ID: 967669899

View in Genome Browser
Species Human (GRCh38)
Location 3:192220309-192220331
Sequence ATAGGGAAGTAGAATGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 325}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967669899 Original CRISPR ATAGGGAAGTAGAATGGTGA AGG (reversed) Intronic
901605629 1:10456936-10456958 ATAGGGAAGGTAAATGGTAATGG + Exonic
903494223 1:23754016-23754038 AAAGGGAAGTAGGAGGCTGAAGG + Intronic
904268886 1:29335527-29335549 ATAGGCAAGTTAAATGGGGATGG - Intergenic
905945352 1:41897152-41897174 ATAGCCAACGAGAATGGTGAAGG + Intronic
906883980 1:49624597-49624619 AAAGGAAAGAAGAAAGGTGAAGG - Intronic
907165975 1:52411700-52411722 AAAGGGAAGCAGGATGGTGAAGG - Intronic
907920756 1:58909495-58909517 AAAGGGAAGAAGAAGGATGATGG + Intergenic
908305145 1:62806633-62806655 ATAGGAAAGGAGAAAGGTGTGGG + Intronic
909332618 1:74432431-74432453 AGAGAGAAATAGAAGGGTGACGG - Intronic
909494113 1:76259024-76259046 ATAGGGAAACAGAATTGAGAAGG - Intronic
909583826 1:77266890-77266912 ACAGGGAAGCAGAATGAAGAAGG + Intergenic
909762518 1:79309562-79309584 ATAGAAAAGCAGCATGGTGATGG + Intergenic
910388316 1:86708530-86708552 GGAGGGAAGTGGAGTGGTGATGG - Intronic
911204157 1:95075799-95075821 ATAGGTAATTATAATAGTGAGGG - Intergenic
911288579 1:96028167-96028189 AAAGGCAAGCAGAGTGGTGAGGG + Intergenic
912146822 1:106804282-106804304 ATAGGGATGTAGCATCTTGAAGG + Intergenic
912195333 1:107391086-107391108 ATAGGAGAGTAGAATGCTGTAGG + Intronic
916444638 1:164860972-164860994 ATAGAGGAGTAGCATGGTGTAGG + Intronic
917468370 1:175304893-175304915 ATAGGGAAGTGGAAAAGGGAAGG + Intergenic
917787760 1:178477171-178477193 AAAGGGAAGGAGAATGGAGAAGG - Intronic
918832934 1:189422076-189422098 ATAGGCAAGCAGAATGAAGAAGG - Intergenic
919393133 1:197012772-197012794 ACAGGGAAGTAGTAAGGTAAAGG - Intergenic
919666793 1:200300252-200300274 ATAAGGAAGGAGAGTAGTGAAGG - Intergenic
921250365 1:213291748-213291770 AGAGGGAAGCAGAATGGTGTGGG - Intergenic
921527539 1:216236334-216236356 ATAGAGAAGTAGTAAAGTGAAGG - Intronic
921601020 1:217106625-217106647 ATAGGGAAGAAGACTGCTAAGGG - Intronic
922014831 1:221634711-221634733 ATAGCCAAGGAGAAGGGTGAAGG + Intergenic
922493261 1:226035849-226035871 AGAGGGAAGTAAAAAGGTGAAGG - Intergenic
924599661 1:245477529-245477551 GTACGGAAGTGGAATGGTGCAGG + Intronic
1063560074 10:7117986-7118008 ATAAGTAAGTAGGATGGAGAAGG + Intergenic
1064569675 10:16679765-16679787 CTAGGGCAGAAGGATGGTGATGG - Intronic
1064753192 10:18553035-18553057 ATTGGGAAATGGAATGGAGAAGG - Intronic
1065553940 10:26895380-26895402 GGAGGGGAGGAGAATGGTGAGGG - Intergenic
1065599373 10:27353219-27353241 GGAGGGGAGGAGAATGGTGAGGG + Intergenic
1068656037 10:59577390-59577412 ATAGGGAACTGGAATGGAGATGG + Intergenic
1068781905 10:60928636-60928658 AAAGGGGAGTAGAAAGGGGATGG + Intronic
1068829125 10:61472906-61472928 ATAGGGAGGTAGGTTGGAGAGGG + Intergenic
1069219411 10:65864805-65864827 ATAGGGAATCAGAATGAAGAAGG + Intergenic
1070490774 10:76974416-76974438 ATGGTAAAGTAGAATGTTGAGGG + Intronic
1071021478 10:81062075-81062097 CTAGAGATGAAGAATGGTGATGG - Intergenic
1071022165 10:81070321-81070343 ATAGGGAAGAAAAATGTTTAGGG + Intergenic
1071479322 10:86052693-86052715 ATAGAGAAGAAGAATGGGAAAGG + Intronic
1071889942 10:89993473-89993495 AAAGGGTGGGAGAATGGTGAGGG - Intergenic
1071932018 10:90483261-90483283 AAAGGGTAGAAGAAGGGTGAGGG - Intergenic
1072265602 10:93724126-93724148 CTAGGGAAGCACCATGGTGAAGG + Intergenic
1072402985 10:95124618-95124640 ATAGGGAAGTAGAGAGGGAAGGG + Intergenic
1072467296 10:95677721-95677743 AAAGAGAAGTGGGATGGTGAAGG + Intronic
1074180743 10:111060371-111060393 ATAGAGAAGGAAAAGGGTGAGGG - Intergenic
1078983029 11:16560207-16560229 ATTGGAAGCTAGAATGGTGAGGG + Intronic
1079422418 11:20306252-20306274 ATAGAGAAATTGAATAGTGAGGG - Intergenic
1079440672 11:20511558-20511580 AAAGTGAGGTAGAATGCTGAAGG - Intergenic
1080015662 11:27504195-27504217 ATGGGAAATCAGAATGGTGAAGG - Intronic
1081468143 11:43344347-43344369 AAAGGGAAGGGGAAGGGTGAGGG - Intronic
1086161639 11:83728319-83728341 TTAGGGAAGCAAAATTGTGAAGG - Intronic
1086283645 11:85220228-85220250 ATAGGAAAGTTGAATGGGGTTGG + Intronic
1087864179 11:103203265-103203287 TTAGGGAAGTAGCATCTTGAAGG + Intronic
1087929587 11:103961476-103961498 ATAGGGAAGCAGGCAGGTGAAGG + Intronic
1092849380 12:12612763-12612785 ACAGGGAAATTGGATGGTGATGG - Intronic
1093893262 12:24548638-24548660 ATAGGTTAGTGGAATGGGGATGG + Intergenic
1095121664 12:38426064-38426086 AAAGGGTAGGAGAAGGGTGAGGG + Intergenic
1095197048 12:39332332-39332354 ATAGTCAAGGAGAATGGAGAGGG - Exonic
1095563064 12:43588373-43588395 AAAGGAAAGGAGAATGATGAGGG + Intergenic
1095598442 12:43986767-43986789 ACAGAGAAATAGAAAGGTGAAGG - Intronic
1095769846 12:45941582-45941604 TTTTGGAAGTAGAATGGTGGTGG - Intronic
1096082895 12:48844607-48844629 AGAGGGAACTAGTAAGGTGAAGG - Intronic
1097658783 12:62403651-62403673 AAGGGGAAGTAGAATGGAGAGGG + Intronic
1097685403 12:62686397-62686419 TTTGGAAAGTAGAAAGGTGAAGG + Intronic
1097931977 12:65197274-65197296 ATAGCCAAGTAGAATGGTTGTGG + Intronic
1098219832 12:68257502-68257524 GGAGGGAAGGAGAATGATGAGGG - Intergenic
1098411699 12:70191988-70192010 AGAGGGAGGTAGAATAGAGATGG + Intergenic
1098783796 12:74723069-74723091 AAAGGAAAGTAGAAAGGAGAAGG + Intergenic
1103061750 12:117863889-117863911 AGAGGGAAGTAGGAGGGTAAGGG - Intronic
1103949016 12:124541531-124541553 AGAGGGAAGGGGAGTGGTGATGG + Intronic
1105956730 13:25290251-25290273 ATAGGAAAGAAGAAAGATGAGGG - Intergenic
1106524904 13:30531965-30531987 TTTGGGAAGTAGAATTATGAAGG - Intronic
1106547926 13:30746335-30746357 AGAGGGAAGGAGAAGGATGAGGG + Intronic
1107144521 13:37044156-37044178 ATAGGGCAGTCGAATGGTCTCGG + Exonic
1107533184 13:41304008-41304030 TTAAGGAAGTAAAGTGGTGAAGG - Intergenic
1108021205 13:46129430-46129452 AGAAGGAAGTAGACAGGTGAAGG - Intronic
1108291056 13:48961553-48961575 ATAGGGAAGTAAAAAGTTCAGGG + Intergenic
1109881694 13:68486825-68486847 ATGGTGAAGGAAAATGGTGAAGG - Intergenic
1110401579 13:75097812-75097834 AGAGGGAGTTAGAGTGGTGAGGG - Intergenic
1111925548 13:94459694-94459716 AAAGGGGAGGAGAATGGAGAGGG - Intronic
1112589611 13:100751281-100751303 ACAGGGAGGTTGGATGGTGATGG - Intergenic
1112636131 13:101220078-101220100 ATAGGGCTGCAGAATGGTGTGGG - Intronic
1113041680 13:106110255-106110277 ATAGGGAGGTAAACTGCTGAAGG + Intergenic
1113881827 13:113631203-113631225 AAAAGGAAGTAAAAGGGTGAAGG + Intronic
1114533894 14:23411353-23411375 CTAGGGAAGGAGAATGGAGGTGG + Intergenic
1115296013 14:31827894-31827916 ATAGTGTAGTAGAATGGTTGAGG + Intronic
1118638314 14:67768209-67768231 ATGGGGAGGTAGGATGGTAAAGG + Intronic
1119672138 14:76527934-76527956 GTAAGGAAGTGGAATGGGGAAGG - Intergenic
1120007478 14:79375713-79375735 GTTGGGAAGTAGATTGCTGAGGG - Intronic
1120517667 14:85489809-85489831 ATAGCGAAGAAGCAGGGTGAGGG - Intergenic
1120720174 14:87881945-87881967 AGAGGGAAGGAGAGTAGTGAGGG - Intronic
1120930056 14:89839343-89839365 AGAGCAAAGTAGAATGGGGATGG + Intronic
1121068268 14:90990881-90990903 AGAGGGTAGGAGAAGGGTGATGG + Intronic
1122312376 14:100805210-100805232 CCAGGGAAGCAGAATGGGGAGGG + Intergenic
1124897233 15:33788576-33788598 GTTGGGAAGGAGAATGGTGGGGG - Intronic
1126684204 15:51233181-51233203 ATAGGGAAGGAGGATGGGGGAGG - Intronic
1127055817 15:55130044-55130066 AAAGGGAAAGAGAATTGTGATGG + Intergenic
1127574780 15:60280476-60280498 ATAATGAATTACAATGGTGATGG - Intergenic
1127836111 15:62792599-62792621 ATGGGGAAGGAGAAGCGTGATGG - Intronic
1128159961 15:65417150-65417172 CTGGGAAAGGAGAATGGTGATGG - Intronic
1129641397 15:77382304-77382326 AATGGAAAGTAGCATGGTGAAGG - Intronic
1130067385 15:80615969-80615991 CTAGTGAAGAAGAAGGGTGAAGG - Intergenic
1130927346 15:88395688-88395710 ATAGGGAGTTAGAAGGGGGATGG + Intergenic
1132057965 15:98666699-98666721 GACGGAAAGTAGAATGGTGAGGG + Intronic
1134185979 16:12085317-12085339 AAAGGGAAGAAGAGTGGAGAAGG - Intronic
1135660177 16:24289606-24289628 GTAGGGAGCTAGAATGGGGATGG - Intronic
1135674848 16:24406635-24406657 ATGGGGAATTAGAAAGGGGATGG - Intergenic
1138108212 16:54302654-54302676 ATAGGGGAATAGGATGGTGGAGG - Intergenic
1140057978 16:71542479-71542501 ATAAGGAAGTAGAACCGTGACGG + Intronic
1140634790 16:76899173-76899195 ATAGGGTAGCAGAATAGAGAAGG + Intergenic
1141793607 16:86253321-86253343 ATAGCGATGAATAATGGTGATGG + Intergenic
1145981090 17:29012088-29012110 ATTGGGAGGTAGTAGGGTGAAGG - Intronic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1149084334 17:52696411-52696433 ATAGAGAAATAGAATTTTGAAGG + Intergenic
1149937837 17:60826641-60826663 ATATGGTAGTAAAATGGTTAGGG - Intronic
1149939337 17:60846224-60846246 ATAAAGAAGTAGAATGGGGCTGG - Intronic
1151199800 17:72459382-72459404 ATAGGGAAGCAGCATGTAGAGGG - Intergenic
1153128236 18:1822427-1822449 AAAGGAAAACAGAATGGTGAAGG + Intergenic
1154138253 18:11799955-11799977 ATAGGGAAAAGGAATGGAGAGGG - Intronic
1155277593 18:24203646-24203668 ATAGGGTGGTAGAGTGGTGGTGG - Intronic
1155994324 18:32313728-32313750 ATTGCGAAGTGGAATGGTAAAGG + Intronic
1156250567 18:35348243-35348265 ACAGGGAAGCAGAATGGTCATGG - Intergenic
1157102486 18:44743260-44743282 GTAGGGAAGTAGATTGGAGGAGG + Intronic
1158049428 18:53198849-53198871 ATAGGTAACTTGAATGGAGATGG + Intronic
1158368592 18:56770728-56770750 ATAGGGCAGTACAAAGGTGCAGG - Intronic
1160283772 18:77519073-77519095 ATAGGAGAGGAGAATGGGGAGGG - Intergenic
1162526906 19:11211516-11211538 ATAGGGGAGCAGACAGGTGAGGG - Intronic
1165546690 19:36543463-36543485 ATAGGCTAGAAGAATGCTGAGGG - Intronic
1165559940 19:36670455-36670477 ATAGGCAAGTTGAATGGTGATGG - Intergenic
1165882307 19:39052841-39052863 ATTGGGAAGGGGAATGGTGCAGG + Intergenic
1166095660 19:40537428-40537450 AGAGAGAATGAGAATGGTGAAGG + Intronic
1166153129 19:40889305-40889327 ATCTGGAGGTGGAATGGTGAAGG + Intronic
1166356214 19:42229089-42229111 ATGGGGTGGTAGAAGGGTGAGGG + Intergenic
926863614 2:17335653-17335675 TTAGGAAAGAAGAGTGGTGATGG + Intergenic
929882949 2:45853156-45853178 ATAAGAAAGGAGAATGGGGAGGG - Intronic
932867565 2:75361621-75361643 ATAGAGAAATACATTGGTGAAGG + Intergenic
932917556 2:75874687-75874709 ATAGGGAGGTAGACTCTTGAGGG - Intergenic
933001773 2:76933903-76933925 ATATTGAAGTAAAATGGGGAAGG - Intronic
933539754 2:83624484-83624506 ATAGGGAAGTCCAGTGGAGAGGG + Intergenic
933555903 2:83830405-83830427 ATAAGGAAGTAGAATTATGTAGG + Intergenic
935277057 2:101484181-101484203 CTAGGGAAGGAGAAGGGGGAAGG - Intergenic
935824346 2:106929713-106929735 AAAGGGAAGTAAAGTGGGGAGGG - Intergenic
936548565 2:113414292-113414314 ATAGGGAAGAAAAATGAGGAAGG - Intergenic
936898507 2:117456964-117456986 ACTGGGAAGTATAGTGGTGAGGG - Intergenic
938049777 2:128158180-128158202 GTAGGGTAGGAGAATGGGGAAGG + Intronic
938344272 2:130556264-130556286 AACAGGAAGTAGAATGGTGGGGG + Intergenic
938345561 2:130564458-130564480 AACAGGAAGTAGAATGGTGGGGG - Intergenic
939010102 2:136836561-136836583 ATGGGGATCTAGAAAGGTGATGG - Intronic
939811855 2:146842410-146842432 AAAGGGAAATAGAATTGTGCAGG - Intergenic
940120685 2:150261288-150261310 GTAGGGAAGTGGGATGGGGAGGG + Intergenic
940588638 2:155690100-155690122 CTAGGGAAGTTGATTTGTGAGGG - Intergenic
941463692 2:165800543-165800565 GTAGGAAAGGAGTATGGTGATGG - Intergenic
942486096 2:176441469-176441491 AAAGAGAAGTAGAATAGAGATGG + Intergenic
943426884 2:187749144-187749166 AAGGGCAAGCAGAATGGTGAGGG + Intergenic
943587348 2:189757278-189757300 ATTTGGATGTGGAATGGTGAGGG + Intronic
945438112 2:209843127-209843149 AAAAGGAATCAGAATGGTGATGG - Intronic
945522752 2:210848502-210848524 ATAGGAAATTAGAATTGTGAAGG - Intergenic
1170149590 20:13215815-13215837 ATAGGGAAGTGGAATGTTGCTGG + Intergenic
1170462634 20:16591795-16591817 AAAGGGATGTAAAATGGTGTAGG - Intergenic
1170496467 20:16929989-16930011 TTAGGAAAGTAGAAGGGTGGTGG - Intergenic
1171069686 20:22056035-22056057 ATAGGGATGTATATTGGTAATGG + Intergenic
1173722803 20:45274090-45274112 ATAGGGAAATAGACTGATAATGG + Intergenic
1174546642 20:51330833-51330855 ACAGGGAAGGGGACTGGTGAGGG + Intergenic
1176332027 21:5558137-5558159 ATAGGGATGAAGACTGTTGAAGG - Intergenic
1176395730 21:6262814-6262836 ATAGGGATGAAGACTGTTGAAGG + Intergenic
1176441427 21:6726290-6726312 ATAGGGATGAAGACTGTTGAAGG - Intergenic
1176465689 21:7053359-7053381 ATAGGGATGAAGACTGTTGAAGG - Intronic
1176489250 21:7435137-7435159 ATAGGGATGAAGACTGTTGAAGG - Intergenic
1178973574 21:37202474-37202496 GTGGGGAAGGAGAATGGTGGTGG - Exonic
1179022797 21:37655559-37655581 ATAGGAAGGTAGAATGGACAAGG + Intronic
949181852 3:1141491-1141513 ACAGGGCAGTAGAATGGTCAAGG - Intronic
950037077 3:9893966-9893988 ATAGAGAAGTAGACTGGGTATGG + Exonic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
951754687 3:26077279-26077301 AAAGGGAAGTAGCATGTTGCAGG + Intergenic
951795925 3:26538228-26538250 AAAGGGAAGGAGAAGGGGGAGGG + Intergenic
951847086 3:27096237-27096259 AAAGAGAAGTATAATGTTGATGG - Intergenic
952861563 3:37817012-37817034 TTAGGGAAGTAGAAAGATGGTGG + Intronic
955015960 3:55069369-55069391 GGAGGGAAGTACAATGGTGGTGG - Intronic
955306801 3:57841007-57841029 ATATGGAAATAAAATTGTGAGGG - Intronic
955452499 3:59084950-59084972 ATAGTGATGGAGAATGGTAATGG - Intergenic
955484391 3:59420938-59420960 AAAGAGAGGTAGAATGCTGAAGG - Intergenic
955565556 3:60240767-60240789 AGCAGGAAGTAGAATGCTGATGG + Intronic
956481070 3:69674536-69674558 GTAGGGAAGTAGAGTGGTGGGGG - Intergenic
956483943 3:69701539-69701561 ATAGTGAAGTATAATGGAAAAGG + Intergenic
957462875 3:80545119-80545141 ATAGGGAAGTAGAAAGAGAAGGG + Intergenic
959102865 3:102033297-102033319 TCATGGAAGTAGAATGGTTAAGG + Intergenic
959444394 3:106420511-106420533 ATAGGGAAAGAGAAGGGTGAGGG + Intergenic
959893016 3:111577886-111577908 GGAGGGAAGTAAAATGGAGAAGG - Intronic
960238223 3:115309771-115309793 AGACAGAAGTAGATTGGTGATGG - Intergenic
960274938 3:115718058-115718080 AAAGGGAAGTAGACTGGGAAAGG - Intronic
960389755 3:117063111-117063133 ACAGGCAAATAGATTGGTGATGG + Intronic
961115353 3:124324359-124324381 ATAGAGAGGAAGAATGGGGAGGG - Intronic
961209095 3:125111500-125111522 AAAGGAAAGTAGAATGGAAAGGG - Intronic
961398962 3:126620785-126620807 ATAGGGAAGTACAATTGGGAAGG - Intronic
961613088 3:128156092-128156114 ATAGGGTAGATGAGTGGTGAAGG + Intronic
966781981 3:183591828-183591850 ATTGGGAAGTCGAATGTTAAGGG - Intergenic
966804448 3:183795690-183795712 ATAGGGAGGTGGAATGGGGTTGG + Intronic
967669899 3:192220309-192220331 ATAGGGAAGTAGAATGGTGAAGG - Intronic
968335144 3:197907193-197907215 ATTGAGAAATAGAATAGTGAGGG - Intronic
968535209 4:1122360-1122382 ATGGGGTAGCAGAATGGTGGTGG - Intergenic
968817432 4:2829275-2829297 ATAGGGAGGATGAATGGGGAAGG + Intronic
969714652 4:8862473-8862495 AGAGGGAACTAGATTGGTCACGG - Intronic
971217104 4:24671954-24671976 AAAAGGAAGTACAATGGTGTGGG + Intergenic
971488156 4:27182900-27182922 GAAGGAAAGTAAAATGGTGAAGG - Intergenic
971641125 4:29134642-29134664 ATAAGGAAATAGAATGTGGAGGG + Intergenic
974978122 4:68917479-68917501 ATGGGGAGCTGGAATGGTGATGG + Intergenic
976392351 4:84518341-84518363 ACTGGGAAGTTGCATGGTGACGG - Intergenic
976633781 4:87266791-87266813 GAAAGGAAGGAGAATGGTGAAGG - Intergenic
976997157 4:91448935-91448957 AGAGGGAATAAGAATAGTGATGG + Intronic
978988448 4:115046218-115046240 ATAGGGAGGCAGAATGGGGCAGG - Intronic
979346325 4:119591817-119591839 AGAAGGAAGGAGAATGGGGAGGG + Intronic
980551016 4:134335350-134335372 GTAGAGAAATGGAATGGTGATGG + Intergenic
981075200 4:140584379-140584401 TTAGGGAGGAAGAATGGGGAAGG - Intergenic
981722955 4:147820028-147820050 AGACGGCAGTAGAATGGAGAGGG + Intronic
981895493 4:149794487-149794509 ATAGATGAGTACAATGGTGAAGG + Intergenic
982786457 4:159542933-159542955 ATAGAGAAAAAGAAAGGTGAGGG + Intergenic
983872739 4:172841023-172841045 CTATGGAAGGAGAATGGTGGAGG - Intronic
983911757 4:173247709-173247731 ATAGAGAAGTAGATTTGTAAAGG + Intronic
984768999 4:183421554-183421576 ATAGGGAAGGAAAATGCTGAGGG - Intergenic
985058392 4:186055907-186055929 ATAGGAATGTAAAATGGAGACGG - Intergenic
985854852 5:2416794-2416816 ATAGGGAACCAGAAGGGGGATGG - Intergenic
986308305 5:6531981-6532003 ACAGGGAAGTAGAAAAGTCATGG + Intergenic
987670714 5:21003852-21003874 GAAGGGGAGAAGAATGGTGAAGG - Intergenic
988773188 5:34452048-34452070 GTGGGGAAATAGAAGGGTGAAGG - Intergenic
988942862 5:36163598-36163620 ATAGGGTGAAAGAATGGTGATGG + Intronic
990777515 5:59319200-59319222 ATAGGGAAGGAGAAAGGTCTTGG - Intronic
991520349 5:67490404-67490426 GTAGGGAAGTATAATAGTGAAGG + Intergenic
992210434 5:74474401-74474423 ATAAGGAAGGAGCATGGAGAAGG + Intergenic
992804398 5:80322908-80322930 AGAAGGAGGTAGAATGGTTAGGG + Intergenic
992829045 5:80576684-80576706 ATGGGAAAGTAAAATGGTGCAGG + Intergenic
993201125 5:84816506-84816528 AGAGGGAAGGGGAATAGTGAGGG + Intergenic
994083926 5:95738234-95738256 ATAGGGAAGTAGAGGGGATATGG - Intronic
994953466 5:106496828-106496850 ATAGGAAAGGAAATTGGTGAGGG + Intergenic
995104982 5:108366711-108366733 ATATCCAAGGAGAATGGTGAGGG - Intronic
995199780 5:109413127-109413149 TAGGGGAAGTAGAATGGTGTTGG + Intergenic
995294735 5:110506389-110506411 ATTGGGGAGTAAAATGGTGAAGG - Intronic
995661166 5:114484780-114484802 TTAGGGAATTAGAAAGGGGATGG + Intronic
995900182 5:117056447-117056469 AGAGGGAAGTAGAGGGGGGAAGG + Intergenic
996773598 5:127110595-127110617 ATAGGGCAGAAGCATGGTGATGG - Intergenic
997569402 5:134914609-134914631 GTAGGGAAGTACAGTTGTGATGG + Intronic
997662208 5:135598065-135598087 CTAGGAGAGTAGAATGGAGATGG + Intergenic
999037853 5:148373609-148373631 ATAGGGACTGAGAATGGGGAGGG - Intergenic
999794568 5:154977006-154977028 AGACAGAAGTAGAATGGTGGTGG - Intergenic
1000113862 5:158135190-158135212 ATAGGGAAGGAGAGAGGGGATGG + Intergenic
1000255870 5:159537722-159537744 AGAGGGAAGTAGAAAAATGAAGG - Intergenic
1000485061 5:161831013-161831035 GTAGGAAAGTAAAATGGTAATGG - Intergenic
1001449936 5:171816898-171816920 ATAGGCAAGGAGCAGGGTGAGGG - Intergenic
1001989055 5:176100878-176100900 AGAGGGAAGGCAAATGGTGAAGG - Intronic
1001989674 5:176105890-176105912 AGAGGGAAGGCAAATGGTGAAGG - Intronic
1001989984 5:176108436-176108458 AGAGGGAAGGCAAATGGTGAAGG - Intronic
1002226886 5:177729702-177729724 AGAGGGAAGGCAAATGGTGAAGG + Intronic
1002227196 5:177732247-177732269 AGAGGGAAGGCAAATGGTGAAGG + Intronic
1002266948 5:178041524-178041546 AGAGGGAAGGCAAATGGTGAAGG - Intronic
1003718596 6:8674899-8674921 ATAGGGAAGTAAAAAGGGCAAGG + Intergenic
1003982775 6:11405062-11405084 TTAGGGGAATAGAATGGGGAAGG + Intergenic
1004100684 6:12607284-12607306 ATTGGGAAATTGAATGGGGATGG - Intergenic
1004407058 6:15342900-15342922 CTTGGGAAGTAAAATAGTGACGG + Intronic
1004769964 6:18770472-18770494 AAAGGGAAGTAAAATTATGAGGG + Intergenic
1005533451 6:26731299-26731321 AAAAGAAAATAGAATGGTGAAGG - Intergenic
1005537343 6:26770365-26770387 AAAAGAAAATAGAATGGTGAAGG + Intergenic
1007756486 6:44102857-44102879 ATAGTGAAGGAGAATGGGGTAGG - Intergenic
1009004832 6:57772080-57772102 ATAGGACAGTAGAACAGTGAAGG + Intergenic
1009008225 6:57812772-57812794 AAAAGAAAATAGAATGGTGAAGG + Intergenic
1009322575 6:62310437-62310459 AAAGGGAAATAGAATGGAAAAGG - Intergenic
1009698485 6:67142583-67142605 ATGGGGAACTAGAAAGGGGATGG - Intergenic
1010977522 6:82332537-82332559 ATAGAGAAGAAGAAGGGAGAAGG - Intergenic
1012609795 6:101202826-101202848 ATAGGGAAGTTGGGTGGTTATGG - Intergenic
1014340325 6:120197519-120197541 ACAGTGAAGTAGAGTGGAGATGG + Intergenic
1014397555 6:120944811-120944833 ATATGGAAGTAAAATAGTGAAGG - Intergenic
1015213013 6:130719384-130719406 ACAGGGAACTGGAATGCTGATGG - Intergenic
1016084385 6:139894818-139894840 ATTGGGGAGGGGAATGGTGAGGG + Intergenic
1017996627 6:159537300-159537322 ACAGGGAAATAGAATGGTGTAGG + Intergenic
1019332363 7:466708-466730 AGAGTGAAGGAGAAAGGTGAAGG - Intergenic
1019522735 7:1468021-1468043 ATGGGGAAGGAGGATGGGGAGGG - Intergenic
1020392844 7:7677378-7677400 AGAGGGAAATAAAATGGGGATGG - Intronic
1020507059 7:9004203-9004225 CTTGGGAAATAGAAAGGTGAGGG - Intergenic
1020583849 7:10040110-10040132 ATTGGTAATTGGAATGGTGATGG + Intergenic
1021372120 7:19862022-19862044 ATAGGTGAGTTGAATTGTGATGG + Intergenic
1021658379 7:22894503-22894525 ACAGCAAAGTACAATGGTGATGG - Intergenic
1023762162 7:43475042-43475064 CTGGGGAAGGAGAGTGGTGATGG + Intronic
1024341138 7:48261851-48261873 ATGAGGCACTAGAATGGTGATGG + Intronic
1024867172 7:53917008-53917030 GTAGAGAAGAATAATGGTGATGG + Intergenic
1025269502 7:57496144-57496166 GGAGTGAAGTGGAATGGTGAGGG + Intergenic
1026268788 7:68818606-68818628 TCAGGGAAGAAGCATGGTGAGGG + Intergenic
1030093729 7:105879017-105879039 ATAGGGAAGCAGAAGGGAAAGGG - Intronic
1031764922 7:125766016-125766038 GAAGGGGAGAAGAATGGTGAGGG - Intergenic
1031865595 7:127035810-127035832 AGAGGGAAGCAGTATGGGGATGG - Intronic
1032345306 7:131110714-131110736 TTGGGGAAGGAGGATGGTGAGGG - Intronic
1037119480 8:15266088-15266110 ATAGGGTGGTAGGAAGGTGAGGG - Intergenic
1037281396 8:17246609-17246631 TTAGGGAAGTAGAAAGGGGGCGG - Exonic
1037665561 8:20966735-20966757 ACTGGGAAATAGATTGGTGAAGG + Intergenic
1038680921 8:29666093-29666115 TTAGGGAAGAAGAATGGAAAGGG - Intergenic
1039292407 8:36110799-36110821 ATAGGTGAGTTGAATGGGGATGG + Intergenic
1040301063 8:46188256-46188278 ATAGGGCGGTAGGATGGTGTGGG - Intergenic
1041800605 8:61793495-61793517 ACAGGGACGTAGAATATTGAAGG + Intergenic
1042278089 8:67026392-67026414 CTAGGGTAGTTGATTGGTGAAGG + Intronic
1042648107 8:71009655-71009677 ATGGGGAAGAAGAGTGCTGAGGG + Intergenic
1043549911 8:81359657-81359679 AAAGGAAAGTACAATGATGATGG + Intergenic
1043790395 8:84459736-84459758 ATAGTGGAGTAGAATGTTTATGG + Intronic
1043943596 8:86225015-86225037 ATAGGGAAGCAGACTGGACATGG - Intronic
1045085427 8:98677751-98677773 AGAGGGAAGAAAAAGGGTGAAGG - Intronic
1045379641 8:101610445-101610467 TTAGGGAGGTAAAATGGAGAGGG + Intronic
1045709667 8:104968461-104968483 AGAGGGAAGGACATTGGTGAAGG + Intronic
1046105794 8:109664804-109664826 CTAGGGAAGTAGAAGGTTGCTGG + Intronic
1046870055 8:119196280-119196302 ATTGGAAAGTAGTATGGAGAGGG - Intronic
1047232197 8:123007173-123007195 ATAGGCATGTAGAAAGGAGAAGG - Intergenic
1047830850 8:128628144-128628166 AGAGGGAAGGAGGATGGGGAAGG - Intergenic
1048010274 8:130449964-130449986 ATAGAGAAGTATGATGGTGAAGG + Intergenic
1048433382 8:134391470-134391492 ATAGGGAAGTAGATGGAGGAAGG - Intergenic
1048934837 8:139346176-139346198 AAAGGGGAGATGAATGGTGAAGG + Intergenic
1049904431 9:202880-202902 ATAGGGAAGAAAAATGAGGAAGG + Intergenic
1050421116 9:5466214-5466236 ATAGGGAAGTAGAATATGGAAGG + Intronic
1050526568 9:6551713-6551735 ATAGGGAAAGAGAAAGGAGAAGG + Intronic
1051106509 9:13587024-13587046 AGAGAGAAGGAGAATGGGGAGGG - Intergenic
1051800494 9:20927710-20927732 CTAGGGAATTATAATGGTCATGG + Intronic
1052527824 9:29642685-29642707 ATATGGAAGTTGCATGTTGAGGG - Intergenic
1053727003 9:41014454-41014476 ATAGGGAAGAAAAATGAGGAAGG + Intergenic
1056546212 9:87616100-87616122 AGAAGGAAGCAGAAAGGTGAGGG - Intronic
1057226804 9:93296909-93296931 CGAGGGAGGTAGAATGGGGAGGG - Intronic
1058233080 9:102454933-102454955 ACAGGTAAGTAGAAGGCTGAAGG + Intergenic
1058622419 9:106897788-106897810 TTAGGGAAGGAGAATAGAGAGGG + Intronic
1059266032 9:113031470-113031492 ATGGAGATGGAGAATGGTGATGG + Intergenic
1059754869 9:117283173-117283195 ATAGCGAAGTAGAATGAGCATGG - Intronic
1060219785 9:121758288-121758310 AGAGGGAAGGAGAAGGGTCAGGG + Intronic
1060378687 9:123143302-123143324 ATAGAGAAGTGGAAGAGTGAAGG + Intronic
1060622159 9:125077158-125077180 GTAGGAAAGCAGAATTGTGACGG - Intronic
1060674322 9:125498817-125498839 AAAGGGAAGGAGAGTGGGGAGGG - Intronic
1061018405 9:127996946-127996968 ATAGGGATGGATATTGGTGATGG - Intergenic
1203430071 Un_GL000195v1:82196-82218 ATAGGGATGAAGACTGTTGAAGG + Intergenic
1185720871 X:2380410-2380432 ATAAGGAAGCAGGATGTTGAAGG + Intronic
1187340859 X:18420369-18420391 ATAGGGAGGTAGAGGGGAGAGGG - Intergenic
1189546400 X:42046692-42046714 AAAGGGAACGAGTATGGTGAAGG + Intergenic
1190435677 X:50422264-50422286 ATAGGGAAGAAAAAAAGTGATGG - Intronic
1191896460 X:65998337-65998359 AAAGGAAAGTAGGATGGGGAGGG - Intergenic
1193418705 X:81256862-81256884 CTAGGGCAGTATAATAGTGAAGG - Intronic
1193772967 X:85609556-85609578 ATTGAGAAGTAGGATGGTGGTGG + Intergenic
1193896759 X:87123833-87123855 ATTGGGAAATAGAATGGGGCAGG + Intergenic
1196477395 X:116104526-116104548 AAAGGGAAGGGGAAGGGTGAGGG + Intergenic
1196748837 X:119096398-119096420 CTAGGGAAATAGTATGGTGTAGG - Intronic
1197166088 X:123379212-123379234 AAAGGGAAATAAAATGGTGATGG - Intronic
1197482341 X:127003087-127003109 AAAGGGAAGTGTAATTGTGAGGG - Intergenic
1197905016 X:131415373-131415395 GGAGGGTAGTAGAATGGAGAAGG - Intergenic
1198686355 X:139231774-139231796 CTAGGCAAGTAGGATGGAGAAGG - Intergenic
1198706210 X:139451239-139451261 ACAGTTTAGTAGAATGGTGAGGG + Intergenic
1199223011 X:145339476-145339498 ACAGGGAGGTTGATTGGTGAAGG - Intergenic
1200299029 X:154953654-154953676 ATAGGGAATTAAAAGGGAGAGGG + Intronic
1200751136 Y:6945243-6945265 AAAGGGAAGAAGAATGGGAAAGG - Intronic
1202089296 Y:21172673-21172695 ATAGGGAAGAATAGTGGTTATGG - Intergenic