ID: 967679113

View in Genome Browser
Species Human (GRCh38)
Location 3:192339066-192339088
Sequence TATGAACCACAACATGATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 230}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967679112_967679113 -6 Left 967679112 3:192339049-192339071 CCTGTTTGAAAGTTTTATATGAA 0: 1
1: 0
2: 0
3: 29
4: 399
Right 967679113 3:192339066-192339088 TATGAACCACAACATGATAATGG 0: 1
1: 0
2: 2
3: 20
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967679113 Original CRISPR TATGAACCACAACATGATAA TGG Intronic
902101673 1:13995881-13995903 TTTGAAGCTCAACATGATAGAGG + Intergenic
904802742 1:33106758-33106780 AATGTACCTCAACATGATAAGGG + Intronic
905331259 1:37200335-37200357 AATGCACCTCAACATAATAAAGG + Intergenic
906895832 1:49770173-49770195 TATGTACCTCATCACGATAACGG - Intronic
908980121 1:69946123-69946145 AATGTACCCCAACATGCTAAAGG - Intronic
910380123 1:86617602-86617624 TATGGAAAACAGCATGATAAGGG - Intergenic
910521506 1:88127161-88127183 TAAGAACTATAACAGGATAAAGG - Intergenic
912065732 1:105739526-105739548 TATAAACAGGAACATGATAAAGG - Intergenic
914831258 1:151172574-151172596 TATGAGCCACTAGAGGATAAAGG + Intronic
915703140 1:157816434-157816456 GATGTACCTCAACATAATAAAGG + Intronic
917574121 1:176302457-176302479 TGTGTACCACAACATGAAGAAGG - Intergenic
918054995 1:181013320-181013342 TCTCAACCACAACAGGAAAAAGG - Intronic
918664581 1:187134185-187134207 TATGTACCTCAACACAATAAAGG + Intergenic
919057791 1:192592278-192592300 TATGAACCATGATATGAAAAGGG + Intergenic
919089682 1:192962987-192963009 AATGTACCTCAACATAATAAAGG + Intergenic
919330608 1:196165635-196165657 TATGTACCTCAACAAAATAAAGG + Intergenic
919375773 1:196792647-196792669 TATGAATCCCTACATGATTATGG - Intronic
919696769 1:200584694-200584716 AATGTACCTCAACATAATAAAGG + Intronic
921381558 1:214529895-214529917 TATTAACCACTATATGACAATGG + Intronic
921683708 1:218065226-218065248 CATGAACTGCAGCATGATAAAGG + Intergenic
924837044 1:247660556-247660578 AATGTACCTCAACACGATAAAGG - Intergenic
1064979785 10:21154565-21154587 TATGAAACAGAATATGAGAAAGG + Intronic
1066578727 10:36856480-36856502 AATGTACCTCAACATAATAAAGG - Intergenic
1069267816 10:66485076-66485098 AATGTACCACAACATAATATAGG + Intronic
1070862170 10:79679819-79679841 TATGAACCACAAAATAAAGATGG + Intergenic
1070874966 10:79794637-79794659 TATGAACCACAAAATAAAGATGG - Intergenic
1071615841 10:87075435-87075457 AATGAAACAGAAAATGATAAAGG + Intronic
1071641890 10:87316802-87316824 TATGAACCACAAAATAAAGATGG - Intergenic
1073972666 10:109061895-109061917 AATGGACCACATCATGATAGTGG - Intergenic
1075282344 10:121150261-121150283 CATGTACCTCAACATAATAAAGG - Intergenic
1076257124 10:129036447-129036469 TATGAACCACCTGATGAAAAAGG + Intergenic
1077935212 11:6777100-6777122 AATGTACCTCAACATAATAAAGG - Intergenic
1077951526 11:6962924-6962946 TATGACACACAACATGACACAGG - Intronic
1079254464 11:18815762-18815784 AATGTACCACAACACAATAAAGG - Intergenic
1079474238 11:20812086-20812108 TATATACCTCAACATAATAAAGG - Intronic
1079687847 11:23383575-23383597 AATATACCACAACATAATAAAGG + Intergenic
1080601463 11:33824682-33824704 TAAGATCAAGAACATGATAAGGG - Intergenic
1080846264 11:36029767-36029789 CATGAGTCACAAAATGATAAAGG - Intronic
1081032665 11:38105484-38105506 TAAGAAAAACAAAATGATAATGG - Intergenic
1081054409 11:38390756-38390778 TATGAAGCACAACTTAACAAAGG + Intergenic
1081307258 11:41528424-41528446 TATGAACCAGAGCTTGAAAATGG + Intergenic
1085972967 11:81615960-81615982 AATATACCCCAACATGATAAAGG + Intergenic
1086086467 11:82960252-82960274 TATGAACTAAAACATGAATACGG - Intronic
1086589134 11:88491243-88491265 TATGCACCTCAACATAATAAGGG + Intergenic
1088745731 11:112802398-112802420 AATGTACCACAACACAATAAAGG + Intergenic
1089167209 11:116486383-116486405 AATGAATCACATCATGATTATGG + Intergenic
1090317765 11:125810754-125810776 TAATAACCACATCATGAAAACGG + Intergenic
1091420313 12:333501-333523 CATGAACCCCAACGTGCTAATGG - Exonic
1093304062 12:17490329-17490351 TATAAACCACAAAACAATAAGGG - Intergenic
1093444797 12:19244785-19244807 TATGAAACACTGCATAATAAAGG + Intronic
1095322145 12:40841768-40841790 AATGTACCTCAACATAATAAAGG + Intronic
1095756496 12:45772753-45772775 TATGAAGCAAAAACTGATAAAGG + Intronic
1095787157 12:46122399-46122421 TATGAAAGACAAAATGAAAAGGG + Intergenic
1097371747 12:58790891-58790913 AATGTACCTCAACATAATAAAGG + Intronic
1099164021 12:79279582-79279604 TAAGAACCAGAACAAGACAAGGG + Intronic
1099752790 12:86799967-86799989 TATGAGTCAAAACATGAAAATGG + Intronic
1100333442 12:93607323-93607345 CATGAAACACAATTTGATAAGGG + Intergenic
1100665778 12:96751424-96751446 TATGATATACAATATGATAATGG - Intronic
1103315178 12:120048425-120048447 TATGAACTACAAAAAGATCAAGG - Intronic
1104384240 12:128336060-128336082 TTTAAAACACAAAATGATAATGG - Intronic
1105014077 12:132775551-132775573 TCTGAGCATCAACATGATAAAGG - Intronic
1108486787 13:50934899-50934921 TATCCACCACAACTTGATCAAGG - Exonic
1109487623 13:63048041-63048063 TACAAACCACAAGATGATAAAGG - Intergenic
1109610308 13:64756652-64756674 TATGAATCATTATATGATAAAGG - Intergenic
1109691610 13:65899611-65899633 AATAAACCTCAACATAATAAAGG - Intergenic
1109758679 13:66797300-66797322 TATCAACCCCAAGATGATAATGG - Intronic
1110548629 13:76785893-76785915 AATGTACCTCAACATAATAAAGG + Intergenic
1111608516 13:90573069-90573091 TATGAATCAAAAAATGATCATGG + Intergenic
1112395428 13:99026274-99026296 TATGAATCATATCCTGATAAAGG + Intronic
1116426950 14:44802435-44802457 TATGAATCAAAACATAAAAAAGG - Intergenic
1116467159 14:45247400-45247422 TCTGCACCAAAGCATGATAAAGG - Intronic
1119731093 14:76951535-76951557 TAACAACCACAGCATGATATTGG - Intergenic
1120730945 14:88000994-88001016 AATGTACCTCAACATAATAAAGG - Intergenic
1121748500 14:96323770-96323792 TATGAACCACAAAAGAATCAAGG + Intronic
1122460453 14:101890244-101890266 TATGAAACAGAGCATCATAATGG + Exonic
1124408199 15:29410703-29410725 TGTGTGCAACAACATGATAAAGG - Intronic
1125124436 15:36202954-36202976 AATGTACCTCAACATAATAAAGG - Intergenic
1126236917 15:46396374-46396396 TATGAACTTCACCATAATAAAGG + Intergenic
1127197117 15:56599687-56599709 TACCAACCACAACATTTTAAAGG - Intergenic
1127596798 15:60492100-60492122 TATCAAAAACAACATGGTAAAGG + Intronic
1128871501 15:71159968-71159990 TATGTACCATAACACAATAAAGG - Intronic
1131470500 15:92692647-92692669 GACGTACCACAACATAATAAAGG + Intronic
1131613295 15:93987621-93987643 TATGAACCACAAGATTCAAAGGG + Intergenic
1132448116 15:101947427-101947449 AATGTACCACAACACAATAAAGG - Intergenic
1133652905 16:7829772-7829794 TTTCAACCACAACAAAATAATGG - Intergenic
1136010760 16:27362291-27362313 TCTGGAGCACAACATGAAAAGGG + Exonic
1136601646 16:31295868-31295890 AATGTACCTCAATATGATAAAGG - Intronic
1138153500 16:54681571-54681593 TATAAACCATGACATGAAAATGG - Intergenic
1144151093 17:12447412-12447434 AATGTACCTCAACATAATAAAGG - Intergenic
1145355183 17:22139015-22139037 TACAAACCACAAGATGTTAAAGG + Intergenic
1145407244 17:22614527-22614549 TATGAACCACAAAATAAAGATGG - Intergenic
1149027378 17:52043705-52043727 AATGTACCTCAACATAATAAAGG - Intronic
1153714369 18:7831558-7831580 TAACAACCACATCATGAAAAGGG + Intronic
1154090543 18:11356265-11356287 AATGTACCTCAACATAATAAAGG + Intergenic
1154097952 18:11437594-11437616 AATGAATCTCAACATAATAAAGG + Intergenic
1155896944 18:31341686-31341708 AATGAACCAAGACAAGATAAAGG + Intronic
1156672883 18:39491763-39491785 TATGTACTTCAACATGGTAAAGG + Intergenic
1158650903 18:59284515-59284537 AATGTACCTCAACATAATAAAGG - Intronic
1158747900 18:60222858-60222880 AATGTACCTCAACATAATAAAGG - Intergenic
1158782863 18:60672558-60672580 TATTAACTACAACTTGATATAGG + Intergenic
1164946611 19:32299389-32299411 AATGCACCTCAACATAATAAAGG - Intergenic
1165180948 19:33968241-33968263 TATCAACAACAACATGAAATAGG - Intergenic
926404310 2:12535005-12535027 TATCAACCACCACATGATGCTGG - Intergenic
927355889 2:22172738-22172760 AATGTACCTCAACATGATAAAGG - Intergenic
927983654 2:27392236-27392258 CAGGAACAACAACATGATGAAGG - Intronic
929129519 2:38553387-38553409 TATGAACAGCAATATGATGAGGG + Intergenic
929257936 2:39832782-39832804 AATGTACCTCAACATAATAAAGG - Intergenic
930783147 2:55243613-55243635 TATGAACAAGAACAGGAGAAAGG - Exonic
931636423 2:64344460-64344482 TATGCACCACAACAGGACATAGG - Intergenic
933191207 2:79336237-79336259 AATCAACCACAACATGATTTTGG - Intronic
935004105 2:99053611-99053633 TATGTACCTCAACACAATAAAGG + Intronic
936560091 2:113530348-113530370 TATGAACCATGACATGATCGTGG + Intergenic
936696520 2:114955936-114955958 AATGTACCTCAACATGATAAAGG + Intronic
936850430 2:116890781-116890803 AATGTACCACAACACGATAAAGG - Intergenic
939431259 2:142111470-142111492 TAGGAAGCAAAACATGATCATGG + Intronic
939724979 2:145707630-145707652 AATGTACTTCAACATGATAAAGG - Intergenic
941199291 2:162489830-162489852 TATAAATAACAACAAGATAATGG + Intronic
941256339 2:163236401-163236423 CATGAACCTCAACATAATAAAGG - Intergenic
942103228 2:172606755-172606777 TGTGAACTTCAACATGAAAAAGG - Intronic
944726420 2:202475658-202475680 TAAAAACCCCAACATGAAAAAGG - Intronic
945389802 2:209250668-209250690 AATGTACCACAACATAACAAAGG + Intergenic
945501912 2:210586410-210586432 TTTGAAACACAGCATGATAGAGG + Intronic
946103174 2:217344859-217344881 TATTTAGCACAACATGCTAATGG + Intronic
947584358 2:231343719-231343741 AATGAACCTTAACATGATTAGGG - Intronic
948713709 2:239843955-239843977 TATGTCCCTCAACATGATAAAGG - Intergenic
1172219867 20:33266383-33266405 TAATAACCACAGCTTGATAAAGG + Intergenic
1177916887 21:27099946-27099968 TATGCAACAGAACATGAAAAAGG + Intergenic
952629970 3:35454476-35454498 AATGAAACACAAAATGTTAAAGG + Intergenic
953273667 3:41473084-41473106 AATGTACCTCAACATAATAAAGG + Intronic
954543376 3:51411680-51411702 TATAAACCAGAACTTTATAAAGG + Intronic
954686655 3:52374195-52374217 TATGAAACAGAGCATCATAATGG + Intronic
954941248 3:54375213-54375235 ACTGCAACACAACATGATAAAGG - Intronic
957937864 3:86967575-86967597 TGTGAACCAGCACATGATTAAGG + Intronic
961500840 3:127333793-127333815 AATGTACCTCAACATAATAAAGG + Intergenic
963446362 3:145414394-145414416 AATATACCACAACATAATAAAGG - Intergenic
964954922 3:162341982-162342004 AACAAACCACAAAATGATAAAGG - Intergenic
965867772 3:173226176-173226198 TATAAATCACAATATCATAATGG + Intergenic
967588393 3:191242020-191242042 TGTGATAAACAACATGATAATGG - Intronic
967679113 3:192339066-192339088 TATGAACCACAACATGATAATGG + Intronic
967842119 3:194014304-194014326 TATGAACAAGAACATGGTGAGGG + Intergenic
970633977 4:17986664-17986686 TAAGAATCACAAAATGATACGGG - Intronic
971062201 4:22985004-22985026 TACCCACCACAACAAGATAAGGG + Intergenic
972378005 4:38491248-38491270 TTTGATCCACTGCATGATAATGG + Intergenic
973981776 4:56314037-56314059 TAGGATCCACAACATGAGCAAGG + Exonic
974434356 4:61837956-61837978 TATGAAGCACATCATGACAATGG - Intronic
977708753 4:100100420-100100442 TAGGAAGCACAACCTGAAAATGG + Intergenic
977776285 4:100923368-100923390 TAATAACCAGAACATGATATTGG + Intergenic
978315289 4:107428923-107428945 TGTGAACCACAACTTGCAAAGGG + Intergenic
980023879 4:127741368-127741390 AATGTACTACAACATAATAAAGG - Intronic
980144330 4:128962570-128962592 TCTGAAACACAAAATGATAGAGG - Intronic
980346264 4:131624585-131624607 AATGTACCACAACATAATAAAGG + Intergenic
981224654 4:142278865-142278887 TATGAACCAGAACACCACAAAGG + Intronic
981256591 4:142668343-142668365 AATGAACCTCAACAAAATAAAGG + Intronic
983130275 4:164010878-164010900 TAGTAACCACAGCATGATACTGG + Intronic
984401072 4:179264895-179264917 AATGTATCACAACATAATAAAGG + Intergenic
984707044 4:182855215-182855237 AATGAACCAAGACATGTTAAGGG - Intergenic
985133811 4:186765672-186765694 TATGAATCACTACATGATTGAGG + Intergenic
986049242 5:4072128-4072150 AATGTATCTCAACATGATAAAGG - Intergenic
986111192 5:4720036-4720058 TATCAAAGACAAAATGATAATGG + Intergenic
987782072 5:22451556-22451578 AATGTACCTCAACATAATAAAGG + Intronic
989765903 5:45083128-45083150 TATATACTACAACATAATAAAGG + Intergenic
989778974 5:45242264-45242286 AATGAACGAAAAAATGATAAGGG - Intergenic
990229114 5:53691371-53691393 AATGTACCTCAACATAATAAAGG + Intergenic
990537955 5:56742374-56742396 TATGTACCACTGGATGATAAAGG + Intergenic
990761327 5:59133148-59133170 CATGAAACACAAAATGAAAAAGG + Intronic
992932344 5:81661748-81661770 TACGAACCAAACCCTGATAAGGG - Intronic
993598963 5:89896255-89896277 TATGCACCTCAACATAAAAAAGG + Intergenic
994243375 5:97450001-97450023 TATGAACAACAAAATGATAATGG - Intergenic
994444070 5:99850328-99850350 AATGTACCAAAGCATGATAAAGG - Intergenic
994645826 5:102467567-102467589 TAATAACCCCCACATGATAAGGG - Intronic
994696781 5:103081363-103081385 AATGTACCTCAACATAATAAAGG - Intergenic
994798438 5:104337379-104337401 TTTGAATGACAAAATGATAAAGG - Intergenic
995003725 5:107165613-107165635 TATGAAGTTCAACTTGATAAAGG - Intergenic
996264714 5:121524364-121524386 AATGTACCTCAACATAATAAAGG + Intergenic
997217085 5:132121450-132121472 TAGTAACCAAAACATGGTAATGG + Intergenic
997813198 5:136992258-136992280 TATGTACCACAGCATGCTTACGG + Intronic
998781138 5:145658202-145658224 TATGAACAAAAAAATGTTAAAGG + Intronic
1000642852 5:163724071-163724093 TATGAAACACAAAATGACAAAGG - Intergenic
1001903413 5:175450901-175450923 TATGAACCACAAAAGGATTCAGG + Intergenic
1002871981 6:1175328-1175350 CATCATCCACAAAATGATAAGGG + Intergenic
1003779039 6:9402599-9402621 TTTGAAGAAAAACATGATAAAGG + Intergenic
1004622085 6:17339866-17339888 TGTAAACTACAACATGGTAATGG - Intergenic
1005683267 6:28227487-28227509 GATGAACCACAACATGAGGTAGG + Exonic
1008140481 6:47826176-47826198 CATGAACCACAATATGCTATGGG - Intronic
1008702407 6:54117087-54117109 AATGTACCTCAACATGATAAAGG + Intronic
1012060794 6:94477438-94477460 TATGTACCTCAACACAATAAAGG - Intergenic
1014829614 6:126086930-126086952 TATGAATAATACCATGATAAAGG - Intergenic
1014950957 6:127555422-127555444 TATGAACCACAAATTATTAAAGG - Intronic
1016708079 6:147137148-147137170 TATGAACTACAACTTGAATATGG - Intergenic
1019720757 7:2569160-2569182 CATGAACCCCAACATGAAAGGGG - Intronic
1019832720 7:3349298-3349320 TATGAACCACAGTCTAATAAGGG - Intronic
1020405637 7:7830616-7830638 AATGAACCAAAACATGCTGAAGG - Intronic
1020691370 7:11358709-11358731 TAGAAACCACAAGCTGATAAGGG + Intergenic
1020859543 7:13473823-13473845 AATGTACCTCAACATAATAAAGG + Intergenic
1023409118 7:39870718-39870740 TATGAAACATAACATGTCAATGG + Intergenic
1023696025 7:42847644-42847666 AATGTACCTCAACATAATAAAGG + Intergenic
1025043813 7:55673311-55673333 TATGAAACATAACATGTCAATGG - Intergenic
1025136739 7:56421832-56421854 TATGAAACATAACATGTCAATGG - Intergenic
1028176402 7:87664944-87664966 AATGTACCTCAACATAATAAAGG + Intronic
1029056251 7:97746423-97746445 TATGTTTCTCAACATGATAAAGG + Intergenic
1029340568 7:99940527-99940549 TAGGAAGCACAACATAAGAATGG - Intergenic
1030996385 7:116363664-116363686 TGTGAACCTCAACAAGATACTGG - Intronic
1031160624 7:118163055-118163077 AATGAACCTCAACACAATAAGGG - Intergenic
1031185256 7:118471870-118471892 TATGAACCAAAACCTGTGAAGGG + Intergenic
1031402013 7:121336519-121336541 TATGCACTACAACACGATGAAGG - Intronic
1031802312 7:126263361-126263383 TATGTACCTCAACACAATAAAGG - Intergenic
1031813699 7:126405752-126405774 TATTAACAACAACAAGAAAATGG + Intergenic
1033766352 7:144495493-144495515 TATGTACCTCAACACAATAAAGG - Intronic
1034757570 7:153637246-153637268 AATGTACCTCAACATGATAAAGG - Intergenic
1034903483 7:154922813-154922835 TATGAAGAACAACTTGATACTGG - Intergenic
1037537217 8:19835878-19835900 GATGTGCCACAACATGAAAAGGG + Intronic
1038795323 8:30704362-30704384 TAAGAAAGACAACAGGATAATGG + Intronic
1040371141 8:46776431-46776453 TATGTTTCTCAACATGATAAAGG - Intergenic
1041746900 8:61217271-61217293 CATGAACCACAAGAAGAGAATGG + Intronic
1044669313 8:94662905-94662927 TATGAACAAAAACAAGTTAAAGG - Intronic
1044876648 8:96674280-96674302 TTTTAACCACAACATCATTAAGG - Intronic
1048022473 8:130552735-130552757 AATATACCTCAACATGATAAAGG - Intergenic
1048463964 8:134647362-134647384 AATGTACCACAACATAATAAAGG + Intronic
1048693282 8:136992715-136992737 AATGAACCTAAACATAATAAGGG - Intergenic
1048916276 8:139186753-139186775 AATGAGCCACAACACAATAAAGG + Intergenic
1052510352 9:29410341-29410363 TATGAAACACAACATGACAAAGG - Intergenic
1053557768 9:39155625-39155647 TAAAAACCACAAAATGAAAAGGG - Intronic
1053821879 9:41975910-41975932 TAAAAACCACAAAATGAAAAGGG - Intronic
1054139346 9:61463326-61463348 TAAAAACCACAAAATGAAAAGGG + Intergenic
1054608693 9:67211498-67211520 TAAAAACCACAAAATGAAAAGGG + Intergenic
1054854867 9:69888013-69888035 TATGAACCAAAACATGACTGAGG + Intronic
1055361066 9:75490742-75490764 GAACAACCACAACTTGATAAAGG - Intergenic
1056952328 9:91051979-91052001 AATTTACCACAACATAATAAAGG + Intergenic
1057241298 9:93412966-93412988 AATGTACCACAATATAATAAAGG - Intergenic
1059254965 9:112921554-112921576 TATGAATCTCATCATGATACAGG - Intergenic
1060081192 9:120647459-120647481 AATGAATCACAATAAGATAAAGG + Intronic
1186646461 X:11512128-11512150 TATGCACCATGACATGAAAATGG + Intronic
1186934912 X:14438289-14438311 TATGAACCTCAGAATGATAAAGG - Intergenic
1187633308 X:21198874-21198896 AATGAACCTCAACACAATAAAGG + Intergenic
1187727900 X:22222932-22222954 TAAGAACCTCAGCATGATATAGG - Intronic
1187762446 X:22602758-22602780 GATGTACCACAACATAATAAAGG - Intergenic
1189022598 X:37356680-37356702 AATGGATCACAACATTATAAGGG + Intronic
1190532183 X:51390144-51390166 TAAGAACTGGAACATGATAAAGG + Intergenic
1190589620 X:51986381-51986403 AATGTACCTCAACATAATAAGGG + Intergenic
1193254385 X:79329873-79329895 AATGTACCTCAACATAATAAAGG - Intergenic
1193591614 X:83394921-83394943 AATGTACCACAACATAATAAAGG - Intergenic
1193889253 X:87023179-87023201 TATGTACCTCAACATAATAAAGG + Intergenic
1194071940 X:89336056-89336078 AATGTATCACAACATAATAAAGG + Intergenic
1194931437 X:99892526-99892548 TAGGCACCTCAACATAATAAAGG + Intergenic
1196640162 X:118050217-118050239 TATGAATGACAACATGAGAAGGG - Intronic
1197105475 X:122708686-122708708 TAAGTACCACAACATAATGAAGG + Intergenic
1197437028 X:126442790-126442812 GATGAACCTCAACACCATAAAGG - Intergenic
1199268521 X:145856013-145856035 TAAGATCCACAACATCTTAAAGG - Intergenic
1200478624 Y:3673417-3673439 GATGAAACAAAAAATGATAAAGG - Intergenic
1200726183 Y:6671785-6671807 AATGTATCACAACATAATAAAGG + Intergenic
1200833243 Y:7707971-7707993 TATGCAATACAAAATGATAAAGG - Intergenic
1201689727 Y:16749889-16749911 GATGAAACAAAAAATGATAAAGG - Intergenic
1201866655 Y:18663045-18663067 TAAGAACAAAAACATGTTAAAGG - Intergenic