ID: 967670214

View in Genome Browser
Species Human (GRCh38)
Location 3:192224841-192224863
Sequence TGACCTCTTCTTACGCTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 52}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967670212_967670214 1 Left 967670212 3:192224817-192224839 CCATTGCCACTGAGATTCTTGCA 0: 1
1: 0
2: 2
3: 25
4: 240
Right 967670214 3:192224841-192224863 TGACCTCTTCTTACGCTAGTAGG 0: 1
1: 0
2: 0
3: 3
4: 52
967670213_967670214 -5 Left 967670213 3:192224823-192224845 CCACTGAGATTCTTGCAGTGACC 0: 1
1: 0
2: 0
3: 9
4: 138
Right 967670214 3:192224841-192224863 TGACCTCTTCTTACGCTAGTAGG 0: 1
1: 0
2: 0
3: 3
4: 52
967670211_967670214 21 Left 967670211 3:192224797-192224819 CCTCAGAGTAGTTCGAGTTGCCA 0: 1
1: 0
2: 1
3: 1
4: 54
Right 967670214 3:192224841-192224863 TGACCTCTTCTTACGCTAGTAGG 0: 1
1: 0
2: 0
3: 3
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967670214 Original CRISPR TGACCTCTTCTTACGCTAGT AGG Intronic
900551466 1:3258419-3258441 TGGCCTCTTCTTATGCTAACGGG + Intronic
905378837 1:37545209-37545231 TGCCCTCATCTTGCGCAAGTTGG - Intronic
910890654 1:92016300-92016322 TAACCTCTTCTTAGGCTATAAGG + Intergenic
912760946 1:112366827-112366849 TGACTGCTTCTTAGGCTAGATGG - Intergenic
921562793 1:216678714-216678736 TCACCTCTTCTTTCTGTAGTGGG - Intronic
1081272051 11:41096868-41096890 TGACCTTTACTCACACTAGTGGG - Intronic
1083723229 11:64614102-64614124 TGGCCTCTTCTGACTCTTGTGGG - Intronic
1090697762 11:129266212-129266234 TGACATTTTCTTACTCAAGTAGG - Intronic
1099968803 12:89479617-89479639 TCACCTCCTCTTACACTAATGGG + Intronic
1107038423 13:35923928-35923950 TGACCTCTCCTTTTGCTAGAAGG - Intronic
1110360858 13:74623708-74623730 TGACCAATTCTTACGCTTTTAGG + Intergenic
1110504074 13:76264117-76264139 TGACCTCTTCTTTTCCTATTTGG - Intergenic
1116222516 14:42106891-42106913 TCACCTCTTCTTTTGCTACTTGG + Intergenic
1117588308 14:57237223-57237245 TGTCATCTTCCTACCCTAGTAGG - Intronic
1118226549 14:63905755-63905777 TGACCTCTTCTTTTCCTATTTGG + Intronic
1119582600 14:75800672-75800694 TGTTCTCTTCTTCCCCTAGTAGG + Intronic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1140710838 16:77675973-77675995 TAACCTCCTCTGACGCTGGTGGG - Intergenic
1140826015 16:78707438-78707460 GGACATCTTCTTGGGCTAGTTGG + Intronic
1144331023 17:14224351-14224373 TGACGCCTTCTTACCCTACTTGG + Intergenic
1164803911 19:31101361-31101383 TGCCCTCTTCTTACTCTCCTGGG - Intergenic
930927173 2:56832191-56832213 TGACCTCATCTGAGGCAAGTAGG + Intergenic
932922262 2:75929805-75929827 TGACCTCTTCTTTCTCTCTTTGG + Intergenic
940311170 2:152280141-152280163 TGACTTCTTTCTACCCTAGTGGG - Intergenic
1176741680 21:10609792-10609814 TGACTTCTTCTTTTGCTATTTGG + Intergenic
1179252120 21:39679427-39679449 TGACCTCTTGTTTCTCTTGTTGG + Intergenic
956928338 3:74014171-74014193 TGACCTCAACTGATGCTAGTTGG - Intergenic
962167693 3:133067241-133067263 CGAGCTCCTCTTACACTAGTGGG - Intronic
962678284 3:137771873-137771895 TGCCCTCTTCCTACGCTGGGCGG + Intergenic
967670214 3:192224841-192224863 TGACCTCTTCTTACGCTAGTAGG + Intronic
974078651 4:57191054-57191076 TGTCCCCTTCTTCCGCTAGGGGG + Intergenic
976219494 4:82744471-82744493 TGACCTCTTCCCACGGTCGTGGG - Intronic
979128443 4:117007640-117007662 TGACCTCTTCTTTCTCTATTTGG - Intergenic
982988099 4:162235598-162235620 GGACCTCTTCCTTAGCTAGTAGG - Intergenic
983413484 4:167426065-167426087 TGACTTCTTCTTTTCCTAGTTGG - Intergenic
992384852 5:76274930-76274952 TGTCCTCTTCCTAAGCTTGTTGG + Intronic
992937028 5:81718480-81718502 TGACCTCTGCTTCCGGTAGGAGG - Intronic
996121160 5:119673604-119673626 TGATCTTTTCATATGCTAGTTGG + Intergenic
1007735351 6:43978876-43978898 TTTCCTCTTCTGATGCTAGTGGG - Intergenic
1018158897 6:161017950-161017972 TAAACTCTTCTTACGCTATTTGG + Intronic
1026462720 7:70629111-70629133 TGACCTCTTCTTGCATTAGGTGG - Intronic
1028381030 7:90198596-90198618 TGACCTCATCTCCCACTAGTTGG + Intronic
1032311370 7:130790478-130790500 AGACCTCTGCTTACGCAGGTAGG - Intergenic
1038212330 8:25530800-25530822 TGACCTCTTCTTTTCCTATTTGG + Intergenic
1041860826 8:62510819-62510841 TGACCTCTTCTTTCACCTGTTGG + Intronic
1046106115 8:109668392-109668414 TGACCTGTTCTGATGCTAGAAGG + Intronic
1048681570 8:136847689-136847711 TAACGTCTTCTTTCTCTAGTTGG - Intergenic
1050668956 9:7974687-7974709 TTACTTCTCCTTACGCTTGTAGG + Intergenic
1057991847 9:99778674-99778696 TGTCCTTTTCTTAGGGTAGTAGG - Intergenic
1187679010 X:21747615-21747637 TGACATCTTCTTTCCCCAGTGGG + Intronic
1189193195 X:39129385-39129407 TGATCTCTTCTCAAGCCAGTGGG - Intergenic
1193469222 X:81878797-81878819 TGCCCTCTTCTTTCCCTAGAAGG + Intergenic
1194565588 X:95484159-95484181 TGACCTCTTCTTCAGATAATGGG - Intergenic
1198277352 X:135108209-135108231 TGACTTCTTCTTTTGCTATTTGG + Intergenic
1199284465 X:146040518-146040540 TGACATCTTCTTGCCCTATTTGG - Intergenic
1202600009 Y:26584016-26584038 TGACCTCTTCTTTTGCTATTTGG + Intergenic