ID: 967677360

View in Genome Browser
Species Human (GRCh38)
Location 3:192316458-192316480
Sequence AAGGAGAGTACAGTGGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 2, 2: 17, 3: 84, 4: 339}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967677351_967677360 24 Left 967677351 3:192316411-192316433 CCATTAGTGGCTGCATGGCATGG 0: 1
1: 0
2: 6
3: 12
4: 162
Right 967677360 3:192316458-192316480 AAGGAGAGTACAGTGGTTGTGGG 0: 1
1: 2
2: 17
3: 84
4: 339
967677357_967677360 -7 Left 967677357 3:192316442-192316464 CCTGTGTGTTTGGGGTAAGGAGA 0: 1
1: 1
2: 2
3: 22
4: 230
Right 967677360 3:192316458-192316480 AAGGAGAGTACAGTGGTTGTGGG 0: 1
1: 2
2: 17
3: 84
4: 339
967677349_967677360 26 Left 967677349 3:192316409-192316431 CCCCATTAGTGGCTGCATGGCAT 0: 1
1: 0
2: 3
3: 11
4: 174
Right 967677360 3:192316458-192316480 AAGGAGAGTACAGTGGTTGTGGG 0: 1
1: 2
2: 17
3: 84
4: 339
967677350_967677360 25 Left 967677350 3:192316410-192316432 CCCATTAGTGGCTGCATGGCATG 0: 1
1: 0
2: 4
3: 13
4: 137
Right 967677360 3:192316458-192316480 AAGGAGAGTACAGTGGTTGTGGG 0: 1
1: 2
2: 17
3: 84
4: 339
967677348_967677360 27 Left 967677348 3:192316408-192316430 CCCCCATTAGTGGCTGCATGGCA 0: 1
1: 0
2: 3
3: 15
4: 131
Right 967677360 3:192316458-192316480 AAGGAGAGTACAGTGGTTGTGGG 0: 1
1: 2
2: 17
3: 84
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967677360 Original CRISPR AAGGAGAGTACAGTGGTTGT GGG Intronic
901594767 1:10376147-10376169 CAGGAGTGTAAATTGGTTGTGGG + Intronic
904659473 1:32073589-32073611 AAAGAGAGGAGAGTGGGTGTGGG + Intronic
904875914 1:33654468-33654490 AGGGAGAGCACAGTTGTTGCAGG + Intronic
904953139 1:34260504-34260526 AAGGAAAGTAGAATGGTGGTTGG + Intergenic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906732126 1:48091866-48091888 AAGGAGAGAACAGAAGTTGGAGG + Intergenic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907375498 1:54034784-54034806 AAAGAAAGTTCAGTGGTTGATGG + Intronic
907601581 1:55776436-55776458 AAGGAGAAGACAGTGGATCTGGG + Intergenic
909235718 1:73150986-73151008 AAGGAGAGTATATCGTTTGTAGG - Intergenic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
910321685 1:85953061-85953083 ATGGAGAATACATTGCTTGTTGG - Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910515489 1:88055094-88055116 AAGGAGAGCACCGTGATTGTGGG - Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
911011608 1:93287184-93287206 AAGGAGAATGCAGTGATTCTGGG + Intergenic
911239520 1:95449694-95449716 AAAGAGAGCACAGTGCTTGTGGG - Intergenic
912046684 1:105467866-105467888 AAAGAGAGTACAGTGTATTTTGG + Intergenic
912583924 1:110744605-110744627 GAAGAGAGAAAAGTGGTTGTGGG + Intergenic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
915005229 1:152629471-152629493 AAAGAGAGTGCAGTGATTGTGGG + Intergenic
915185825 1:154104529-154104551 CTGGGGAGTACAGTGATTGTGGG + Intronic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
917171677 1:172183445-172183467 AAGGAAAATACAGTGATTCTGGG + Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
918083837 1:181228430-181228452 AAGGAGAGGAGAGTGGATGCTGG - Intergenic
918290891 1:183106955-183106977 AAAGAGACTGCACTGGTTGTGGG + Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918683788 1:187389522-187389544 AAGGAGAATGCAGTGGCTTTGGG + Intergenic
919012495 1:191983306-191983328 AAGGAGAGTAGAGTTGCTTTCGG + Intergenic
919455770 1:197818271-197818293 ATGGAGAGCATAGTGATTGTGGG + Intergenic
919678560 1:200410257-200410279 AAGGAGATGAAAGTGGTTGAGGG + Intergenic
921329396 1:214020400-214020422 AAGGAGGGGGCAGTGGTTTTGGG - Intronic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
923062348 1:230487543-230487565 ATGGAGAAAACAGTGGTGGTTGG + Intergenic
923575486 1:235154909-235154931 AATGAGAGAACTGTGTTTGTTGG - Exonic
1063638633 10:7809947-7809969 AAGGAGAGGACAGAAGTTGGGGG - Intergenic
1063969944 10:11374616-11374638 AAGAGGAGCACAGTGGTTCTTGG + Intergenic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065431559 10:25662055-25662077 AAGGAGAGTGTAGTGACTGTGGG - Intergenic
1066311760 10:34204308-34204330 AAAGAGAGTCCAGTGGCAGTGGG + Intronic
1066649838 10:37643670-37643692 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067032728 10:42889217-42889239 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067324464 10:45253729-45253751 GAGGAGAGCACAGTGATTGGAGG + Intergenic
1068447821 10:57146178-57146200 AGGAAGAGCACAGTGGTTGTGGG + Intergenic
1069734889 10:70647569-70647591 AAGGAGAGCACTGTGCATGTGGG - Intergenic
1070409858 10:76129589-76129611 TAGGAGTGAACAGTGGTTCTGGG - Intronic
1070464134 10:76702878-76702900 AAGGAGAGTGCAGTGATCATGGG + Intergenic
1071935635 10:90527061-90527083 AGGGAGAGTACAGGATTTGTGGG - Intergenic
1073650404 10:105352543-105352565 ACAGAGAGTACAGTGGTGGTGGG - Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1076376709 10:129993146-129993168 AAGGAAAGCACGGTGATTGTGGG + Intergenic
1077632284 11:3818828-3818850 AAAAAGAGTACAGTGACTGTGGG + Intronic
1077646754 11:3932157-3932179 GAAGAGAGTCCAGTGGTGGTGGG - Intronic
1077911879 11:6579595-6579617 AAGGAGAGCAGAGTGATTGTGGG + Intronic
1078475226 11:11623413-11623435 GAAGAGAGAACAGTGGGTGTGGG + Intergenic
1078931581 11:15916013-15916035 AAGGAGAGGAGAGTGGATTTTGG - Intergenic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1079724676 11:23866398-23866420 AAGTAGAGTTTATTGGTTGTAGG + Intergenic
1080252781 11:30253850-30253872 ATGGAGAGTACATTAGTAGTAGG + Intergenic
1080489963 11:32751588-32751610 AAGGAGAGTGCAGCAATTGTGGG - Intronic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1081282497 11:41226975-41226997 AAGCAGAGGACTGTGGTTGTGGG - Intronic
1082250692 11:49976819-49976841 AAGGTGAGAGCAGTGCTTGTAGG + Intergenic
1082835153 11:57646077-57646099 AAGGAGAAAGCAGTGATTGTAGG + Intronic
1083528935 11:63398627-63398649 ATAGAGAGCACAGTGATTGTGGG - Intronic
1084110266 11:67009752-67009774 AAGGAGAGTCCAGCTATTGTGGG + Intronic
1084694829 11:70746917-70746939 AAGGGGAGTACAGCGGTGGAGGG - Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1086540049 11:87898306-87898328 AAGTAGAGTGCAGAGGTTGAGGG - Intergenic
1087102734 11:94380843-94380865 AAGGAGAGGCCAGTGCTTCTTGG - Intronic
1087473098 11:98601647-98601669 AAGGAAAGCACAATGATTGTAGG - Intergenic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1090292298 11:125555928-125555950 AAGGAGAGCACTGTGCATGTGGG - Intergenic
1092969469 12:13678269-13678291 AAGGACAATCCAGTGGTGGTGGG - Intronic
1093596802 12:20972370-20972392 TAGGAGAGAAAAATGGTTGTGGG + Intergenic
1094242849 12:28248722-28248744 AAGGATAGGACTGTGGTTGGAGG + Intronic
1095535469 12:43240877-43240899 GAGTAGAGGACAGTGGTTGATGG + Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1098100201 12:67007127-67007149 GAGGAGAGCACAGTGGTGATGGG + Intergenic
1098602892 12:72354317-72354339 AAGGAGAGAAGAGTGGTCTTGGG + Intronic
1098953220 12:76663231-76663253 AAGGAAAGAAGACTGGTTGTGGG + Intergenic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099825988 12:87779016-87779038 AAGGGGAGTACAGGGGAGGTGGG - Intergenic
1105408291 13:20149741-20149763 AAGGTGGGAACAGGGGTTGTGGG + Intronic
1106197977 13:27510278-27510300 AAGCAGAGGACAGTGGCTGCAGG - Intergenic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1107840310 13:44450700-44450722 AAGGGGAGTAAACTGGTTCTGGG + Intronic
1108400173 13:50033460-50033482 AAGCAGAGTACTGTGGGTCTGGG + Intergenic
1108972926 13:56400619-56400641 AAGGAGATCACAATGATTGTGGG + Intergenic
1110448876 13:75618612-75618634 AGGGAGAGTAGAGTGATTATGGG - Intergenic
1111296012 13:86278664-86278686 AAGGAGATTAGAGTGATTATAGG + Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1111351813 13:87041235-87041257 AAGGAGAGCACTGTGCATGTGGG - Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1113217495 13:108060162-108060184 ACCGAGAGTGCAGTGATTGTAGG + Intergenic
1113776681 13:112951630-112951652 GAGAATAGTTCAGTGGTTGTGGG + Intronic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1116888951 14:50249001-50249023 AGGGAGGGTACAGTGGCTGGGGG + Intronic
1117052187 14:51872021-51872043 CAGGTGAGTGCAGTGGTTGAAGG + Intronic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1117795546 14:59389370-59389392 AGAAAGAGTGCAGTGGTTGTGGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1119321018 14:73730363-73730385 CAGGAGAGTACAGTAGTTCAGGG + Intronic
1124582594 15:30973289-30973311 TAGCAGAGTAGAGTGGTTGTAGG - Intronic
1125442519 15:39718094-39718116 AAGGAGCTAACAGTGGATGTTGG - Intronic
1126572285 15:50164903-50164925 GAGGAGAGCACAGTGATTGTAGG - Intronic
1126640149 15:50816273-50816295 AAGGAGTGGGCAGTGGTTTTAGG + Intergenic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1127493203 15:59484558-59484580 AGGGAGAGTGCAGTGTTTATGGG + Intronic
1128789397 15:70422141-70422163 AAGGAGGGCAGAGTGGATGTTGG + Intergenic
1130275806 15:82475842-82475864 AAGGAGACCACAGTGCTTGCTGG + Intergenic
1130468165 15:84203234-84203256 AAGGAGACCACAGTGCTTGCTGG + Intergenic
1130496099 15:84470308-84470330 AAGGAGACCACAGTGCTTGCTGG - Intergenic
1130590458 15:85207832-85207854 AAGGAGACCACAGTGCTTGCTGG + Intergenic
1131275614 15:90978270-90978292 AAGGAGAGAAGAATGGATGTTGG - Intronic
1131470729 15:92694314-92694336 AAGGACAGTAGAGGTGTTGTTGG - Intronic
1131944800 15:97608397-97608419 AAGGAAAGTGCAGTGATTGTGGG + Intergenic
1135821284 16:25688753-25688775 AAGGACAGTACAGTGTGTGGTGG - Intergenic
1137329850 16:47482324-47482346 AAGGACAGTACAGAGTTTGTAGG - Intronic
1138594668 16:58023409-58023431 AAGGAGAGTTCTGAGGTCGTAGG - Intergenic
1138748312 16:59389413-59389435 AAGGAGGGCACAGTGCATGTGGG - Intergenic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1140618408 16:76695599-76695621 AAAGAGAGAAAAGTGGTTGCAGG + Intergenic
1140711851 16:77686022-77686044 AGAGAGAGTCCAGTGGTGGTGGG - Intergenic
1140830598 16:78747069-78747091 AAGAAGACTAGAGTGGTTGCAGG - Intronic
1141265564 16:82493869-82493891 AAGGAGAGAAGAGGGGTTGGAGG - Intergenic
1141644550 16:85360279-85360301 AAGAAGGGTGCAGAGGTTGTGGG + Intergenic
1142677915 17:1526421-1526443 AAGGAGTGTACAGGAGTTCTTGG + Intronic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1143479303 17:7219493-7219515 AGGGAGGGTACAGTGGTGGGGGG - Exonic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146271729 17:31489319-31489341 AAGGTGGTTACAGTGGTTGCTGG + Intronic
1147503802 17:40993704-40993726 AAGCAGAGTACATTAGTTGTAGG + Exonic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1151181150 17:72329622-72329644 GAAGAGAGTCCAGTGGTGGTGGG - Intergenic
1151412808 17:73942423-73942445 AAGCAAAGAGCAGTGGTTGTTGG + Intergenic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1157217883 18:45800899-45800921 AAGGAGGGAACACTGGTTGCAGG + Intergenic
1157275461 18:46308146-46308168 AAGGAGAGTGCAATGGATATTGG - Intergenic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1157991723 18:52504516-52504538 AAGTAAAGCACAGTGGCTGTGGG + Intronic
1158591418 18:58782070-58782092 AAGGAGAGTGAGCTGGTTGTTGG - Intergenic
1158716482 18:59884797-59884819 AAGGAGAATGGAGTGGTTGGTGG - Intergenic
1159446200 18:68544532-68544554 CAGGAGAGTGCAGTGATTGTGGG + Intergenic
1159513600 18:69428732-69428754 AAGGAGAATAGAGAGGTTGTTGG - Intronic
1163767342 19:19170893-19170915 AAGGAGAGGGAAGTGGTTGGTGG - Intronic
1166715699 19:44965967-44965989 AAGAAGAGGAGAGTGGTTATGGG + Intronic
1167135456 19:47612876-47612898 AAGGAGGGGACAGTGGCTGCGGG - Intronic
925194883 2:1914832-1914854 ATGGAAAAGACAGTGGTTGTGGG - Intronic
925338138 2:3113851-3113873 AGCAAGAGAACAGTGGTTGTGGG + Intergenic
925484838 2:4316526-4316548 AAGGACAGTACAGTAATTGTGGG - Intergenic
925786259 2:7434118-7434140 TAGGAGTGTGCAGTGGATGTGGG + Intergenic
925883176 2:8369843-8369865 AAGGAGAGGCCAGTGGCTGATGG - Intergenic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
928190621 2:29162983-29163005 AAGGAGTGTACAGTAGTAATTGG - Intronic
928468050 2:31541776-31541798 ATGGACAGTACAGTGATTGTGGG + Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
929281837 2:40088203-40088225 AAGGAAAGTGCAGTGACTGTGGG - Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935257830 2:101328143-101328165 CAGGAGAGAACTGTGGTGGTGGG + Intergenic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
938648976 2:133361156-133361178 AAGTAGGGTACATTGGTTGTGGG - Intronic
938811969 2:134862122-134862144 AAGGGGAGGACAGTTGTTGGGGG - Intronic
939635054 2:144571698-144571720 AAGGAGAGAACCGTGGTGCTGGG - Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942399361 2:175585047-175585069 AAGGAGAGTACAGATATTGAGGG - Intergenic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
942972378 2:181971868-181971890 AAGGAGAGCAAAGGGATTGTGGG - Intronic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
945709732 2:213280380-213280402 AATGAGTTTTCAGTGGTTGTTGG + Intergenic
946059319 2:216928085-216928107 AAGGAGAGTGGAGTGGTTAAGGG - Intergenic
946714383 2:222538127-222538149 ATGGAGAGACCAGTGGTTGCTGG + Intronic
947009273 2:225547616-225547638 AAGGAGAGTATAGTGATTGTGGG - Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
948811702 2:240481732-240481754 AAGGAGAGGCCAGTGGTGGAGGG + Intronic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1168900046 20:1355541-1355563 GAAGAGAGCACAGTGATTGTGGG - Intronic
1168906125 20:1405182-1405204 AGAGAGAGTCCAGTGGTGGTGGG + Intergenic
1169647347 20:7827231-7827253 CAGGAGAGTTCAGTGGGTTTAGG - Intergenic
1169905638 20:10600485-10600507 AAGGAGACAGCAGTGGTTGATGG + Intronic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170062648 20:12275854-12275876 AAGAAGAGTACAATTATTGTAGG + Intergenic
1170293795 20:14801837-14801859 AAGGAAAGTACAGTGATGCTCGG - Intronic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1173632300 20:44525834-44525856 AAGGAGAATACAGAGTTGGTGGG + Intergenic
1173709696 20:45143786-45143808 AGGGAGAGCTCAGTGCTTGTGGG - Intergenic
1174887210 20:54348924-54348946 CCAGAGAGTACAGGGGTTGTTGG + Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1176613251 21:9006156-9006178 GAGGAGAGTACAATGGGTATGGG + Intergenic
1176711920 21:10157640-10157662 GAGGAGAGTACAATGGGAGTGGG - Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1181997231 22:26892543-26892565 CAGGAGAGTAGAGTGGCTCTGGG + Intergenic
1182399155 22:30061191-30061213 AAGAAGAGAACAGTCCTTGTGGG - Intergenic
949448707 3:4163246-4163268 AAGGAGAGATAATTGGTTGTTGG - Intronic
949838398 3:8293672-8293694 AAGGAAAATAGAGTGGTGGTTGG + Intergenic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
951837248 3:26996923-26996945 CAGGAGAGTCCAGTGGTGGTGGG + Intergenic
952683366 3:36121723-36121745 AAGGAGAGCAAAGTGAGTGTGGG + Intergenic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
956281857 3:67566041-67566063 AAGGAGAGTATAGCGGTGGAAGG + Intronic
957046004 3:75375174-75375196 AAGGACAGTTCAGTGAGTGTAGG - Intergenic
957468694 3:80629898-80629920 AAGGAGAGGAAATTGGTTATTGG - Intergenic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957486029 3:80864337-80864359 AAGGGGAGTGCAGGGGTTGTGGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
958867058 3:99513381-99513403 AAAGAGAGTATACTGGTAGTTGG + Intergenic
959011243 3:101078878-101078900 AAGGAGACACCAGTGGTAGTTGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959806710 3:110562855-110562877 AAGGAGAATGCAGTGATTGTGGG - Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960298188 3:115968999-115969021 AAGGTGAGCTCAGTGATTGTAGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
961929691 3:130519947-130519969 AAGGAGATTACAATGTTTGGCGG - Intergenic
962638917 3:137362309-137362331 AAGCAGAGTAAAGTAATTGTGGG - Intergenic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
964140888 3:153397455-153397477 AAGGAGAGCAAAGTGATTGTGGG - Intergenic
964151561 3:153531753-153531775 AGGCAGAGCACAGTGTTTGTGGG + Intergenic
964216188 3:154286195-154286217 ATTGAGAGTAAAGTGTTTGTTGG - Intronic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
965256984 3:166425751-166425773 AAGGAGAGCACAGTGACAGTGGG + Intergenic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
966141830 3:176766299-176766321 AAGAAGAGTGCAGGGATTGTGGG + Intergenic
966328905 3:178789597-178789619 GAGAAGAGCACAGTGATTGTGGG + Intronic
967677360 3:192316458-192316480 AAGGAGAGTACAGTGGTTGTGGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
968005120 3:195237362-195237384 AAGGAGAGTGCAGCAGTTGTGGG - Intronic
968152746 3:196351392-196351414 GAGGAGAGTATAGTAGTTATAGG - Exonic
968339983 3:197947445-197947467 AAGGAAAGTGCAGTTGTAGTTGG - Intronic
969786863 4:9465192-9465214 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
969790292 4:9489671-9489693 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
969825051 4:9751036-9751058 AAGGACAGTTCAGTGAGTGTAGG + Intergenic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
975224885 4:71859756-71859778 TAGGAGAGTAACGTGGTTTTTGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
976762888 4:88569267-88569289 AAGGAGAGTGCCGGGATTGTGGG - Intronic
977278419 4:95008305-95008327 AAGGAAAGTAGAGTGGTTAAGGG - Intronic
977632137 4:99254897-99254919 AAGGAGAGTAGAATGAGTGTGGG - Intergenic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
977673313 4:99720402-99720424 AAGGAGATTAGAGTGGAGGTTGG + Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
979675328 4:123403068-123403090 AAGGAGAGGGCAGTGGTTAAAGG - Exonic
980712638 4:136590671-136590693 AAGAAGAGCACAGTGATTGTGGG + Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981758594 4:148168675-148168697 ACAGATATTACAGTGGTTGTTGG - Intronic
982074773 4:151727468-151727490 AGGGAGGTTACAGTGGTTGGTGG + Intronic
982683486 4:158459943-158459965 AAGGAGAGTGCAGTGGCTGGGGG - Intronic
982690019 4:158538051-158538073 CAAGAGAGAACAGTGTTTGTAGG + Intronic
982932570 4:161428075-161428097 AAGGAGAGTGCAGTGGTTTTAGG + Intronic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983572010 4:169219533-169219555 GAGGAGAGTACATTAGTTTTGGG - Intronic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
984143809 4:176036660-176036682 AATGAAAGTCCAGTGGTGGTGGG - Intergenic
984309599 4:178040335-178040357 AAGAGGAGTCCATTGGTTGTTGG - Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986621412 5:9679528-9679550 AACTAGAGTACAGTGTTTATGGG - Intronic
987169682 5:15240923-15240945 AAGGAGATTATTGTGGTTTTAGG + Intergenic
987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG + Intergenic
988384075 5:30539155-30539177 GAGAAGAGTACAGTGATTGCAGG + Intergenic
989480999 5:41930018-41930040 AAGTACAGTACTTTGGTTGTTGG + Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991395410 5:66199280-66199302 AGGGAGAGTACAGCAATTGTGGG - Intergenic
991926416 5:71709593-71709615 ACAGAGAGTTCACTGGTTGTGGG - Intergenic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993107114 5:83612054-83612076 AAGGAGACTTCAGTGCCTGTGGG + Intergenic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
994093732 5:95830308-95830330 AAGAAGAGAAAAATGGTTGTGGG + Intergenic
994995581 5:107058259-107058281 AAGGTGGGCACAGTGGGTGTGGG + Intergenic
995147001 5:108797540-108797562 AAAGAGAGCACTGTGATTGTGGG - Intronic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
998131930 5:139655723-139655745 AAGGGGTGGACAGTGGTTGGGGG - Intronic
1000358546 5:160425014-160425036 AAAGAGACTAAAGTGGTTCTAGG + Intronic
1000433411 5:161179310-161179332 ACGGAGAGCACAGTGATGGTGGG + Intergenic
1002276122 5:178105279-178105301 AAGGAGAGAGCGGTGCTTGTGGG + Intergenic
1009373629 6:62939374-62939396 AAGGAGAGCACAGTGATGGCAGG - Intergenic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010088792 6:71953617-71953639 AGGGAAAGTACAGTGGTAATGGG - Intronic
1011018857 6:82788606-82788628 AGGGAGAGTGCAGAGCTTGTCGG + Intergenic
1012059769 6:94463420-94463442 AAGGAAAGCTCAGTGATTGTGGG - Intergenic
1012892005 6:104907577-104907599 AAGGAAAGCACAGTGATTGTGGG + Intergenic
1013908450 6:115245936-115245958 AGGAAGAGTACAGCGATTGTGGG + Intergenic
1013996967 6:116320481-116320503 AAGGAGAGAACAGTGCAGGTTGG + Intronic
1014378651 6:120711156-120711178 ACGGAGAGTCCACTGATTGTGGG + Intergenic
1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG + Intronic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016350701 6:143163995-143164017 CAAGAGATTAAAGTGGTTGTAGG - Intronic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017281036 6:152626197-152626219 ATGAAGAGTAGAGTGTTTGTAGG + Intronic
1017384848 6:153871721-153871743 AAGGAAAGTACATTAGTTTTTGG - Intergenic
1017751245 6:157492208-157492230 AGGGAGACTACAGTGGCTGGGGG - Intronic
1018444174 6:163840172-163840194 AAGTAGATTACAGTGGATGCTGG - Intergenic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021234439 7:18124933-18124955 AAATAGATGACAGTGGTTGTTGG + Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1023661834 7:42478260-42478282 AGAGAGAGTCCAGTGGTGGTGGG - Intergenic
1024922125 7:54569199-54569221 AATTAGAGTACAGTGGGTGCAGG - Exonic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1025908835 7:65811118-65811140 CAGGAGAGTACTGTGAATGTGGG + Intergenic
1025980033 7:66397810-66397832 CAGGAGAGTACTGTGAATGTGGG - Intronic
1026043502 7:66888322-66888344 CAGGAGAGTACTGTGAATGTGGG + Intergenic
1027204909 7:76090149-76090171 CAGGAGAGTACTGTGAATGTGGG - Intergenic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027604764 7:80287304-80287326 GTGGAGAGAACAGTGATTGTAGG + Intergenic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028185175 7:87775551-87775573 CAGTAGTGTACAGTAGTTGTAGG + Intronic
1028242488 7:88438160-88438182 AAGGAGTGGGCAGTGGTTGAGGG - Intergenic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1031306148 7:120130320-120130342 AAGGAGAGTGCAGTAATTTTGGG + Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031732541 7:125316384-125316406 AGGGAGAGTACAGAGATTTTGGG + Intergenic
1032906888 7:136378372-136378394 AGATAGAGGACAGTGGTTGTAGG + Intergenic
1033502514 7:141966088-141966110 AAGGAGAGTGCAGTGATTGAGGG - Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1036011990 8:4736345-4736367 AAGGAGATCACAATGGTTGGAGG + Intronic
1036042382 8:5100424-5100446 AAGAAGAATAAGGTGGTTGTTGG - Intergenic
1037475253 8:19250959-19250981 AAGGAGAGTAAAGTTGATGGAGG - Intergenic
1038067273 8:23975996-23976018 CTGGAGAGGACAGTGTTTGTGGG + Intergenic
1039133545 8:34294804-34294826 AGAGAGAGTCCAGTGGTGGTGGG - Intergenic
1042383667 8:68149227-68149249 AAGGAGGGCACAGTAGTTGATGG + Intronic
1042578347 8:70248397-70248419 AATCAGAGTATCGTGGTTGTTGG - Intronic
1043214885 8:77573652-77573674 AAGGAGAGCAAAGTGATTGTGGG + Intergenic
1043567203 8:81561639-81561661 AAGGAGGGCACGGTGATTGTGGG + Intergenic
1043585233 8:81760899-81760921 AAAGAGAGCAAAGTGGTGGTGGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1045070073 8:98493844-98493866 AAGGAGAGAAGAGGGGTTGGTGG - Intronic
1045497726 8:102722341-102722363 AAGGAGTGGACAGTGGATGGAGG - Intergenic
1045786954 8:105932863-105932885 AATGAGCATACAGTGGTTCTCGG - Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1049580115 8:143407267-143407289 AAGGAGAGCTCAGTGGCTGGTGG + Intergenic
1049980139 9:896480-896502 AATCAGAGAACAGTGGTTGCCGG - Intronic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG + Intergenic
1051599772 9:18861361-18861383 AAGGAGACTGCATTGGTTTTAGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052246116 9:26337407-26337429 AAGGGAAGTTCAGTGGTTGTTGG + Intergenic
1053017123 9:34668235-34668257 AAGAAGAGAACAGTGCATGTGGG - Intergenic
1053648916 9:40143328-40143350 GAGGAGAGTACAATGGGAGTGGG - Intergenic
1053756828 9:41320525-41320547 GAGGAGAGTACAATGGGAGTGGG + Intergenic
1054535667 9:66232842-66232864 GAGGAGAGTACAATGGGAGTGGG + Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1057891050 9:98870095-98870117 AAGTAGAGGAGAGTGGATGTTGG + Intergenic
1059283919 9:113156786-113156808 AAGGAGGGTACAGTGGGAGCTGG - Intronic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1059910672 9:119040559-119040581 AAGGAGGGGACAGTGGTGGTTGG - Intergenic
1060304380 9:122397773-122397795 AGGGAGAGTGTAGTGGTTGTAGG + Intergenic
1202796674 9_KI270719v1_random:126629-126651 GAGGAGAGTACAATGGGAGTGGG - Intergenic
1185755848 X:2652309-2652331 AAGGAGACTACAGTGTTTGGGGG + Intergenic
1187723890 X:22182388-22182410 AAGGAGAGTACGGTGATTGTGGG - Intronic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188585816 X:31773882-31773904 TAGGAGAGTAAAGTGATTGGTGG + Intronic
1188652013 X:32642863-32642885 AAGGACAGTAAAGAGGTGGTTGG + Intronic
1188716548 X:33465465-33465487 AAAGAGAGCACAATGATTGTGGG - Intergenic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189412003 X:40780596-40780618 AAGGAGAGCACAGTGATGGTGGG - Intergenic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1189640650 X:43067449-43067471 AAGGAAAGTGTAGTGATTGTGGG + Intergenic
1190498451 X:51051566-51051588 AAAGAGAGTAAAGTGATTATGGG + Intergenic
1190521508 X:51282852-51282874 AAAGAGAGTAGAGAGATTGTGGG + Intergenic
1190708714 X:53050186-53050208 AAGGACAGTGAAGTGGTGGTGGG + Intronic
1192069528 X:67922544-67922566 AGAGAGAGTGTAGTGGTTGTGGG + Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1193098221 X:77578040-77578062 AAGGAGAGTGCAGTGATCATAGG + Intronic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194239791 X:91431316-91431338 ACAGAGAGTAGAGTGGTGGTTGG - Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196619479 X:117806333-117806355 CAGGAGAGCACAGTGACTGTGGG + Intergenic
1197011478 X:121569974-121569996 AGGGAAAGTACAATGATTGTGGG + Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199431839 X:147770667-147770689 AGAGAGAGTTCAGTGGCTGTGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199916495 X:152347343-152347365 AAGGATAGTGGAGTGGTTGAGGG + Intronic