ID: 967667209

View in Genome Browser
Species Human (GRCh38)
Location 3:192187643-192187665
Sequence TTGAATAAGAATCAGGACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967667206_967667209 18 Left 967667206 3:192187602-192187624 CCATACTGTGAGGTATAAGATTA 0: 1
1: 0
2: 0
3: 9
4: 111
Right 967667209 3:192187643-192187665 TTGAATAAGAATCAGGACCAAGG 0: 1
1: 0
2: 0
3: 19
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967667209 Original CRISPR TTGAATAAGAATCAGGACCA AGG Intronic
901499229 1:9641350-9641372 TTGTATCAGAAGCAGGACTAGGG + Intergenic
904993009 1:34608879-34608901 TTGAATAGGAATAAGGAAAACGG - Intergenic
908562401 1:65319764-65319786 TAAAATAAGAATAAGGATCAGGG - Intronic
909272421 1:73640692-73640714 TTGAACAAGAATCAGGAATCAGG - Intergenic
909544755 1:76833664-76833686 GTGGAAAAGAATCAGAACCATGG - Intergenic
913615315 1:120553846-120553868 TTGACTCAGAATTAGGACAAAGG + Intergenic
914574962 1:148957062-148957084 TTGACTCAGAATTAGGACAAAGG - Intronic
915206095 1:154271559-154271581 TTGAAAAAGAATCTAGAGCAAGG + Intergenic
915457213 1:156048744-156048766 CTGTATCAGGATCAGGACCAGGG + Intronic
916379113 1:164188870-164188892 TTGAATAAGAATTCGGCACAAGG + Intergenic
917221625 1:172736193-172736215 TTGAAAAAGAATCAGAAAAAAGG + Intergenic
921759344 1:218895107-218895129 TTTAATAAGAATCAAAACCTGGG + Intergenic
923658854 1:235941395-235941417 TAGAATGAGAATCAGGTCCTGGG - Intergenic
1063724729 10:8624261-8624283 TTAAATAGGAAGCAGAACCAGGG - Intergenic
1063878146 10:10501941-10501963 TTGAAAAAGAAACAGGAATAGGG - Intergenic
1064745413 10:18473854-18473876 TTGTATCAGAACCAGGGCCAGGG + Intronic
1064880653 10:20049313-20049335 TTGAATAAGAATGACGACAGAGG - Intronic
1068046696 10:51895371-51895393 TGGAGTAAGAATCAGGACCTTGG + Intronic
1068064192 10:52108428-52108450 TTGAATATGAAACAAGAGCAGGG - Intronic
1068787530 10:60992382-60992404 TTGAATAAGAGTCATTACAAGGG + Intronic
1070160494 10:73863905-73863927 TAGAATCAGAATGAGGATCAAGG - Intronic
1070315203 10:75303556-75303578 TTAAGAAAGAATCAGGAGCAGGG - Intergenic
1070904506 10:80059850-80059872 TTGATAAAGAATCTGGGCCAGGG - Intergenic
1071323898 10:84492505-84492527 TTGAATAAGAATTATGAGAATGG + Intronic
1071443749 10:85727397-85727419 TTAAATAAGTATGAGGACCTGGG + Intronic
1072300226 10:94053707-94053729 TTGAATAAGGGCCAGGACTAGGG + Intronic
1073085739 10:100887493-100887515 TTGAGGAAGAATGAGGAGCAAGG - Intergenic
1076383321 10:130039702-130039724 ATGAATGAGAAACAGGCCCAGGG - Intergenic
1079504722 11:21140814-21140836 ATGAATAATAAACAGGCCCATGG + Intronic
1080993691 11:37574741-37574763 TTGAGTAATAAGCAAGACCAGGG + Intergenic
1081384512 11:42455804-42455826 TTCAGTTAGAATCAGCACCAAGG - Intergenic
1081948912 11:47025437-47025459 TTGAATTATAATCAAGTCCAAGG + Intronic
1082194318 11:49283720-49283742 TTGAATAATAATTACAACCAGGG - Intergenic
1083876913 11:65529106-65529128 GAGAATCAGAATCAGGAGCAGGG + Intronic
1084044840 11:66562564-66562586 TGGAAAAAAAATCAGGACCAGGG + Intronic
1085380837 11:76116378-76116400 TAGAATGAGCATCAGGACCATGG + Intronic
1085846971 11:80077129-80077151 GTGGTAAAGAATCAGGACCAGGG - Intergenic
1087223912 11:95576814-95576836 TAAAATAAGAAACAGGTCCAGGG - Intergenic
1087231200 11:95667452-95667474 ATGAAGAAGGATCAGGACCATGG - Intergenic
1089515117 11:119027271-119027293 ATGAATGAGAAACAGGACCAGGG + Intronic
1091409940 12:232745-232767 TTGAGAAACACTCAGGACCAGGG + Intronic
1091686800 12:2568122-2568144 CTGGAGAAGAATCAGCACCAAGG - Intronic
1092254841 12:6921097-6921119 TGAAATAAGAATCAGGAGCCAGG + Intronic
1093771083 12:23019483-23019505 TGGAATAAGAATGAAGACCATGG + Intergenic
1094043512 12:26142510-26142532 TTCAATAAGAATAAGGAATATGG + Intronic
1096600171 12:52723468-52723490 TTGAGCAAGAATCAGGGCCCTGG - Intergenic
1098188853 12:67926570-67926592 TGGAAGAAGAAGCAGGCCCATGG - Intergenic
1101456890 12:104842017-104842039 TTGAATAAGAGCTTGGACCAAGG + Intronic
1102488400 12:113273606-113273628 ATGAAGAAGACGCAGGACCAGGG - Exonic
1106919630 13:34549523-34549545 TTCAACAAGAAACAGCACCATGG - Intergenic
1108564097 13:51677238-51677260 CTGAAAAAGATTCAGGACCCTGG + Intronic
1108718130 13:53102602-53102624 TTGAATAATAATCAGGATTGTGG - Intergenic
1109226903 13:59708012-59708034 TTGAAGAGGAATTAGGATCAAGG - Intronic
1110011732 13:70344396-70344418 ATGAGTAAGAATCAGGGCAAAGG + Intergenic
1110683317 13:78342020-78342042 TTGAGGAAGAAGCAGGAGCATGG - Intergenic
1111961542 13:94816132-94816154 ATGAATAAGAATTAGGAGGAGGG + Intergenic
1113094390 13:106648406-106648428 TTGAATATGAATGAGGACTAGGG + Intergenic
1114722146 14:24893946-24893968 AAGAATAAAAATCAGGACCAAGG + Intronic
1114883016 14:26810047-26810069 TTGAATAAAAATCAGCAGCTCGG - Intergenic
1116942917 14:50808918-50808940 TTTATAAAGAATCAGGGCCATGG + Intronic
1116955492 14:50918840-50918862 TTTAATAAGACTCTGGTCCAAGG - Intronic
1117232963 14:53741042-53741064 TTGAAGAAGAAGAAGGAGCAAGG - Intergenic
1126891816 15:53213713-53213735 TTGAAGAAAATTTAGGACCATGG - Intergenic
1127562511 15:60153277-60153299 TTGAATAACTATTAGGAACAAGG + Intergenic
1134291481 16:12905330-12905352 TTGAATAAACATCAGGATCTGGG + Intronic
1138100765 16:54250340-54250362 TTGAAAAAGAATGAGGGCCGTGG + Intronic
1139710026 16:68769058-68769080 TTGAATAGTAATCAGTGCCATGG - Intronic
1143100932 17:4504344-4504366 TTGAAAAGGAAGCAGGAGCAAGG - Intronic
1144356803 17:14454244-14454266 TGGAATGAGAAACAGTACCATGG - Intergenic
1150689344 17:67351088-67351110 ATCACTAACAATCAGGACCATGG + Intronic
1151047160 17:70934272-70934294 TTCTATTAGAATCAGGAACACGG - Intergenic
1153031665 18:719071-719093 TTGAAAATTAATCAGGACTATGG + Intergenic
1155240695 18:23861319-23861341 ATGAATAAAAACTAGGACCATGG - Intronic
1157589988 18:48830639-48830661 TAGAATAAGGCTCAGGACCTTGG + Intronic
1157913508 18:51641498-51641520 TTGAAAAATAATCAGGTTCACGG - Intergenic
1158265622 18:55657969-55657991 TTGAATTATAATCAGGATCCAGG + Intronic
1159372063 18:67540897-67540919 GAGAATAAGACTCGGGACCATGG + Intergenic
1159406139 18:68005312-68005334 TTGATTAAAAATCCAGACCAAGG + Intergenic
1164734739 19:30532494-30532516 TTGAATTATAAGCAGGACTAAGG - Intronic
1166077089 19:40420055-40420077 AAGAATAAGAAACAGGCCCACGG + Intergenic
926439378 2:12871881-12871903 TTGAATAAGTAGCAGACCCAGGG - Intergenic
930784928 2:55262413-55262435 TTTAATAGGAAGAAGGACCATGG - Exonic
932104136 2:68927459-68927481 TTGCAAATGAATAAGGACCACGG + Intergenic
932192566 2:69753291-69753313 TTGCATAAGAATCAGGGCCTGGG + Intronic
933628103 2:84625252-84625274 CTGGATAAGAATCAAGGCCAGGG + Intronic
934932351 2:98436823-98436845 AAGAATAAGGATCAGGACAAAGG - Intergenic
935366293 2:102294560-102294582 TGTAATAAGAATCAAGACCATGG - Intergenic
939424781 2:142020782-142020804 TTGGATTAGAATCAAGATCAAGG + Intronic
940520184 2:154735412-154735434 TAGAATAAGAAACAGGCCTATGG - Intronic
941996621 2:171607305-171607327 ATGAATAAAAATCATGTCCAGGG + Intergenic
943951947 2:194141432-194141454 TTGAAGAAGACTCAGGAACAGGG - Intergenic
946002779 2:216496681-216496703 TTGAATTAAAATCAGGTCCCTGG - Intergenic
948610673 2:239164506-239164528 TTGAAAAAGAATCACCGCCACGG - Intronic
1169160274 20:3371718-3371740 TAGAATAAGAATTAGGAAAAGGG - Intronic
1169530109 20:6475952-6475974 TTGAGTAAGAATCAGGATATTGG - Intergenic
1169915869 20:10682639-10682661 ATGAATAAATATCAGGACCAAGG + Intergenic
1169995449 20:11551110-11551132 GTGAATAAGCCTCTGGACCATGG + Intergenic
1173111391 20:40193715-40193737 TAGAATAAGAAGCATGAACAAGG - Intergenic
1173336544 20:42116719-42116741 TTGAATAATAACTAGGAACATGG + Intronic
1173360259 20:42337873-42337895 TTTAGTAGGCATCAGGACCAAGG - Intronic
1173522592 20:43710753-43710775 TTGACTCAGAATCAGTTCCATGG - Intronic
1173650072 20:44657823-44657845 CTGAATAAGAAAGAGGACAAGGG + Intergenic
1174261201 20:49296605-49296627 ATGAATTAATATCAGGACCATGG - Intergenic
1177554844 21:22676082-22676104 TTGCATAAGAATAAGAACAAAGG + Intergenic
1184944192 22:47789886-47789908 CCCAATAAGAATAAGGACCATGG + Intergenic
951284984 3:20799817-20799839 TTGAATAAGAATGATGACAGTGG + Intergenic
951903594 3:27681160-27681182 TTGAATCAGAAACAAGAACAAGG + Intergenic
956148471 3:66216218-66216240 TTCAATAAAAATCAGTAACATGG + Intronic
956858409 3:73298578-73298600 TTGTATAAAAATCAGGACAGGGG - Intergenic
956933922 3:74078087-74078109 TTGGAGAAGAATCAGGTTCAAGG - Intergenic
958504923 3:94963891-94963913 TTGAATAACAATTTGGACAATGG + Intergenic
958857745 3:99407128-99407150 TTCAATAAAATTCAGCACCATGG - Intergenic
958920860 3:100103902-100103924 ATTAATAAGAATCATGAGCACGG + Intronic
960280928 3:115780778-115780800 TGTGATAAGAACCAGGACCATGG + Intergenic
967667209 3:192187643-192187665 TTGAATAAGAATCAGGACCAAGG + Intronic
968780297 4:2575351-2575373 TTGAAGGAGGATCAGGAGCATGG + Intronic
970967509 4:21945704-21945726 TTGAAAGAGAATCAGAAACAAGG - Intronic
971637802 4:29085297-29085319 GTGAAAAAGAATCAGTACAATGG + Intergenic
971938486 4:33185547-33185569 TTTAAAAAAAATTAGGACCAGGG + Intergenic
971991303 4:33898537-33898559 TTGAATTAGAAATATGACCAGGG - Intergenic
973848889 4:54941482-54941504 TGAAATAAGGATCAGGACAATGG + Intergenic
975821792 4:78278362-78278384 ATGAATAAGAAGGAAGACCAAGG - Intronic
976868694 4:89763856-89763878 TTGAATAAGAATATGTACAAGGG - Intronic
977807505 4:101319620-101319642 TTCAATAAGAATCAGGTTAATGG + Intronic
979880807 4:125957177-125957199 CTGAATAAAAAAGAGGACCATGG - Intergenic
980380870 4:132014334-132014356 TTTAATAAGAATCAGCACAGGGG - Intergenic
980539229 4:134171623-134171645 TTGAATAGGAATCATGACAGTGG - Intergenic
980999657 4:139816568-139816590 TTGCATGAGAATTAGGACCTTGG - Intronic
982247396 4:153366950-153366972 GTGATTAAGAATGAGGACCCTGG - Intronic
986068136 5:4256064-4256086 TTGTCTAAGAATCAAGTCCAAGG + Intergenic
986773410 5:10993812-10993834 TCTAATAAGAATTAGGAACATGG + Intronic
991312853 5:65263851-65263873 ATGAATAACAATAAGGAACATGG + Intronic
991428493 5:66517496-66517518 TTGGCTAAGAATCAGGAGCATGG + Intergenic
992933664 5:81678055-81678077 CTGAACAAGAACCAGAACCAGGG + Intronic
993942287 5:94074002-94074024 TAGGTTAAGAATCAGGAACAAGG - Intronic
994564757 5:101429004-101429026 TTTAACAAGAATCATCACCAAGG - Intergenic
995028789 5:107456081-107456103 TTGAAAAAGAATTAGGAACCTGG + Intronic
995340023 5:111048113-111048135 TAGAATATGATTCAGGACCAGGG - Intergenic
996860328 5:128058366-128058388 TAGAATGAAAAACAGGACCAAGG - Intergenic
1004158317 6:13190625-13190647 TTGTGTAAGAGTCAGGAGCAGGG + Intronic
1005534796 6:26744489-26744511 GCCAATAAGATTCAGGACCAGGG - Intergenic
1007232928 6:40361638-40361660 TTAAATAAGAATCAGGGACAAGG + Intergenic
1007769243 6:44179991-44180013 TTCACGAAGTATCAGGACCACGG + Exonic
1008200755 6:48586570-48586592 TTGTTTGAGAATAAGGACCATGG - Intergenic
1008559820 6:52712995-52713017 TTGTATGATAACCAGGACCAGGG + Intergenic
1008969176 6:57346762-57346784 TTGGATGAGAATAAGAACCAGGG + Intronic
1009158154 6:60248580-60248602 TTGGATGAGAATAAGAACCAGGG + Intergenic
1013210565 6:107983197-107983219 TTAAAAAAGAATCAGGAGCGAGG + Intergenic
1014008445 6:116448485-116448507 GTGATTAAGAATCAGGACAGTGG - Intergenic
1014490721 6:122058497-122058519 TTGAATTAGAATGAGGAGAAAGG + Intergenic
1014608924 6:123516804-123516826 ATGAATAAGAATTATGACTAAGG - Intronic
1014698678 6:124656170-124656192 TAGCAGAAGAATCAGGTCCATGG - Intronic
1016805985 6:148212372-148212394 GTGATTAAGAATTAGGACCTTGG + Intergenic
1021351399 7:19598521-19598543 TTGAATAGGAATGAGGACAGTGG + Intergenic
1021387385 7:20048114-20048136 TTGCATAAGAATCACGCCAAGGG - Intergenic
1022270955 7:28807509-28807531 CTGTAAAAGAATCAGGCCCAGGG - Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023088116 7:36592649-36592671 CAGAATAAGAATCTTGACCAAGG - Intronic
1024655429 7:51447861-51447883 TAGAATAAGGATAAGGACAAAGG - Intergenic
1026527845 7:71171037-71171059 TTGAGGAAGAAACAGGACAAGGG + Intronic
1026957598 7:74387550-74387572 GTGAACAAGAAGCAGGGCCAGGG - Intronic
1027333403 7:77122704-77122726 CTAAATAAGGATCAGGACCAAGG + Exonic
1027464378 7:78496778-78496800 TTGGTTAAGAACAAGGACCATGG + Intronic
1029782391 7:102748610-102748632 CTAAATAAGGATCAGGACCAAGG - Intergenic
1029819672 7:103133895-103133917 TTGAATCAAAATCAGTACAATGG - Intronic
1031493725 7:122421540-122421562 TTGAATCAAATTCAGGGCCACGG - Intronic
1032454363 7:132061663-132061685 TTGAATAATAATAAGTAACATGG + Intergenic
1033228402 7:139578444-139578466 TAGACTAAGAATCAGTACCATGG - Intronic
1039438002 8:37573907-37573929 TTGAATAAGAATAACTAGCATGG + Intergenic
1040083991 8:43320486-43320508 ATGAATAAAAATAAAGACCAAGG - Intergenic
1040891467 8:52321467-52321489 TTAAATAATAATCAAGACAATGG + Intronic
1041629735 8:60073275-60073297 GTCAATAAGATTAAGGACCAGGG - Intergenic
1041793953 8:61726530-61726552 TAAAATAATATTCAGGACCATGG - Intergenic
1042704789 8:71654704-71654726 TTTAATAACATTCAGGACTAGGG + Intergenic
1045624405 8:104026137-104026159 TTGCATAAGAAACAATACCAGGG + Intronic
1052823464 9:33158261-33158283 TAGAAAAAGAATAAAGACCAGGG + Intronic
1055045985 9:71924230-71924252 TTGGAAAAGAATTAGGACTAAGG - Intronic
1057542108 9:95985232-95985254 CTACTTAAGAATCAGGACCATGG + Intronic
1061234299 9:129333678-129333700 TTGAATAAAAAACAGAACCTTGG - Intergenic
1187474570 X:19599753-19599775 CTAAATAAAAATCAGGACCAGGG + Intronic
1188164349 X:26843604-26843626 TTGAACAAGAATCAGCTACATGG - Intergenic
1188796837 X:34477546-34477568 TTGAATAAGAATGATGAGAAAGG + Intergenic
1191868816 X:65728042-65728064 TTGGATCAGAATAAGGACCGAGG + Intronic
1192103756 X:68293345-68293367 TTAAACAAAAATCAGGATCAGGG + Intronic
1192203471 X:69081733-69081755 TGGGATAAGAATGAGGACCTGGG - Intergenic
1192989897 X:76439462-76439484 TTGAATAAGACTAATGACAATGG + Intergenic
1198445601 X:136710763-136710785 TTGGAAAAGAGTCAGGGCCAAGG - Intronic
1199680019 X:150217829-150217851 TGCAATAAGAACCAGGGCCAAGG + Intergenic
1201494993 Y:14583350-14583372 TTGAATTATAATCTGAACCATGG - Intronic