATGGAAGGCAAACGG + Intergenic
1112229634 13:97575617-97575639 CAATTATGGCAGAAGACAAAGGG + Intergenic
1113167127 13:107454358-107454380 CAATTATGGCAGAAGACAAAGGG + Intronic
1114348989 14:21829235-21829257 GAAGTATTACAGAAGAAAAAAGG + Intergenic
1114353232 14:21877928-21877950 GAAGTATTACAGAAGAAAAAAGG + Intergenic
1114715571 14:24820397-24820419 CCACCATTAAAGAAGAAAAATGG - Intronic
1115306780 14:31941846-31941868 CAAGAATTATGGAAGATAAATGG - Intergenic
1115833992 14:37376856-37376878 CAACTATCTTGGAAGACAATTGG - Intronic
1116270902 14:42764842-42764864 CAACCATTATGGAAAACAATTGG - Intergenic
1116383475 14:44301239-44301261 AAAGTAATAAAGAAGACAAAGGG + Intergenic
1116728550 14:48593297-48593319 CAACCATTGTGGAAGACAGATGG + Intergenic
1116766214 14:49073255-49073277 CAATACTTATATAAGACAAATGG + Intergenic
1116815147 14:49576855-49576877 CAATTATGGTAGAAGGCAAAAGG - Exonic
1117772437 14:59148238-59148260 CAAATATTAAAGATGAAAAAAGG - Intergenic
1117867461 14:60164968-60164990 CGACCAGTACAGAAGACAAAGGG + Intronic
1117974379 14:61282776-61282798 CAGGTATTATAGAAGACTGAGGG + Intronic
1118269470 14:64329037-64329059 CAATTATTGTAGGAGAAAAATGG + Intronic
1120148453 14:81005089-81005111 TAAATATTATAGGAGAGAAAAGG - Intronic
1120648465 14:87101741-87101763 CACCAATTATACAGGACAAAAGG + Intergenic
1120664580 14:87290988-87291010 CAATTATGGCAGAAGACAAAGGG - Intergenic
1120965388 14:90162861-90162883 CAACATATATAGAAGACAAAGGG + Intronic
1123111479 14:105869580-105869602 CAACTGTTCTTGAAGAAAAAAGG - Intergenic
1124471729 15:29993010-29993032 AAATTATCATAAAAGACAAATGG - Intergenic
1124821428 15:33049832-33049854 CAACAATTATAGACAGCAAAAGG - Intronic
1125785315 15:42311594-42311616 CAATTATGATGGAAGGCAAAGGG + Intronic
1126121615 15:45257427-45257449 CCAGTGTTATAGGAGACAAAAGG - Intronic
1126122591 15:45267163-45267185 AAAATGTTATAGAAGAGAAATGG - Intronic
1126503041 15:49368857-49368879 GAACTCTTATAGAGGAAAAAGGG - Intronic
1126929388 15:53631285-53631307 CAATTATGGTAGAAGGCAAAGGG - Intronic
1127482887 15:59393312-59393334 TAAGTATTATAGAAGCAAAATGG - Intronic
1128300353 15:66562939-66562961 CAAGTTTTTTAGAAAACAAAAGG + Intronic
1129972511 15:79791527-79791549 CAGAAATTATAGAAGACAAAAGG + Intergenic
1130566928 15:85004185-85004207 CAACTATTATGCATGGCAAAGGG - Intronic
1133558568 16:6928513-6928535 AAACGATTAGAGAAGACAAGAGG - Intronic
1134226634 16:12396227-12396249 CTACAATTATCGAAAACAAAGGG - Intronic
1135302454 16:21342866-21342888 AAACTACAATAAAAGACAAAGGG - Intergenic
1135353197 16:21747558-21747580 AAACTATTATAGAAGCCAGAGGG + Intronic
1135451684 16:22563681-22563703 AAACTATTATAGAAGCCAGAGGG + Intergenic
1136299260 16:29322381-29322403 AAACTACAATAAAAGACAAAGGG - Intergenic
1138255803 16:55558701-55558723 CCACTATTATAGAGCAGAAATGG + Intronic
1139183671 16:64776936-64776958 AAAATATTAAACAAGACAAATGG - Intergenic
1140236765 16:73166190-73166212 CACCTATTATAAAATACAAATGG + Intergenic
1142310343 16:89308754-89308776 GAACAATTCTAGAATACAAATGG + Intronic
1142435451 16:90053884-90053906 CAATTAAGGTAGAAGACAAAGGG - Intergenic
1143790292 17:9289548-9289570 CAAGAATTATAATAGACAAAGGG + Intronic
1145842883 17:28010962-28010984 CAATTATGATGGAAGAAAAAGGG - Intergenic
1147525521 17:41218584-41218606 CAAATATCAAAAAAGACAAAGGG + Intronic
1147584344 17:41645054-41645076 CAACTATGAAGAAAGACAAAAGG - Intergenic
1148525499 17:48329226-48329248 CCAGTATTAAAAAAGACAAAGGG - Intronic
1150868130 17:68876380-68876402 CAATTTTTACAGAAGAAAAATGG + Intronic
1150935601 17:69631990-69632012 CAACCATTATAGAAAACAATTGG + Intergenic
1151110505 17:71671090-71671112 CACCTATTATAAAAGAAGAAAGG + Intergenic
1151374258 17:73673621-73673643 CAACAATTATAGAATGCACATGG + Intergenic
1153602730 18:6797525-6797547 CTGCTATTACAGAAGACAAAAGG - Intronic
1155033810 18:22007307-22007329 CAGCTATTAAAGAAAAAAAAAGG + Intergenic
1155891631 18:31277617-31277639 CAACCATGACAGAAGGCAAAGGG - Intergenic
1155981824 18:32188344-32188366 CAATTATTATAACAGACCAATGG - Intronic
1156612312 18:38739274-38739296 CAACAAATGTAGAAGACAACAGG - Intergenic
1156792744 18:40996710-40996732 CAACTTATATAACAGACAAAGGG + Intergenic
1156839664 18:41596365-41596387 CTAGAGTTATAGAAGACAAAAGG + Intergenic
1157545574 18:48544262-48544284 CACCTATTATAAAAGGCAGATGG - Intronic
1158009043 18:52707424-52707446 CAGCCATTATAGAAAACATAGGG + Intronic
1158072379 18:53488210-53488232 CAACTAATTTAGAAGAGACAGGG - Intronic
1158790862 18:60778820-60778842 CAAATATGACAGAAGCCAAAGGG - Intergenic
1159348685 18:67241634-67241656 CTCCTATTACAGAAGACAACAGG + Intergenic
1159358498 18:67368812-67368834 CAATTATGGCAGAAGACAAAGGG - Intergenic
1159449317 18:68579540-68579562 CAACTATGGCAGAAGGCAAAGGG - Intergenic
1161740972 19:6021074-6021096 CAAGTATCTTAGGAGACAAAGGG - Intronic
1162544604 19:11321259-11321281 CAATTATAACAGAAGGCAAAGGG + Intronic
1164917402 19:32062905-32062927 CAACTATTGTGGAAGACAGTGGG - Intergenic
1167925242 19:52816210-52816232 CAATTATTATTGAATATAAATGG - Intronic
925457533 2:4028742-4028764 CAATCATAATGGAAGACAAAAGG - Intergenic
927077128 2:19589818-19589840 CATCTTTCATAGAAGAAAAATGG - Intergenic
927605778 2:24484945-24484967 CAATTATGATGGAAGACAAAAGG - Intergenic
927633518 2:24794087-24794109 GAACTAACATTGAAGACAAAGGG + Intronic
928732551 2:34248858-34248880 CAACTATCAAAAAAGACAGAGGG - Intergenic
928734365 2:34268819-34268841 CAACAATTAAAAAGGACAAAGGG - Intergenic
929817477 2:45245976-45245998 CAAAAACTATAGAAGAAAAAGGG + Intergenic
930149880 2:48048340-48048362 CAATTATTATATAATAGAAATGG - Intergenic
931143356 2:59488216-59488238 CAGCTGTTTTAGAAGAGAAATGG - Intergenic
931201649 2:60103368-60103390 CAAACATTATAGAAGTCCAAAGG + Intergenic
931358218 2:61555534-61555556 CAACTATTACAGAAAACCAAGGG + Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
933074162 2:77902235-77902257 CAACCATTAAATTAGACAAAAGG + Intergenic
933113664 2:78437714-78437736 CAATTATGGTGGAAGACAAAAGG - Intergenic
933540824 2:83639654-83639676 AAAGTAGTACAGAAGACAAAAGG + Intergenic
935386337 2:102503127-102503149 TGTCTATTATAGAACACAAATGG + Intronic
936766235 2:115851791-115851813 CAACCATGGCAGAAGACAAAGGG - Intergenic
937140164 2:119593454-119593476 CAACTATGGTAGAAGGCAAAGGG + Intronic
937796489 2:126028627-126028649 TAACAATTATAGTAGAAAAAGGG - Intergenic
938645874 2:133329484-133329506 CAAGTGTTATGGAAGAGAAAAGG + Intronic
939029758 2:137057532-137057554 CAACAGTGATAGAAGACTAAGGG + Intronic
939546280 2:143558131-143558153 CAGCTATTATAGAAGCTAAGTGG - Intronic
940341817 2:152589409-152589431 CAACTTTTATAGTTGGCAAAGGG - Intronic
941262204 2:163311617-163311639 AAAATATGATAGAAGAAAAAAGG - Intergenic
941291366 2:163679598-163679620 CAACTATTATAGAAAGAAGATGG - Intronic
942792162 2:179773155-179773177 AAATTATTATAGAAAACAATTGG - Intronic
943091399 2:183379227-183379249 CAAATATTTTACAAGAAAAATGG + Intergenic
943839114 2:192555050-192555072 CAACCATTATAGAAGCAAGAAGG + Intergenic
943918433 2:193668908-193668930 CTGCAATGATAGAAGACAAAAGG - Intergenic
944594692 2:201250465-201250487 CAATTATGGTGGAAGACAAAGGG + Intronic
944997250 2:205307794-205307816 CAGCTATTATATAAAAAAAATGG - Intronic
946512055 2:220368639-220368661 CTACTAATAAAAAAGACAAAAGG + Intergenic
947997789 2:234543538-234543560 CGTCTAATATAGAAGACTAATGG + Intergenic
1169286964 20:4317078-4317100 CAGGTATTTTATAAGACAAAAGG + Intergenic
1169640573 20:7746233-7746255 CAACCATGATGGAAGGCAAAGGG + Intergenic
1170360141 20:15537246-15537268 CAACCATGACAGAAGGCAAAAGG - Intronic
1171384405 20:24759417-24759439 CACCTATTAGAAAAGAAAAAAGG + Intergenic
1171936939 20:31283792-31283814 CCACTTTTATAGAAGTGAAAAGG + Intergenic
1173055695 20:39610492-39610514 CAACCATTGTAGAAGACAGTAGG + Intergenic
1173876093 20:46372716-46372738 CAACTATTAAAGAAAACAACAGG + Intronic
1174366873 20:50061776-50061798 TAAGTTTTAGAGAAGACAAATGG + Intergenic
1175457496 20:59126567-59126589 CAACTCTTAGAGGAGACAAAGGG - Intergenic
1175684016 20:61013825-61013847 CAATTATGGCAGAAGACAAAGGG + Intergenic
1177136625 21:17311036-17311058 CAAAGATTAAAAAAGACAAAGGG + Intergenic
1177489134 21:21799124-21799146 CAAATATTATATAAGGCAAATGG - Intergenic
1177720223 21:24896225-24896247 CAAGTATTATGGAAGATAAGAGG + Intergenic
1178031996 21:28538534-28538556 CAACTTTTATTGTAGACACAGGG + Intergenic
1178406386 21:32326721-32326743 CAATTATGGTAGAAGGCAAAGGG - Intronic
1178659748 21:34496918-34496940 CAACAATTTAAAAAGACAAAGGG - Intergenic
1179101787 21:38360804-38360826 CAATTATGATGGAAGGCAAAAGG - Intergenic
1182706031 22:32280976-32280998 CAACAGTTCTAGAAAACAAAAGG + Intergenic
1184394352 22:44224059-44224081 CAACAGTTCTAGAAAACAAAAGG + Intergenic
949135207 3:556242-556264 CAATTATGATGGAAGGCAAAGGG + Intergenic
949358253 3:3204303-3204325 CAACAATTAAGGAGGACAAAGGG - Intergenic
950944927 3:16935301-16935323 CAACAAATAGAAAAGACAAAGGG - Intronic
951051705 3:18101165-18101187 TAACTATTAAAGAACACACAGGG - Intronic
951292676 3:20892793-20892815 CAAATGTTCTAGAAGTCAAATGG + Intergenic
951936907 3:28032250-28032272 CAATCATGACAGAAGACAAAGGG - Intergenic
953090499 3:39720885-39720907 CAAGGATTTTAGAAGTCAAATGG - Intergenic
955251594 3:57288402-57288424 CACCTTTTATGAAAGACAAATGG + Intronic
955495751 3:59530548-59530570 CAACCATGGTAGAAGGCAAAGGG + Intergenic
955872780 3:63456933-63456955 CAACTCTGATAGAAAATAAAAGG - Intronic
956296618 3:67721810-67721832 AAACAATTATAAAAGAGAAAGGG - Intergenic
957503895 3:81094958-81094980 CAACTATTAAAAGAGAAAAATGG - Intergenic
957835070 3:85576880-85576902 AGACTATTATAGAATACAATAGG - Intronic
958034853 3:88157949-88157971 CTATTCTTATAGCAGACAAAAGG - Exonic
958072565 3:88633387-88633409 CAACTATGGTGGAAGACAAAGGG + Intergenic
958472901 3:94543918-94543940 AAACTAGTATAAAAGATAAAAGG - Intergenic
958561856 3:95758189-95758211 CAACTTTTATATTAGATAAAAGG + Intergenic
959129392 3:102334673-102334695 CAAATATTACTAAAGACAAATGG - Intronic
959215918 3:103449769-103449791 CAACTAAGATAATAGACAAATGG - Intergenic
961853674 3:129847747-129847769 CAACTACTTTGGAAGACAATTGG - Intronic
962934223 3:140064843-140064865 CAAAGATTAAAGATGACAAAGGG + Intronic
962934225 3:140064879-140064901 CAAAGATTAAAGATGACAAAGGG + Intronic
964132639 3:153307637-153307659 CAACTATTGCATAAGCCAAACGG + Intergenic
964901777 3:161668894-161668916 GAAACAATATAGAAGACAAATGG - Intergenic
965680269 3:171243497-171243519 CCACTTTTATAGAAAACAATGGG - Intronic
965767275 3:172144119-172144141 CAATTATGACAGAAGACGAAGGG + Intronic
966139423 3:176738126-176738148 CTCCTATTATAGAATACAAAAGG - Intergenic
966611916 3:181875991-181876013 TAACTTTTATAGAACATAAAAGG + Intergenic
966765204 3:183455240-183455262 TAAATATTAAAGAAGACAAAAGG + Intergenic
967066409 3:185920891-185920913 CAAATATTCTAGAATATAAATGG - Intronic
967142627 3:186574191-186574213 AAACTATTTTAAAAGAAAAAAGG - Intronic
967458509 3:189718388-189718410 CAACCATGACAGAAGGCAAAGGG + Intronic
967521886 3:190441402-190441424 CAACTGTCATATAAAACAAATGG + Intronic
967656267 3:192053544-192053566 CAATTATGGTGGAAGACAAAAGG + Intergenic
967665641 3:192168728-192168750 CAACTATTATAGAAGACAAAGGG + Intronic
970073980 4:12196548-12196570 CAACCATGAGAGAGGACAAAGGG + Intergenic
970097173 4:12477311-12477333 CAATCATGATAGAAGGCAAAGGG + Intergenic
971873930 4:32279902-32279924 CAACTATTATGGAAAACAGTGGG + Intergenic
971972872 4:33642724-33642746 CAACTTTTAGAGTAGAAAAAAGG - Intergenic
972293906 4:37718058-37718080 GAACTGTTATAGAAGTCTAAAGG + Intergenic
972860364 4:43161257-43161279 CAACTCTAATAGTTGACAAAAGG + Intergenic
973094151 4:46176370-46176392 CAACCATGATGGAAGGCAAAGGG - Intergenic
974318166 4:60308738-60308760 CAATTATCAGAGGAGACAAAAGG + Intergenic
974475725 4:62377240-62377262 AAACTATTAGAGAAGAATAAAGG + Intergenic
974751733 4:66150985-66151007 CAAGGATTGTAGATGACAAAAGG - Intergenic
975015964 4:69419929-69419951 AAAATATTATAGAAGTGAAAAGG - Intronic
975191511 4:71468462-71468484 CAATTATGATAGAAAAAAAAGGG - Intronic
975358184 4:73433005-73433027 GGACTATTATAGACAACAAAAGG - Intronic
975629203 4:76382220-76382242 CAATTATGACAGAAAACAAAGGG - Intronic
975716788 4:77212893-77212915 CAACAAGTATAGAAGAAACATGG - Intronic
976069893 4:81229565-81229587 CAACCCTTGTAAAAGACAAAAGG + Intergenic
976121879 4:81792040-81792062 CATCTATTCTGGAAGGCAAAGGG + Intronic
976416174 4:84778287-84778309 CAAATATTTTAGAAGTGAAATGG - Intronic
976551699 4:86403631-86403653 CAATCATGACAGAAGACAAAGGG + Intronic
977004901 4:91554191-91554213 AATCAATAATAGAAGACAAATGG - Intronic
978241485 4:106521878-106521900 CAGCAATTAAAGAAGCCAAAAGG - Intergenic
978920470 4:114177059-114177081 CAATTCTTATATAAGACAAAAGG + Intergenic
979857698 4:125654210-125654232 AAACTATTATAAAAGTGAAATGG + Intergenic
980630312 4:135422937-135422959 CAACCATTGTGGAAGACAATGGG - Intergenic
981358239 4:143817043-143817065 CATCTATTCTAGAAAACAGAAGG - Intergenic
981369484 4:143943161-143943183 CATCTATTCTAGAAAACAGAAGG - Intergenic
981379227 4:144053108-144053130 CATCTATTCTAGAAAACAGAAGG - Intergenic
982697670 4:158621981-158622003 CAGCTATTATGGAAAACATATGG + Intronic
982869064 4:160553195-160553217 CAACTATTATGAAATCCAAATGG - Intergenic
983180023 4:164636764-164636786 GAACTATTATAAAAAACATAAGG - Intergenic
983494730 4:168429880-168429902 TAATCATGATAGAAGACAAAGGG - Intronic
983802714 4:171954903-171954925 CAACCATAGTAGAAGGCAAAAGG - Intronic
984057131 4:174943462-174943484 CAACTATGGTGGAAGGCAAAGGG + Intronic
984973089 4:185208057-185208079 CAACTATTTTAGAGGCAAAAGGG + Intronic
985854002 5:2411022-2411044 CAACTATGAAATAAGGCAAAGGG + Intergenic
985877923 5:2614220-2614242 CAACCATTGTGGAAGACAGATGG - Intergenic
986180449 5:5388374-5388396 CAACACTTATGAAAGACAAATGG + Intergenic
986360862 5:6976467-6976489 CAATTATGGTAGAAGGCAAAGGG - Intergenic
986467427 5:8039755-8039777 AAACAATTAGAGATGACAAAGGG - Intergenic
987030207 5:13970049-13970071 CAACCATTAAAAAAGACAGAGGG - Intergenic
987501880 5:18721946-18721968 CAATCATGACAGAAGACAAAGGG - Intergenic
988829098 5:34970494-34970516 CAAATATATTAGCAGACAAATGG - Intergenic
988942300 5:36158792-36158814 CAACTATGATAAAAGAGACAAGG - Intronic
989019515 5:36985918-36985940 CAACTAGTAAAGATGACAAAAGG + Exonic
989607617 5:43259885-43259907 CAAAAATTATAGAAGAAAACAGG - Intronic
989762376 5:45032696-45032718 TGACTATTATAGAATAAAAAAGG - Intergenic
991098063 5:62760355-62760377 TATCTATTGTAGAAGTCAAATGG + Intergenic
991690630 5:69221864-69221886 AGACTATTATAGAAAACATAAGG + Intronic
993809644 5:92459411-92459433 CAATTATTATAGGAGTCACAGGG - Intergenic
993952046 5:94187848-94187870 CAACTGTCAAAGAAAACAAATGG + Intronic
994377464 5:99031155-99031177 CTACTATCAGAGAGGACAAAAGG - Intergenic
995207503 5:109498119-109498141 CAATTACTATAGAAAACAAATGG - Intergenic
995399258 5:111721792-111721814 CAATTATGGTAGAAGGCAAAGGG - Intronic
995758433 5:115538075-115538097 AAACTACTATAGAAAACAAAAGG + Intronic
996186603 5:120485235-120485257 CAATTATTATATAAAACATAGGG - Intronic
996255244 5:121393441-121393463 CATCTATTATAAAAGAGAAATGG + Intergenic
997105764 5:131017829-131017851 CAACAGTTAAAAAAGACAAAGGG - Intergenic
997637293 5:135422589-135422611 CAACAATAATAGCACACAAAGGG - Intergenic
999656311 5:153814063-153814085 CAACAATTACAAAAGACAAACGG + Intergenic
999931898 5:156442692-156442714 CATTTATAATAGAAGACAAAGGG - Intronic
1000752087 5:165109151-165109173 CAATATTTATAGAAGACAAGTGG + Intergenic
1000870216 5:166567504-166567526 AGAATATTACAGAAGACAAATGG + Intergenic
1000898508 5:166885525-166885547 CTTCTTTCATAGAAGACAAATGG - Intergenic
1000958847 5:167574852-167574874 CAACTCTCATAGCACACAAAAGG - Intronic
1001652172 5:173323773-173323795 CAACTTTTCTGGAACACAAAGGG + Intronic
1003662963 6:8081044-8081066 TAATTATTACAGAATACAAAAGG + Intronic
1003946498 6:11080796-11080818 CAATTATGAGGGAAGACAAAGGG + Intergenic
1004307180 6:14511587-14511609 CAAATATTTTAGAAGACACTGGG + Intergenic
1004461215 6:15838235-15838257 CAACCATTCTAGAAGACAAAAGG + Intergenic
1004476491 6:15978095-15978117 CAATCATGATGGAAGACAAAAGG - Intergenic
1004702674 6:18093556-18093578 CCACTAGTATAGAAGGCAAGTGG + Intergenic
1004713723 6:18196482-18196504 CTATTATCAAAGAAGACAAAAGG - Intronic
1005161207 6:22866287-22866309 CAACAATAAAAGGAGACAAAAGG + Intergenic
1006900573 6:37498199-37498221 TAACTATTTTAGAAGAGACATGG - Intronic
1007310907 6:40945437-40945459 CAATCATTATGGAAGGCAAAGGG + Intergenic
1007892871 6:45312206-45312228 CAACAGTTAAAAAAGACAAAAGG + Intronic
1007894858 6:45343942-45343964 CAACTAGTATAGAATATCAAGGG - Intronic
1008033413 6:46721461-46721483 CAATTATTTTTAAAGACAAAGGG + Intronic
1008273795 6:49520107-49520129 TAACTTGTAAAGAAGACAAAAGG + Intronic
1008720742 6:54348053-54348075 CAGCTCTTATAGAAGACACAAGG - Intronic
1009444771 6:63728908-63728930 CAACAATTTTGGAAGACAATTGG - Intronic
1010037956 6:71347560-71347582 CCTCTCTTATAGAAAACAAATGG + Intergenic
1011561065 6:88616417-88616439 CAGCCATTATGGAAAACAAAGGG - Intronic
1012863095 6:104585160-104585182 CACCTAATCTAGAACACAAAAGG - Intergenic
1013380941 6:109569848-109569870 CAACCATTGTGGAAGACAATGGG + Intronic
1013560232 6:111296422-111296444 CCACTATTATACAACTCAAATGG + Intergenic
1013652527 6:112210078-112210100 CAATCATGATGGAAGACAAAGGG - Intronic
1013804994 6:113986795-113986817 CAATCATGGTAGAAGACAAAGGG - Intronic
1014368930 6:120580733-120580755 CAACTATTGTGGAAGACAGTAGG - Intergenic
1014425907 6:121305876-121305898 CAATTATTATAGAGGAGAGATGG - Intronic
1014995007 6:128132119-128132141 AAAATACTATAAAAGACAAAAGG + Intronic
1015115212 6:129640977-129640999 CAAATATTATAGCAGAGAATGGG + Intronic
1015517450 6:134098109-134098131 ATATTATTATAGAAGACAAATGG + Intergenic
1016059539 6:139615266-139615288 CAAATATTAAAGAATTCAAAAGG - Intergenic
1016144792 6:140656372-140656394 TATCTATTACAGAAGCCAAAGGG - Intergenic
1017989309 6:159472351-159472373 CAATCATTGTGGAAGACAAAAGG + Intergenic
1019004604 6:168785806-168785828 CAAGAATGATAGAAGACAAGAGG + Intergenic
1021347431 7:19546008-19546030 CAAATATCAAAAAAGACAAAGGG - Intergenic
1021785333 7:24145810-24145832 TATCTATTGTGGAAGACAAAGGG - Intergenic
1022694279 7:32689008-32689030 CAATCATTGTGGAAGACAAAGGG - Intergenic
1023326439 7:39063321-39063343 CAACAATTATAGCAGAAAATAGG + Intronic
1024180978 7:46894607-46894629 CAACCATGATGGAAGGCAAAAGG - Intergenic
1024300402 7:47883266-47883288 CAACTCTTAGAGATTACAAAAGG + Intronic
1024352951 7:48385732-48385754 CAACTATTGTGGAAGACAGGTGG - Intronic
1024914751 7:54486789-54486811 CAATTATGATGGAAGGCAAAAGG + Intergenic
1027341277 7:77210776-77210798 CAATTATGACAGAAGGCAAAGGG + Intronic
1027454019 7:78365035-78365057 CAGCTATTTTAGAAAACAATGGG - Intronic
1027575461 7:79924931-79924953 AAACTCTTTAAGAAGACAAATGG + Intergenic
1028394007 7:90347513-90347535 TAGCTATTATAAAAAACAAATGG - Intronic
1028424922 7:90675917-90675939 AAACTATTATAGAAGAGGAGGGG + Intronic
1030229763 7:107195369-107195391 GGACTACTATAGAAAACAAATGG - Intronic
1030501174 7:110361627-110361649 GAACTGTTATAACAGACAAAAGG - Intergenic
1031718935 7:125144370-125144392 TAACTATATTAAAAGACAAATGG + Intergenic
1031734730 7:125343631-125343653 CAAATAAAATAGAAGACAGAAGG - Intergenic
1031741606 7:125438675-125438697 CAAATATTTTAGAATAAAAATGG - Intergenic
1031762661 7:125734119-125734141 CAATTATCATGGAAGACAAAGGG + Intergenic
1032640899 7:133766680-133766702 CACCTACTATAGAAGAGAGAGGG + Intronic
1033071827 7:138209818-138209840 CAATTATGATGGAAGGCAAAGGG + Intergenic
1033793051 7:144815594-144815616 CAACAAACATAGAAGTCAAAAGG + Intronic
1034003220 7:147440422-147440444 CAACTACTTTTGAAGACATATGG - Intronic
1034076240 7:148233983-148234005 CAATCATAGTAGAAGACAAAGGG - Intronic
1034384629 7:150729910-150729932 CAATCATTGTGGAAGACAAAGGG - Intronic
1035308341 7:157948199-157948221 TAAATCATATAGAAGACAAAAGG - Intronic
1035929710 8:3766499-3766521 CAAGTATTATAGGAGGCAAAGGG - Intronic
1036223727 8:6941486-6941508 CAATCATGGTAGAAGACAAAAGG + Intergenic
1036412441 8:8514707-8514729 TAAATAGTATAGAAAACAAAAGG - Intergenic
1036987391 8:13550319-13550341 CAATTATGACAGAAGACAAAGGG - Intergenic
1037130016 8:15397245-15397267 CAACTGTTTCAGAAGACCAACGG - Intergenic
1037147647 8:15592587-15592609 CAATCATGATAGAAGACAAAGGG - Intronic
1037370590 8:18173337-18173359 GACCTATTGTAGAAGACAGATGG - Intronic
1039084100 8:33762575-33762597 CAACTACTATGGAGGACAATTGG - Intergenic
1039584560 8:38695222-38695244 CTACTATGAAAGAGGACAAAAGG - Intergenic
1040628937 8:49186098-49186120 CAAATATTACTGAAGACAGAGGG - Intergenic
1040948823 8:52915178-52915200 GAACTTTAATAGAAGACTAAAGG - Intergenic
1041216294 8:55604637-55604659 CATCTATTTCTGAAGACAAAAGG - Intergenic
1041330449 8:56718762-56718784 CAACTATTCTAAAAGACTCAAGG + Intergenic
1041833821 8:62188156-62188178 CAACTATCATAGAAGAAATAGGG + Intergenic
1043044963 8:75311473-75311495 AAACTATTTTAAAAGACAAAGGG - Intergenic
1043047220 8:75341830-75341852 CAGCTTTTATAGAAGAGTAAAGG + Intergenic
1043130871 8:76459314-76459336 AAACTTTTTTAGAAGATAAATGG - Intergenic
1044019885 8:87093081-87093103 CATCTATTCTAGAAGTCAGAGGG - Intronic
1044193842 8:89351862-89351884 CAATTATAATGGAAGGCAAAAGG + Intergenic
1044381525 8:91539675-91539697 CAACCATGGTAGAAGGCAAAGGG - Intergenic
1044765360 8:95566400-95566422 CTACTATTAAAAAATACAAAAGG - Intergenic
1044912018 8:97069925-97069947 CATTAATTATAGAAGACAAAAGG + Intronic
1045154777 8:99455401-99455423 CAATTATGGCAGAAGACAAAGGG + Intronic
1045942777 8:107757489-107757511 CAATTATGGTGGAAGACAAAGGG - Intergenic
1046998286 8:120548178-120548200 CAATTATGATGGAAGGCAAATGG - Intronic
1047038291 8:120964272-120964294 CAAAGATCATAGAAAACAAAGGG - Intergenic
1048664803 8:136649038-136649060 CTACTGTTATAGAAAACATAAGG - Intergenic
1048729977 8:137427546-137427568 CAACCATTGTGGAAGACAATAGG - Intergenic
1049051944 8:140204688-140204710 CAATCATGATAGAAGGCAAAGGG - Intronic
1049634234 8:143678121-143678143 GAACTATAATAAAAGACCAATGG + Intergenic
1050440715 9:5660425-5660447 CAACCATTATGGAAGACAGTAGG - Intronic
1051712251 9:19943779-19943801 CAAGTATTAGTGAAGAGAAAAGG - Intergenic
1053273842 9:36768655-36768677 GAACAATTATAGGAAACAAAGGG + Intergenic
1053470235 9:38341078-38341100 CAATTATGATGGAAGGCAAACGG + Intergenic
1057213601 9:93215491-93215513 TAAAACTTATAGAAGACAAAGGG - Intronic
1057749846 9:97783535-97783557 CAACTACAATAGTAGAGAAATGG + Intergenic
1057967849 9:99521557-99521579 CAACTATAATAGAATACCAGAGG - Intergenic
1060501296 9:124158142-124158164 CAACTCTTACAGAAAACAAAGGG - Intergenic
1061445970 9:130638217-130638239 TAACTATTAAAAAAGACAATTGG + Exonic
1186004729 X:5056784-5056806 CAATTATGATGGAAGACAAAGGG - Intergenic
1186145900 X:6623224-6623246 CAATTATTGGAGAAGGCAAAGGG - Intergenic
1187083405 X:16015541-16015563 CAACCATTGTAAAAGGCAAAAGG + Intergenic
1187329520 X:18324128-18324150 CAACTATAAGAGAAGACACATGG + Intronic
1187474055 X:19594159-19594181 CAACTAAAATAGAAGAGAAAGGG - Intronic
1187936445 X:24340901-24340923 CAACTATTATAGAATGGGAATGG + Intergenic
1188259838 X:28009276-28009298 CAATCATGATAGAAGCCAAAGGG + Intergenic
1188263208 X:28041278-28041300 CAATTATGGCAGAAGACAAAGGG + Intergenic
1188609282 X:32076232-32076254 CAGCTATGATACAAGGCAAATGG + Intronic
1188871920 X:35382929-35382951 CAACTGCTATAGGAGCCAAAGGG + Intergenic
1189949435 X:46213705-46213727 CAATTATGGTAGAAGGCAAATGG + Intergenic
1190132033 X:47756856-47756878 CAATTATAGCAGAAGACAAAAGG + Intergenic
1190654520 X:52599184-52599206 CAACTTTCATGGATGACAAAGGG + Intergenic
1191207582 X:57850650-57850672 CAAAGATCATAAAAGACAAAAGG - Intergenic
1192079621 X:68033896-68033918 CAATTATGACAGAAGGCAAAGGG - Intergenic
1192867123 X:75146313-75146335 CAACTATTTTAAAATCCAAATGG + Intronic
1193007765 X:76640327-76640349 CAACAGTTAAAAAAGACAAAGGG - Intergenic
1193040629 X:77000151-77000173 CAACTATTGTGGAAGACAGTGGG + Intergenic
1194121317 X:89966755-89966777 CAACTATAGCAGAAGGCAAAGGG + Intergenic
1194132463 X:90097928-90097950 AAACTGTTATAAGAGACAAATGG - Intergenic
1194144531 X:90246333-90246355 CAGCAATAATAAAAGACAAAGGG + Intergenic
1194152105 X:90338632-90338654 TAACTATGATTGAAGAAAAATGG - Intergenic
1195574463 X:106434447-106434469 CATCTAGTATAGGAGAGAAAAGG - Intergenic
1196983524 X:121242070-121242092 CAACCATTGTAGAAGAAAAAAGG - Intergenic
1197417844 X:126196991-126197013 CAATTATGGTAGAAGGCAAAGGG - Intergenic
1197541412 X:127766936-127766958 AAACTATAAAAGGAGACAAAGGG + Intergenic
1198142898 X:133823606-133823628 CAACTATTATACAATATAAAAGG + Intronic
1198333934 X:135649036-135649058 CGACTATTATAAAGAACAAAGGG - Intergenic
1199201163 X:145090854-145090876 TAAGTATGATAGAAGTCAAATGG - Intergenic
1199250919 X:145660452-145660474 CAATTATGATAGAAGGCGAAGGG - Intergenic
1199273199 X:145909897-145909919 CAATCATTGTGGAAGACAAAGGG - Intergenic
1199998763 X:153045295-153045317 CAATAATAATAGAAGACAAATGG + Intergenic
1200405126 Y:2802328-2802350 CAACCATTATGGAAGACAGTGGG - Intergenic
1200474173 Y:3624206-3624228 CAACTATAGCAGAAGGCAAAGGG + Intergenic
1200478257 Y:3668014-3668036 AAACTGTTATAAGAGACAAATGG - Intergenic
1200490288 Y:3815638-3815660 CAGCAATAATAAAAGACAAAGGG + Intergenic
1200498458 Y:3915384-3915406 TAACTATGATTGAAGAAAAATGG - Intergenic