ID: 967675539

View in Genome Browser
Species Human (GRCh38)
Location 3:192294393-192294415
Sequence AAACTACCACCTTAGGAGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 314}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967675529_967675539 14 Left 967675529 3:192294356-192294378 CCCTTATGACTTAATCTCCCAAA 0: 1
1: 0
2: 2
3: 23
4: 240
Right 967675539 3:192294393-192294415 AAACTACCACCTTAGGAGTTAGG 0: 1
1: 0
2: 3
3: 41
4: 314
967675530_967675539 13 Left 967675530 3:192294357-192294379 CCTTATGACTTAATCTCCCAAAG 0: 1
1: 0
2: 4
3: 59
4: 1157
Right 967675539 3:192294393-192294415 AAACTACCACCTTAGGAGTTAGG 0: 1
1: 0
2: 3
3: 41
4: 314
967675532_967675539 -3 Left 967675532 3:192294373-192294395 CCCAAAGGCCCCATTTCCTAAAA 0: 1
1: 7
2: 177
3: 951
4: 2423
Right 967675539 3:192294393-192294415 AAACTACCACCTTAGGAGTTAGG 0: 1
1: 0
2: 3
3: 41
4: 314
967675533_967675539 -4 Left 967675533 3:192294374-192294396 CCAAAGGCCCCATTTCCTAAAAC 0: 1
1: 6
2: 138
3: 830
4: 2114
Right 967675539 3:192294393-192294415 AAACTACCACCTTAGGAGTTAGG 0: 1
1: 0
2: 3
3: 41
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967675539 Original CRISPR AAACTACCACCTTAGGAGTT AGG Intronic
901427426 1:9191302-9191324 AATCTGCCTCCTGAGGAGTTTGG - Intergenic
901442062 1:9283910-9283932 ATACCACCACCTTGGGGGTTAGG - Intergenic
901855174 1:12039735-12039757 AAACTTCCACCATGGGAGTCAGG - Intergenic
903430254 1:23292399-23292421 AAAACACCACCTTAGGATATTGG + Intergenic
903666677 1:25012175-25012197 AAATTACCACCTAATGAGTGTGG - Intergenic
904307055 1:29596745-29596767 AAGCTACCAACTTAGGAGCAAGG + Intergenic
904636993 1:31889758-31889780 ATACCATCACCTTAGGAGTTAGG + Intergenic
905317487 1:37092714-37092736 GAACTACCAACTTAGGTATTTGG - Intergenic
905812242 1:40921240-40921262 AAGGTACCATCTTAGGAATTTGG - Intergenic
907707213 1:56842938-56842960 AAACTACCACCCTATAAGTTTGG - Intergenic
907964188 1:59313253-59313275 ATACCATCACCTTAGGGGTTAGG + Intronic
908345296 1:63226372-63226394 ATACTATCACATTGGGAGTTAGG - Intergenic
908559730 1:65293441-65293463 ATACTACCACACTGGGAGTTAGG + Intronic
908715055 1:67061125-67061147 AAACTATCACCTTAGAGGTTAGG - Intergenic
908836709 1:68235427-68235449 AAACTGAAACCTAAGGAGTTAGG - Intergenic
908846376 1:68328760-68328782 ATACTATCACCTTGGGGGTTAGG - Intergenic
908850323 1:68369341-68369363 AAACAACCACTTTGGGATTTTGG + Intergenic
911156065 1:94638116-94638138 ATACCACCACTTTGGGAGTTAGG - Intergenic
913082287 1:115399791-115399813 ATACTATCACCTTGGGGGTTAGG - Intergenic
914227205 1:145730541-145730563 AAACTACTGCCCAAGGAGTTAGG + Intronic
914451213 1:147793491-147793513 AAACTTCCACATTAAGACTTGGG + Intergenic
914830905 1:151170188-151170210 ACACTACCAATTTATGAGTTTGG - Exonic
915808267 1:158877389-158877411 AAACTTCCTCATAAGGAGTTAGG - Intergenic
916456957 1:164980851-164980873 ATACTATCACATTGGGAGTTAGG + Intergenic
917343042 1:173999931-173999953 AAAGTACCAGCCTGGGAGTTTGG - Intronic
917908453 1:179613766-179613788 ATACTATCACCTTGGGGGTTAGG + Intronic
918281613 1:183011516-183011538 ATACCATCACATTAGGAGTTGGG + Intergenic
922423894 1:225476710-225476732 ACACCATCACCTTGGGAGTTAGG - Intergenic
922882529 1:228991635-228991657 GAACTAACACCTCAGGAGTCGGG - Intergenic
922995182 1:229951737-229951759 ATACTATCACATTGGGAGTTAGG + Intergenic
923005071 1:230042894-230042916 AAAATACCATCTTACTAGTTGGG - Intergenic
923924617 1:238610569-238610591 AAACTCCCAGGTTAGCAGTTTGG - Intergenic
924009479 1:239649148-239649170 ACACTACCACCTTGGGGATTAGG - Intronic
924546307 1:245031093-245031115 AAACAACCTCATTAGGATTTGGG - Intronic
1064131100 10:12710684-12710706 AAAATGCAACCTTAGGAGTCAGG + Intronic
1064742104 10:18444133-18444155 AAACCATCACCTTTGGCGTTAGG - Intronic
1065209460 10:23388868-23388890 ATACCATCACCTTGGGAGTTAGG + Intergenic
1066681700 10:37941298-37941320 AAACTGCCACCATGGTAGTTAGG + Intergenic
1067218252 10:44321763-44321785 ACTCTACCACCATAGGAGTGTGG + Intergenic
1068198569 10:53750733-53750755 AAACTTCCACCTTAGCACTTTGG + Intergenic
1068411749 10:56664305-56664327 AAACTACACCATTAGGAGCTTGG - Intergenic
1072521562 10:96234455-96234477 AAACTACCACCTGTGCACTTTGG - Intronic
1074622819 10:115143894-115143916 ATACTATCACGTTGGGAGTTAGG + Intronic
1074726927 10:116320667-116320689 ATACCATCACCTTAAGAGTTAGG - Intergenic
1075395904 10:122126903-122126925 ATACCATCACCTTAGGGGTTAGG - Intronic
1076775544 10:132695937-132695959 ACACCATCACCTTAGGGGTTAGG - Intronic
1076994875 11:292981-293003 AAAGTACCACCTGAGGGGTGAGG + Exonic
1078867699 11:15313165-15313187 ATACTATCACCTTGGGGGTTGGG - Intergenic
1078945994 11:16069586-16069608 AAACTGCAACCTTAGTAATTAGG + Intronic
1080282237 11:30570348-30570370 ATACCACCACCTTGGGAGTTAGG + Intronic
1081314653 11:41616901-41616923 ACACTATCACCTCAGGTGTTAGG + Intergenic
1082777377 11:57257427-57257449 ATACTATCATCTTAGGGGTTAGG - Intergenic
1082782152 11:57296060-57296082 AACCTATCACCTTAGGGGCTAGG - Intergenic
1082874755 11:57977198-57977220 ATACCACCACCTTGGGGGTTAGG - Intergenic
1083033279 11:59614314-59614336 CAACAACAACCCTAGGAGTTGGG - Intronic
1084714429 11:70864632-70864654 AAACCATCACGTTGGGAGTTAGG - Intronic
1085949740 11:81315514-81315536 ATACCACCACCTTGAGAGTTAGG + Intergenic
1086677765 11:89630312-89630334 AACCTTCCAGCTTGGGAGTTAGG - Intergenic
1087038408 11:93775744-93775766 ATACCATCACCTTAGGGGTTAGG - Intronic
1088917483 11:114238584-114238606 ATACCATCACCTTAGGGGTTAGG + Intronic
1089009470 11:115120877-115120899 AAACTGCCACCTTGGGGGTTAGG - Intergenic
1089645980 11:119879327-119879349 ATACTATCACCTTGGGGGTTAGG + Intergenic
1091359022 11:134959955-134959977 ATACCATCACCTTAGGTGTTAGG - Intergenic
1092977068 12:13755785-13755807 ATACCATCACCTTGGGAGTTAGG - Intronic
1093994720 12:25629372-25629394 AAACTTCCACTTTACGAGTTAGG - Intronic
1094278952 12:28713045-28713067 AAACTAACACTTGATGAGTTTGG - Intergenic
1094478581 12:30861778-30861800 ATACTATCACCTTAGCAGTTAGG + Intergenic
1095779760 12:46046799-46046821 ATACTGTCACATTAGGAGTTAGG - Intergenic
1097256186 12:57676396-57676418 CAGCTACCACCTTTGGAGCTGGG + Intergenic
1098364925 12:69692562-69692584 AAAGTATTAACTTAGGAGTTTGG + Intronic
1098471198 12:70846539-70846561 ACACTATCACCTTGGGGGTTAGG - Intronic
1099168211 12:79333399-79333421 ATACCATCACCTTGGGAGTTAGG + Intronic
1099504828 12:83460694-83460716 ATACTGTCACCTTAGGGGTTAGG + Intergenic
1099552408 12:84064327-84064349 ATACCATCACCTTAGGGGTTAGG - Intergenic
1100223760 12:92535373-92535395 ATACTATCACCTTGGGGGTTAGG + Intergenic
1100866810 12:98866085-98866107 ATACCATCACTTTAGGAGTTAGG + Intronic
1101468235 12:104970134-104970156 ATACTATCACCTTGGGGGTTAGG - Intergenic
1101896493 12:108760931-108760953 AATCCACCACATTAGGGGTTAGG + Intergenic
1102799386 12:115718169-115718191 AAAATCCAACCTTAGGACTTTGG - Intergenic
1103216578 12:119206409-119206431 AAACGATCACATTGGGAGTTAGG - Intronic
1104407045 12:128526488-128526510 AAGCCAACACCTTGGGAGTTAGG + Intronic
1104805212 12:131585712-131585734 AAACTATCACCTTGGGGGTTAGG - Intergenic
1105464011 13:20620493-20620515 ATACTACCACCTTGGGGGTTAGG - Intronic
1105610177 13:21961933-21961955 ACACCATCACCTTGGGAGTTAGG - Intergenic
1107076473 13:36326167-36326189 AAACCATCACCTCAGGGGTTAGG + Intronic
1108601698 13:52000440-52000462 ATACCACCACCTTGGGGGTTAGG + Intronic
1110384468 13:74892680-74892702 AGACTACCAAGTTAGGAGTTGGG - Intergenic
1111176265 13:84600478-84600500 ATACAAGCACTTTAGGAGTTAGG - Intergenic
1111615354 13:90655161-90655183 AAACAACCACCTCATGAGTTTGG + Intergenic
1111755823 13:92394335-92394357 ACACTATCACTTTAGGAGTTAGG - Intronic
1111905298 13:94248771-94248793 AAACTAGCACCTCAGGACATAGG + Intronic
1111909883 13:94299460-94299482 ATACCATCACCTTAGGTGTTAGG - Intronic
1113492556 13:110703881-110703903 AAACCGTCACCTTGGGAGTTAGG - Intronic
1115300027 14:31875035-31875057 ATACTATCACCTTGGGGGTTAGG - Intergenic
1120242398 14:81964847-81964869 ATACCATCACCTTAGGGGTTAGG - Intergenic
1121151034 14:91635209-91635231 ATACTACCACCTTGAGGGTTAGG + Intronic
1121521484 14:94588947-94588969 ATACCACCACCTTGGGGGTTAGG + Intronic
1122738563 14:103857606-103857628 ATACCACCACCTTAAGGGTTAGG + Intergenic
1123662420 15:22575908-22575930 ATACTGCCACATTAGGAGTCGGG + Intergenic
1124137926 15:27051457-27051479 ATATCACCACCTTGGGAGTTAGG - Intronic
1124261869 15:28199992-28200014 ATACTGCCACATTAGGAGTTGGG - Intronic
1124316220 15:28670192-28670214 ATACTGCCACATTAGGAGTCGGG + Intergenic
1126205005 15:46035462-46035484 ATACCACCACATTAGGAGTTAGG - Intergenic
1127007560 15:54587534-54587556 AAACTCACAACTAAGGAGTTTGG + Intronic
1128928892 15:71685732-71685754 AAACTACCACTTTTCTAGTTTGG - Intronic
1129054774 15:72811268-72811290 CAACCACCACCTTAGGAACTGGG + Intergenic
1129357004 15:74997929-74997951 AAACTTCCATCTTAGCAGGTTGG + Intronic
1129733909 15:77948974-77948996 ATACTCCCACCTTAGCAGCTGGG - Intergenic
1131473934 15:92720162-92720184 ATACTATCACCTTAGGGGTTAGG - Intronic
1133888335 16:9853304-9853326 ACACCACCACATTAGGGGTTAGG - Intronic
1133924896 16:10184068-10184090 ATACCATCACCTTGGGAGTTAGG - Intergenic
1134654497 16:15937924-15937946 ATACCATCACCTTAGGGGTTAGG - Intergenic
1134795227 16:17029180-17029202 TAATTACCACCATAGGAGCTTGG - Intergenic
1135830706 16:25770393-25770415 TCACAACCACCTTAGGAATTTGG + Intronic
1136702919 16:32159830-32159852 CAACTACCACCTAGGGAATTGGG - Intergenic
1136764781 16:32767766-32767788 CAACTACCACCTAGGGAATTGGG + Intergenic
1136803318 16:33102618-33102640 CAACTACCACCTAGGGAATTGGG - Intergenic
1137667264 16:50258889-50258911 AAAATACTACCTTAAGGGTTGGG - Intronic
1137888717 16:52135190-52135212 AAACTACCACTTGGTGAGTTTGG + Intergenic
1138941215 16:61792994-61793016 ATACGATCACCTTGGGAGTTAGG - Intronic
1139511817 16:67432080-67432102 AAACTACTGCCTCAGCAGTTTGG - Intronic
1143395201 17:6589140-6589162 ATACTACCACATTGGGGGTTAGG - Intronic
1144243235 17:13335082-13335104 AAATAACTACCTTAGGAGTGGGG + Intergenic
1146030743 17:29364042-29364064 AACCCACCACATTAGGGGTTAGG + Intergenic
1147001653 17:37367587-37367609 AAAACACCACCTTAGAAGGTAGG - Intronic
1149015570 17:51904996-51905018 AAGCAGCCACCTTAGGAGGTTGG - Intronic
1149339084 17:55667836-55667858 GAATTACCACCTTAGGATCTGGG + Intergenic
1152373560 17:79905717-79905739 ACACCATCACCTTGGGAGTTAGG - Intergenic
1152863222 17:82708289-82708311 AAACTAACAGCTGAGCAGTTTGG + Intergenic
1153176465 18:2379198-2379220 AAACAACCATGTTGGGAGTTAGG + Intergenic
1153371925 18:4327188-4327210 AATCTACCATGTTAGCAGTTGGG - Intronic
1153886074 18:9467998-9468020 ATACTATCACCTTGGGAATTAGG - Intergenic
1154495954 18:14961282-14961304 ATACCATCACCTTAGGTGTTAGG + Intergenic
1154957565 18:21274297-21274319 AAACCATCACCTTGGGGGTTAGG + Intronic
1155107260 18:22679808-22679830 AAAATTCCCCCTTAAGAGTTAGG - Intergenic
1155129821 18:22922322-22922344 ACACTATCTCCTTAGAAGTTAGG + Intronic
1155343927 18:24839981-24840003 ATACTACCACCTTGGAGGTTAGG - Intergenic
1155466620 18:26142868-26142890 ATAGTATCACCTTAGGGGTTAGG + Intronic
1156782973 18:40874529-40874551 TAACTACCACTTCAGTAGTTAGG + Intergenic
1157382963 18:47236485-47236507 ATACCACCACCTTGGGGGTTAGG - Intronic
1157924650 18:51749953-51749975 ATACTACCACATTAGGTATTAGG + Intergenic
1158970995 18:62666321-62666343 TAACTAACACCTTAGCAGATAGG - Intergenic
1159101638 18:63964816-63964838 AAACTATCATCTTAGGGGTTAGG + Intronic
1159523686 18:69559984-69560006 ATACTAGCACCTTGGGAGTTAGG + Intronic
1159592459 18:70350002-70350024 AAACTACTTCCTTAGGAGTAAGG + Intronic
1160183360 18:76655245-76655267 ATACCACCACCTTGGGAGTTAGG + Intergenic
1162251988 19:9453023-9453045 ATATAAACACCTTAGGAGTTGGG - Intergenic
1163852322 19:19671478-19671500 ATACCATCACCTTAGGTGTTAGG + Intronic
1164062960 19:21691284-21691306 AAACTGCCACCATGGTAGTTAGG - Intergenic
1164579378 19:29425124-29425146 AAGCCATCACCTTAGGGGTTAGG + Intergenic
1165231500 19:34390110-34390132 TCAGTACCACCTGAGGAGTTGGG + Intronic
1165918782 19:39278759-39278781 TTACTACCACCTTAGGATGTAGG + Intergenic
1166441171 19:42816533-42816555 AAACTACCATCTGAGCTGTTGGG - Intronic
1166460651 19:42985140-42985162 AAACTACCATCTGAGCTGTTGGG - Intronic
1166477942 19:43145113-43145135 AAACTACCATCTGAGCTGTTGGG - Intronic
1168469560 19:56629425-56629447 ATACCATCACCTTAGGGGTTAGG - Intergenic
1168474481 19:56666022-56666044 AAAGCATCACCTTGGGAGTTAGG - Intronic
926470585 2:13251700-13251722 AAACAACCATTTTAGGAATTAGG - Intergenic
927004382 2:18833076-18833098 ATACTGTCACCTTAGGGGTTGGG - Intergenic
927091123 2:19713487-19713509 AAACTAGCAACAGAGGAGTTTGG - Intergenic
930385159 2:50685177-50685199 AAAATAGCATCTTAGAAGTTAGG - Intronic
930595314 2:53380117-53380139 AAACTACCACTTGTCGAGTTTGG - Intergenic
930760398 2:55028990-55029012 ATACTATCACTTTAGGGGTTGGG - Intronic
931373063 2:61682133-61682155 ATACCAGCACCTTAGGGGTTAGG - Intergenic
932837655 2:75052135-75052157 ATACCATCACCTTAGGGGTTAGG - Intronic
933500951 2:83110131-83110153 AACCTACCACCTTGGGCGTTAGG + Intergenic
934539284 2:95160625-95160647 ATACTATCACCTTGGGAGTTAGG - Intronic
936116314 2:109705868-109705890 AGATTTCCACCTTAGAAGTTTGG - Intergenic
937473762 2:122195966-122195988 ATACTACCACATTGGGATTTAGG - Intergenic
939273276 2:139967370-139967392 AAACAACCACAGTAGGACTTGGG + Intergenic
939786630 2:146521542-146521564 AAACTACAAACCTAGGAGGTAGG + Intergenic
940313692 2:152305561-152305583 ATACTACCACCGTATCAGTTAGG - Intergenic
940389906 2:153120260-153120282 AATCTACCACGTGAAGAGTTGGG - Intergenic
940808984 2:158221591-158221613 AAAATGCCACCTTAGGGGTAGGG - Intronic
941985218 2:171503843-171503865 ACACTACCATATTGGGAGTTAGG + Intergenic
942225090 2:173807933-173807955 ATACTATCACCTTGGGGGTTAGG + Intergenic
942488913 2:176469968-176469990 AAACTAGTGCCTTTGGAGTTGGG + Intergenic
944557079 2:200898028-200898050 ATACTACCACCTTCTGAGTTAGG - Intronic
944965464 2:204927230-204927252 ATACTAACACCTTAGGAGTTAGG - Intronic
945029756 2:205652291-205652313 AAACCACCATCTGAGAAGTTTGG + Intergenic
945734825 2:213586452-213586474 ACACTATCACCTTAAGAGTTAGG + Intronic
945834686 2:214824652-214824674 AAATTACCACCTTAAGTCTTAGG - Intergenic
946522002 2:220476141-220476163 AAACCATCACATTAGGGGTTAGG + Intergenic
947256155 2:228166014-228166036 AAACTACCACCAAATGAGTCTGG + Intronic
948428763 2:237905056-237905078 AAACTCCCACCATAGGATTCAGG + Intronic
949062873 2:241971427-241971449 AGACTTCCTCCATAGGAGTTCGG - Intergenic
1169300621 20:4439152-4439174 ATACTATCACATTAGGGGTTAGG - Intergenic
1169315824 20:4590416-4590438 ATACTATCACCTTGGGGGTTAGG - Intergenic
1169408538 20:5347192-5347214 ATACCACCACATTGGGAGTTAGG + Intergenic
1170306461 20:14944135-14944157 AAAATACCTTCTCAGGAGTTAGG - Intronic
1173179443 20:40793224-40793246 ATACTATCACCTTGGGGGTTAGG - Intergenic
1173291527 20:41719142-41719164 AAACCATCACCTTGGGGGTTAGG + Intergenic
1177222681 21:18215305-18215327 AAACTTCCACCTCAGGAGATAGG + Intronic
1177666415 21:24165788-24165810 AAACTATCACCTTGGGGATTAGG - Intergenic
1178017120 21:28360253-28360275 AAACTACCACATTAAGAAATGGG - Intergenic
1179030485 21:37715608-37715630 ATACTGTCACCTTAGGGGTTGGG - Intronic
1180010404 21:45046202-45046224 ATACTACCACCTCAGGGGTTAGG + Intergenic
1182246185 22:28959679-28959701 ATACCACCACCGTGGGAGTTAGG - Intronic
1184021131 22:41822205-41822227 GAACAACAAGCTTAGGAGTTTGG + Intronic
949196370 3:1313988-1314010 ATACTATCACCTTAGGGGTTAGG + Intronic
949917793 3:8977957-8977979 TGACAACCACCTTAGGAGTAAGG - Intergenic
951247856 3:20361753-20361775 ATACCATCACCTTAGGGGTTAGG + Intergenic
951801425 3:26600758-26600780 ATACCACCACCTTAGGGGCTAGG + Intergenic
952487752 3:33832347-33832369 ATACCATCACATTAGGAGTTAGG + Intronic
952679903 3:36079339-36079361 ATACTATCACCTTGGGAGTTAGG + Intergenic
954881789 3:53841271-53841293 AATCCACCAGCTTAGGAGGTTGG + Intronic
954895231 3:53969535-53969557 ATACTATCACCTTGGGGGTTAGG + Intergenic
955938852 3:64128875-64128897 AAACAAAAACCTTAGTAGTTTGG + Intronic
955952658 3:64257820-64257842 ATACTATCACTTTAGGGGTTAGG - Intronic
956361306 3:68450904-68450926 AAACTACAATCTTATGAGATTGG + Intronic
956393442 3:68799443-68799465 ATACCACCACCTTGGGGGTTAGG + Intronic
956747816 3:72323418-72323440 AAACCATCACCTTCGGGGTTAGG + Intergenic
956989053 3:74742382-74742404 AAACTACCTACTCAGGTGTTGGG - Intergenic
957311122 3:78520177-78520199 ATACTATCACCTTGGGGGTTAGG + Intergenic
959105289 3:102058531-102058553 ACACTCCCACCTCAGGATTTTGG - Intergenic
960461571 3:117942417-117942439 ATACCATCACCTTGGGAGTTAGG - Intergenic
960635114 3:119777211-119777233 AAACCATCACCTTGGGGGTTAGG + Intergenic
960895307 3:122498209-122498231 ACACTATCACATTGGGAGTTAGG - Intronic
962024286 3:131530934-131530956 AAACTACCACTTGTTGAGTTTGG + Intergenic
962351814 3:134661837-134661859 ATATTATCACCTTAGAAGTTAGG - Intronic
962578781 3:136778597-136778619 AAAGTACCAGGTTAGGTGTTAGG + Intergenic
963842533 3:150122345-150122367 ATACCATCACCTTGGGAGTTAGG - Intergenic
964015840 3:151945468-151945490 AAACCATCACCTTGGGGGTTAGG - Intergenic
964659761 3:159107177-159107199 ATACTACAGCCTTGGGAGTTAGG - Intronic
965910894 3:173773975-173773997 ATATTACCACCTTATGACTTCGG - Intronic
965968193 3:174522277-174522299 ATACCATCACCTTAGGGGTTAGG - Intronic
966022282 3:175229674-175229696 ATACTATCACCTTGGGGGTTAGG + Intronic
966433328 3:179855636-179855658 AATATATCACCTTTGGAGTTAGG - Intronic
967336863 3:188353684-188353706 AATCTGCCTCCTTATGAGTTTGG + Intronic
967675539 3:192294393-192294415 AAACTACCACCTTAGGAGTTAGG + Intronic
969179810 4:5430783-5430805 AAAATACCAGCTTTAGAGTTGGG + Intronic
970550696 4:17178085-17178107 AAACCATCACCTTGGGGGTTAGG + Intergenic
970954325 4:21792996-21793018 AAGCTACTGCCTTAGGTGTTTGG + Intronic
971498205 4:27290176-27290198 AAACTAACACTCTAGGAGGTTGG - Intergenic
972352106 4:38245410-38245432 ATACTATCACCTTGGGGGTTAGG - Intergenic
972833551 4:42841898-42841920 ATACTATCACCTTGTGAGTTAGG - Intergenic
974368798 4:60987292-60987314 AAACTGTCACTTTAGGAGTTAGG + Intergenic
974579095 4:63771664-63771686 AAACTATCACCTGAGTAGTTTGG - Intergenic
975320350 4:73003502-73003524 ATACTATCACCTTAGGAGTGAGG - Intergenic
975805066 4:78103574-78103596 AAACCGTTACCTTAGGAGTTAGG - Intronic
976064449 4:81168215-81168237 AACCTAGCACCTTTGGAGGTTGG + Intronic
977509420 4:97943232-97943254 ATACCATCACCTTGGGAGTTAGG + Intronic
977904933 4:102466501-102466523 ATACTACCACATTAGGCATTAGG - Intergenic
978155990 4:105489739-105489761 ATACCATCACCTTGGGAGTTAGG - Intergenic
978631888 4:110757206-110757228 ATACTATCACCTTGGGAGTTAGG - Intergenic
979348014 4:119612120-119612142 ATACTATCACCTTCGGGGTTAGG - Intronic
980347029 4:131634746-131634768 ATACCATCACCTTGGGAGTTAGG + Intergenic
980594551 4:134936238-134936260 AAACTATCACCATGGGAGTTAGG - Intergenic
981893792 4:149772595-149772617 AAACTACCACTTTGGAATTTGGG + Intergenic
982113440 4:152076973-152076995 ATACCATCACCTTGGGAGTTAGG - Intergenic
982219341 4:153111566-153111588 ATACCACCACCTTGGGGGTTAGG - Intergenic
982554584 4:156843101-156843123 ATACCATCACCTTAGGGGTTAGG - Intronic
983214641 4:164991830-164991852 TAAATATCACCTTAGGAATTAGG + Intergenic
987941367 5:24542907-24542929 AAACCATCACCTTAGGAGTTAGG + Intronic
988326555 5:29776128-29776150 ATACTATCACCTTGGGATTTAGG + Intergenic
988832589 5:35002507-35002529 AGACCATCACCTTGGGAGTTAGG - Intronic
988972915 5:36487772-36487794 ATACTATCACCTTGGGGGTTAGG - Intergenic
989055436 5:37361847-37361869 ATACTATCACATTAAGAGTTAGG - Intronic
989555405 5:42789120-42789142 AGACGACCTCCTTAGTAGTTTGG + Intronic
989761931 5:45025817-45025839 AAACTACCTCATTAGAAATTAGG + Intergenic
990377241 5:55183680-55183702 ATACTATCACCTTGGGGGTTAGG + Intergenic
990639514 5:57765707-57765729 ATACTACCACATTGGGAATTAGG + Intergenic
993756031 5:91731607-91731629 ATACTATCACCTTGGGGGTTAGG - Intergenic
993878424 5:93336216-93336238 ATACCATCACCTTAGAAGTTAGG + Intergenic
994090458 5:95805385-95805407 ATACCATCACCTTAGGGGTTAGG + Intronic
997650768 5:135517547-135517569 ATACAGCCACATTAGGAGTTAGG - Intergenic
1001187912 5:169594507-169594529 AAAATACCAATTTAGTAGTTAGG - Intronic
1001667776 5:173447458-173447480 ATACTACCACATTAGGGGTTAGG + Intergenic
1001677237 5:173528753-173528775 ATACTGTCACCTTAGGAATTAGG - Intergenic
1003428556 6:6017538-6017560 ATACTATCACATTAGGGGTTGGG - Intergenic
1003903190 6:10674260-10674282 AAACTATCACATTGGGAGTGAGG + Intronic
1004729097 6:18340429-18340451 ATACCATCACCTTAGGGGTTAGG - Intergenic
1005249339 6:23926826-23926848 CACCTCCCACCTTGGGAGTTAGG + Intergenic
1005820370 6:29593539-29593561 AAACTAAGATCTCAGGAGTTGGG + Intronic
1006784762 6:36658919-36658941 ACACTATCACATTAGGGGTTAGG - Intergenic
1007189763 6:40003536-40003558 ATACCACCACATTGGGAGTTAGG + Intergenic
1007752125 6:44077011-44077033 ACCCTCCCACTTTAGGAGTTGGG + Intergenic
1009896854 6:69762645-69762667 ATACTATCACATTGGGAGTTAGG - Intronic
1010304027 6:74296236-74296258 AAACTACCACCTAATGATATTGG - Intergenic
1011002014 6:82600982-82601004 AACCAACTACCTTTGGAGTTGGG - Intergenic
1011707411 6:90015346-90015368 CAACTACCACCTTAGGAAACTGG - Intronic
1012557615 6:100535059-100535081 AAACTAACACCTTAGAAGAGTGG - Intronic
1013408353 6:109862269-109862291 CAACTACCATCTGAGAAGTTTGG + Intergenic
1014059222 6:117051324-117051346 AACCTATCACATTATGAGTTAGG + Intergenic
1014914790 6:127133391-127133413 AAAATCCCACCTTAGGAGGCAGG + Intronic
1015719689 6:136228314-136228336 ATACGATCACCTTGGGAGTTAGG - Intergenic
1016543986 6:145199873-145199895 AAAATACAACCTTATGACTTAGG - Intergenic
1017121025 6:151024020-151024042 AAACTACGATCTTAGGGTTTAGG + Intronic
1018026155 6:159807801-159807823 AAACTACCACTTGTTGAGTTTGG + Intronic
1019013551 6:168862681-168862703 AAGCTACCACCTTTGGGGCTTGG - Intergenic
1019322814 7:423302-423324 ACACCAACACCTTAGGAGTGAGG - Intergenic
1020201550 7:6083960-6083982 ACACAACCAGCTTGGGAGTTAGG - Intergenic
1020743609 7:12053552-12053574 ATACCATCACCTTAGGAGTTAGG - Intergenic
1020939932 7:14519632-14519654 AAACAACTACTTTAGCAGTTTGG - Intronic
1021214887 7:17903455-17903477 AAACTACAGACTTAGGAGTTAGG + Intronic
1022224220 7:28346475-28346497 ATACCATCACCTTAGGGGTTAGG + Intronic
1022233623 7:28439691-28439713 AAAGTGCCATCTTAGGAGATAGG - Intronic
1022284823 7:28946558-28946580 ATACCATCACCTTAGGGGTTAGG - Intergenic
1022875960 7:34530249-34530271 AGACTTCCACCTTGGGATTTTGG + Intergenic
1023689725 7:42773246-42773268 ACACTTCAACCTTCGGAGTTAGG + Intergenic
1024952206 7:54876195-54876217 ATACTACCACCTTGGGAGTTAGG - Intergenic
1027842150 7:83326487-83326509 AAACTACAAGGTTAGGACTTTGG - Intergenic
1028564404 7:92212426-92212448 ATACCATCACTTTAGGAGTTAGG - Intronic
1028592636 7:92514264-92514286 ATACGATCACCTTGGGAGTTGGG + Intronic
1030247900 7:107405742-107405764 ATACTATCACCTTGGCAGTTAGG - Intronic
1031114512 7:117653573-117653595 ATACTATCACCTTGGGGGTTAGG + Intronic
1031909074 7:127494720-127494742 AAACCATCACCTTGGGGGTTAGG + Intergenic
1036067320 8:5396310-5396332 ATACTATCACCTTGGAAGTTAGG + Intergenic
1038096912 8:24323283-24323305 ACACCACCACCTTGGGAGTTAGG + Intronic
1040825185 8:51612551-51612573 ATACCATCACCTTAGGAGTTAGG - Intronic
1041472875 8:58230730-58230752 TCACAACCACCTTAGGAGATGGG - Intergenic
1042058797 8:64794677-64794699 ATACCATCACCTTGGGAGTTAGG + Intronic
1043344590 8:79285378-79285400 GATCAGCCACCTTAGGAGTTGGG - Intergenic
1045395286 8:101754615-101754637 ATACCATCACCTTAGGGGTTAGG + Intronic
1045671811 8:104563583-104563605 ATACTATAACCTTAGGAGTTAGG - Intronic
1046686172 8:117229199-117229221 ATACTACCTCCTTAGAAGTGAGG - Intergenic
1048107935 8:131431806-131431828 ATAATACCACTTTAGGAGTTAGG + Intergenic
1050217692 9:3346259-3346281 AAACTAGTATATTAGGAGTTTGG - Intronic
1051589876 9:18766816-18766838 ATACTATCACCTTGGGAGTTAGG + Intronic
1052231234 9:26156183-26156205 AAATTACCATCTTATGAATTAGG + Intergenic
1052840073 9:33285524-33285546 AAACTTCCACCTTAAGAAATTGG - Intergenic
1055205706 9:73727954-73727976 AAAAAGCCACTTTAGGAGTTTGG + Intergenic
1055599629 9:77902015-77902037 ATACCATCACCTTAGGGGTTAGG + Intronic
1055716705 9:79126130-79126152 AGACTACCACATTGGGAATTAGG - Intergenic
1055726677 9:79237578-79237600 ATACTATCACCTTGGGGGTTAGG + Intergenic
1056222933 9:84467917-84467939 TGACTATCACCTTGGGAGTTAGG - Intergenic
1056300025 9:85231103-85231125 AGGCTACCACCTTAGCAGTGAGG + Intergenic
1056361462 9:85861733-85861755 AAACTACTACCTTAGAAGGCTGG - Intergenic
1057126671 9:92621175-92621197 ACACCATCACCTTGGGAGTTGGG + Intronic
1057353008 9:94316189-94316211 ATACCATCACGTTAGGAGTTAGG + Intergenic
1057654738 9:96941402-96941424 ATACCATCACGTTAGGAGTTAGG - Intronic
1058184080 9:101833469-101833491 AATCTATCACCTTAAGAGTGAGG + Intergenic
1058827625 9:108788864-108788886 ATACTTTCACCTTGGGAGTTAGG + Intergenic
1058881899 9:109292642-109292664 AAACTGACACCTTAGGTATTTGG - Intronic
1058954926 9:109937232-109937254 AAACTACCACCTTGGTTTTTAGG + Intronic
1059493393 9:114688777-114688799 AAACTCACACCTTGGGGGTTTGG + Intergenic
1061223721 9:129267775-129267797 ATGCCACCACCTTAGGGGTTAGG - Intergenic
1185855469 X:3530771-3530793 ATACTATAACCTTGGGAGTTAGG + Intergenic
1186173053 X:6897836-6897858 ATACTATCACCTTAGGGGTGAGG + Intergenic
1186689021 X:11955227-11955249 ATATCATCACCTTAGGAGTTAGG + Intergenic
1186733601 X:12437278-12437300 GTAATACCACCTTGGGAGTTGGG - Intronic
1188044164 X:25406021-25406043 AAAGTTCAACCTTAGGGGTTGGG - Intergenic
1188431963 X:30113664-30113686 AAACCATCACCTTGAGAGTTAGG + Intergenic
1188678141 X:32968630-32968652 ATACTATCACTTTGGGAGTTAGG - Intronic
1188935228 X:36167459-36167481 GAACTACCACCTTACGAACTGGG + Intergenic
1189656927 X:43254380-43254402 ATACTACCACACTAGGGGTTAGG - Intergenic
1190241082 X:48658691-48658713 ATACTATCACATTAGGGGTTAGG + Intergenic
1192687122 X:73318715-73318737 AAACTTCCAGCTTGGGCGTTAGG + Intergenic
1194139179 X:90188194-90188216 AAAATACAACCTTATCAGTTAGG + Intergenic
1194314417 X:92357440-92357462 ATACTATCACCTTAGGGGTGAGG - Intronic
1194745181 X:97620457-97620479 ATACTATCACCTTGGGGGTTAGG + Intergenic
1195307446 X:103598369-103598391 ATACTATCACCTTGGAAGTTTGG - Intergenic
1195767445 X:108311355-108311377 AAAATACCAACTGAGGAATTTGG - Intronic
1196786395 X:119424949-119424971 AAACCATCACCCTAGGAGTCAGG + Intronic
1196990325 X:121321594-121321616 AAACTACAAACTCAGGAGGTGGG + Intergenic
1199250595 X:145657995-145658017 ATACCATCACCTTGGGAGTTAGG - Intergenic
1200094528 X:153650928-153650950 AAACTACCGCCGGAGGAGATGGG + Exonic
1200484923 Y:3757170-3757192 AAAATACAACCTTATCAGTTAGG + Intergenic
1200622475 Y:5468970-5468992 ATACTATCACCTTAGGGGTGAGG - Intronic