ID: 967674667

View in Genome Browser
Species Human (GRCh38)
Location 3:192282456-192282478
Sequence ATCTCATAGTGGGAGTATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967674667_967674671 -2 Left 967674667 3:192282456-192282478 CCTCCATACTCCCACTATGAGAT 0: 1
1: 0
2: 2
3: 9
4: 116
Right 967674671 3:192282477-192282499 ATGTTTGAAAATTTTCTTTAAGG 0: 1
1: 0
2: 7
3: 134
4: 1051
967674667_967674672 3 Left 967674667 3:192282456-192282478 CCTCCATACTCCCACTATGAGAT 0: 1
1: 0
2: 2
3: 9
4: 116
Right 967674672 3:192282482-192282504 TGAAAATTTTCTTTAAGGAGTGG 0: 1
1: 0
2: 5
3: 43
4: 488

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967674667 Original CRISPR ATCTCATAGTGGGAGTATGG AGG (reversed) Intronic
901619166 1:10568332-10568354 ATCTGTTAGTGGGAGTGGGGGGG - Intronic
903159064 1:21471841-21471863 ATGTCATTGTGAAAGTATGGAGG - Intronic
904422330 1:30402287-30402309 ATCACATAGATGGAGTTTGGGGG + Intergenic
915690398 1:157683382-157683404 ATAACATAGGGGGAGTAAGGAGG - Intronic
916063903 1:161120802-161120824 AGCTCATAGTGGCAGGGTGGGGG - Exonic
916581646 1:166114641-166114663 AACAGATAGTGGGAGTAGGGAGG + Intronic
917382929 1:174434678-174434700 ATCTCATTGTGGGTGTATATTGG + Intronic
921958705 1:221011641-221011663 ATCCCATAGTGGGAGCACAGAGG + Intergenic
1064676356 10:17764187-17764209 TTCTCATAGAGGAAGCATGGTGG - Intronic
1065144125 10:22750104-22750126 GTCACATAGTGAGATTATGGAGG + Intergenic
1069277518 10:66611096-66611118 ATCTCATGGAGGTAGAATGGCGG + Intronic
1073867749 10:107824565-107824587 AACTCAAAGTGGGAGTGTGGGGG + Intergenic
1075588273 10:123672854-123672876 ATCACACAGTGGGAAAATGGTGG - Intronic
1075865047 10:125711285-125711307 ATCTCATTGTGGTAGTGTTGGGG + Intergenic
1078420970 11:11212540-11212562 ACCTCAGAGTGGCAGTGTGGAGG - Intergenic
1086348167 11:85919066-85919088 GTCTCATAGTGGGTTAATGGGGG - Intronic
1087964966 11:104401074-104401096 ATATATTAGTGGGAGAATGGAGG + Intergenic
1095366165 12:41408437-41408459 TTCTCAAAGTGGAAGTGTGGGGG + Intronic
1100928653 12:99580553-99580575 ATCTCATAGGGGTAGAATGGTGG + Intronic
1103135253 12:118501564-118501586 ATCTCAGAGGCTGAGTATGGTGG + Intergenic
1104011972 12:124937580-124937602 ATCCCCGAGTGGGTGTATGGTGG + Intergenic
1108293496 13:48987452-48987474 ATTTCTTAGTGGGAGAATGGGGG + Intronic
1109528618 13:63609040-63609062 ACCTAATAGTGGAAATATGGTGG - Intergenic
1109802954 13:67401567-67401589 CTCTGATACTGGGAGTAGGGTGG - Intergenic
1109971599 13:69777423-69777445 ATCTTAAAGTGGGATTATAGAGG + Intronic
1112580954 13:100675517-100675539 CTCTGAGAGTGGGAGTGTGGTGG - Intergenic
1116422699 14:44751650-44751672 CTCACATAGTGGGAGGATTGAGG + Intergenic
1117901133 14:60534683-60534705 ATCCCTTAGTGGGAGTTGGGAGG - Intergenic
1120489593 14:85160692-85160714 ATCTCAGACTGTGAGTATGCTGG + Intergenic
1126254286 15:46607064-46607086 ATCTCATAGTGGTGATAAGGTGG + Intergenic
1127096351 15:55515448-55515470 CTCTCATACTGGGAGCAGGGTGG + Intergenic
1127208241 15:56743141-56743163 ATCTCCTATTAGGAGAATGGAGG - Intronic
1131035079 15:89216799-89216821 TTCTCATGGTGGGGGTCTGGAGG + Intronic
1131393481 15:92068326-92068348 CTCTGAAAGTGGGAGTAAGGTGG - Intronic
1132774312 16:1583498-1583520 ATCTCATAGTCGTAGGATGATGG - Intronic
1135923711 16:26673805-26673827 ATCTCATACTTGGAGTAGGCTGG + Intergenic
1137081470 16:36063933-36063955 ATCTCAAAGTGGATATATGGAGG + Intergenic
1138461336 16:57149669-57149691 ATCTGAGAGTGGGAGCATGTGGG - Intergenic
1141318402 16:82983415-82983437 ATGTCATAGTCTGAGTTTGGAGG + Intronic
1142662006 17:1437124-1437146 ATCTCCTATTCGGAGTCTGGAGG + Exonic
1143204137 17:5131237-5131259 ATCTCACAGTGAGACTAGGGAGG + Intronic
1147783013 17:42957235-42957257 TTATCATTGTGGGAGTATGTAGG - Intronic
1155424625 18:25694092-25694114 ATCTAATTTTGGCAGTATGGTGG - Intergenic
1159039298 18:63308356-63308378 TTCTCACAGTGGGAGCAAGGTGG - Intronic
1160315579 18:77842572-77842594 ATCTGATAAGGGGAGAATGGGGG + Intergenic
1162259910 19:9524199-9524221 TTCTCCTAGTGGGAGTTTTGTGG + Intergenic
1166346054 19:42166648-42166670 ATCTGACAATGGGAGTAAGGAGG + Intronic
927000100 2:18785956-18785978 ATTTCATAGTGGGGATATAGGGG + Intergenic
929502470 2:42502136-42502158 ATCTCAAAGTGGGGGTGTTGGGG + Intronic
931182336 2:59915478-59915500 AGCTCATAATGGGAGAATGTGGG - Intergenic
935043256 2:99454761-99454783 AACTAATAGTAGGAGTATTGTGG - Intronic
935807488 2:106763286-106763308 ATGTCATAGTGGGACAATAGTGG + Intergenic
942777866 2:179606888-179606910 TTCTCATAGTGGGAGTACTCTGG + Intronic
948143516 2:235691797-235691819 TTCTCCTAGTGGGTGAATGGGGG - Intronic
1169688790 20:8307186-8307208 ACCTAAGAGTGGGAGTAGGGGGG + Intronic
1173110428 20:40182479-40182501 ATCTCATAGGGTGAATATTGAGG + Intergenic
1173140560 20:40478275-40478297 AACACAGAGTGGGAGAATGGTGG - Intergenic
949389127 3:3539267-3539289 ATCTCATAGTGGGAGAATTCAGG + Intergenic
949487190 3:4551125-4551147 ATCTCATAGTGGAGGTTTGGAGG + Intronic
952080150 3:29748163-29748185 ATCTCTTAGTGGGAGTAGGGAGG + Intronic
960295312 3:115935687-115935709 ATCTCAGAGTGGCAGGATGGGGG + Intronic
964522446 3:157583553-157583575 CTCTCATACTGGGAGCAGGGTGG + Intronic
965080367 3:164024693-164024715 CTCTCAGAGGGGAAGTATGGGGG + Intergenic
965846577 3:172969268-172969290 ATCTAATAGTGGGAATATGGAGG + Intronic
967674667 3:192282456-192282478 ATCTCATAGTGGGAGTATGGAGG - Intronic
971103073 4:23490528-23490550 ATTTCATCTTGGGAGTATGCTGG + Intergenic
971216565 4:24667170-24667192 ATCTCAGAGTGTGATTCTGGAGG + Intergenic
987486686 5:18534805-18534827 ATCTCAAAGTGGGGGTGGGGTGG - Intergenic
987971354 5:24949060-24949082 ATTTCATTGTGGGAGTATGATGG - Intergenic
989709207 5:44376313-44376335 AGCTCATAGTGTCAGTAGGGGGG + Intronic
990113821 5:52363985-52364007 GACTCATAGTGGGAGGCTGGAGG + Intergenic
990655272 5:57948435-57948457 TTTTCATACTGGGAGTAGGGAGG - Intergenic
991036689 5:62134606-62134628 ATCTCCTAGAGGGAGGTTGGGGG - Intergenic
991773054 5:70057810-70057832 AACTCAAAGTGGGGGTAGGGAGG - Intronic
991852347 5:70933234-70933256 AACTCAAAGTGGGGGTAGGGAGG - Intronic
994337070 5:98579684-98579706 TTCTAATAGTGATAGTATGGAGG - Intergenic
995339822 5:111045700-111045722 ATTTCACTGGGGGAGTATGGTGG + Intergenic
996542050 5:124640619-124640641 ATCTCATAGTAGGTGGGTGGTGG - Intronic
997622168 5:135305975-135305997 ATCTCAAAGTGGTATTATTGGGG + Intronic
998178082 5:139914267-139914289 AGCTAGGAGTGGGAGTATGGCGG + Intronic
999724951 5:154429510-154429532 ACCCCATGGAGGGAGTATGGCGG + Intergenic
999835428 5:155365175-155365197 ATCTCATATTGGGAGGAGGAAGG - Intergenic
1001069391 5:168571373-168571395 ATCTTATAGTGGGGGTACTGAGG - Intronic
1002000861 5:176195674-176195696 ACCTCATTGGGGGAGTGTGGGGG + Intergenic
1002192167 5:177483973-177483995 TTCTCATAGTCTGAGAATGGGGG + Exonic
1004397110 6:15255084-15255106 GACTCTTACTGGGAGTATGGAGG - Intronic
1005893946 6:30162536-30162558 ATCACCCAGTGGGAGAATGGGGG + Intergenic
1006104990 6:31711068-31711090 AGCACAAAGTGGGAGGATGGAGG + Intronic
1008695246 6:54028457-54028479 ATGTCATAGTGGGAGGCTGAAGG + Intronic
1010137974 6:72577400-72577422 ACCTCATAGGCTGAGTATGGTGG - Intergenic
1013313940 6:108923681-108923703 ATCTCACTGTGGGATGATGGTGG - Intronic
1014598737 6:123380887-123380909 AGCTCATAGTGAGTGTAGGGGGG + Intronic
1014808935 6:125863778-125863800 AGCTCAGAGTGAGAGGATGGTGG - Intronic
1020442271 7:8230967-8230989 ATCTCATAGTGGAGGGAAGGTGG + Intronic
1021002423 7:15349252-15349274 ATCTGTTAGTGGGAGAATGTTGG - Intronic
1024586584 7:50847056-50847078 ATGTCATTGTGAGAGGATGGGGG + Intergenic
1026582228 7:71628038-71628060 ATTTCATAGTGGGAGCAGGTAGG + Intronic
1028884198 7:95912936-95912958 TTCTCATTTTGGGAGCATGGGGG - Intronic
1028889082 7:95966860-95966882 ACCTCATAGTGGGTGCAGGGAGG + Intronic
1030729300 7:112966125-112966147 ATCTCATAGTGAAGTTATGGAGG - Intergenic
1031500099 7:122503828-122503850 ATCTCATAGAGTGAGAATGGAGG + Intronic
1034027959 7:147727823-147727845 ATTGCATAATGGGAGTATGAGGG + Intronic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1035891299 8:3346498-3346520 ATCTCACACTGGCAGTATGAGGG - Intronic
1037060186 8:14498070-14498092 ATATCATATTGGGATTTTGGGGG + Intronic
1037904406 8:22707062-22707084 ACCTCATGGAGGGAGGATGGAGG - Intergenic
1039320371 8:36423737-36423759 ATCTCGTGGAGGGAGTGTGGGGG - Intergenic
1042101946 8:65283741-65283763 ATCTCCTAATGGAGGTATGGGGG - Intergenic
1046365807 8:113229801-113229823 ATCTGAGACTGGGAGTAAGGAGG - Intronic
1047320429 8:123775277-123775299 ATATTATACTGGGATTATGGAGG + Exonic
1048152870 8:131910836-131910858 ATCCTATAGTGGGAGTAGAGAGG + Intronic
1052996570 9:34554355-34554377 ACCTCATTGTGGGCTTATGGTGG + Intronic
1053580368 9:39397604-39397626 ATCTCTTGGTGGGTGAATGGAGG - Intergenic
1053844868 9:42225678-42225700 ATCTCTTGGTGGGTGAATGGAGG - Intergenic
1054101955 9:60956409-60956431 ATCTCTTGGTGGGTGAATGGAGG - Intergenic
1054123326 9:61231786-61231808 ATCTCTTGGTGGGTGAATGGAGG - Intergenic
1054584399 9:66950449-66950471 ATCTCTTGGTGGGTGAATGGAGG + Intergenic
1056158164 9:83860448-83860470 AACTTATATTGGGAGAATGGAGG - Intronic
1056352384 9:85763609-85763631 AACTTATATTGGGAGAATGGAGG + Intergenic
1058964957 9:110028560-110028582 ATCTCAAAGTGAGTGTGTGGTGG + Intronic
1186782757 X:12929860-12929882 AGGTCATAGTAGGAGTAGGGTGG - Intergenic
1187084977 X:16032934-16032956 AGCTAATGGTGGGAGTTTGGTGG + Intergenic
1195034961 X:100964115-100964137 ATCACATGGTGAGAGTAGGGAGG - Intergenic
1196568056 X:117231497-117231519 ATCACACAGTGGGAGCAGGGAGG - Intergenic
1196602313 X:117616595-117616617 ATCTCATAATGGAAAGATGGAGG - Intergenic
1197496219 X:127184887-127184909 AAATCATAGTGGGAGAATGTAGG + Intergenic
1199199796 X:145074097-145074119 ATCTCATACTGGAATTTTGGAGG - Intergenic
1199783655 X:151084707-151084729 AGCTCATGGTGGGAGTATGAAGG + Intergenic