ID: 967681442

View in Genome Browser
Species Human (GRCh38)
Location 3:192368742-192368764
Sequence TTGTTGTAGCATGAAAGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 6, 3: 35, 4: 253}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967681442 Original CRISPR TTGTTGTAGCATGAAAGCAG AGG (reversed) Intronic
902539300 1:17141524-17141546 TTCTTGTAGGATGAAAGCAGAGG - Intergenic
903341338 1:22656588-22656610 TTGTTGTGGTGTGAGAGCAGAGG - Intronic
903503244 1:23813855-23813877 TTCCTTTAGCATGATAGCAGTGG + Intronic
903526611 1:23995617-23995639 TTGTTGTGGTATGAGAGTAGGGG + Intergenic
903907912 1:26698322-26698344 TTGTTGTACCATTACATCAGAGG - Intronic
904926721 1:34055222-34055244 TTGTCGTAGAGTGAGAGCAGAGG - Intronic
909584093 1:77270120-77270142 TTGCTGCAGCATGAAAGGAAGGG - Intergenic
910393672 1:86770257-86770279 CTGTTGTAGTCTGAAAGCTGAGG - Intergenic
911805195 1:102198245-102198267 CTCTTGTTGCATGAAAGAAGAGG + Intergenic
912667782 1:111598613-111598635 TTGTTGTGGTGTGAAAGCAGAGG - Intronic
913671826 1:121104443-121104465 TTGTTGTAGTGTGAAAGCACAGG - Intergenic
914023604 1:143891888-143891910 TTGTTGTAGTGTGAAAGCACAGG - Intergenic
914662076 1:149799833-149799855 TTGTTGTAGTGTGAAAGCACAGG - Intronic
916027873 1:160850689-160850711 TTGTTGTGGTGTGAAACCAGAGG - Intronic
916170366 1:161997393-161997415 TTGTAGTAGAGTGAGAGCAGGGG - Intronic
916420954 1:164637384-164637406 TGGGTCTAGCGTGAAAGCAGCGG + Intronic
916480483 1:165210056-165210078 TTGTTGTAGTGTAAGAGCAGAGG + Intronic
916674089 1:167051933-167051955 TTGTTGTTGAATTAATGCAGTGG + Intergenic
916889397 1:169101956-169101978 TTGTTCTAGCAGGACCGCAGAGG - Intergenic
917567462 1:176227706-176227728 TTATTGTAGGATTAAAACAGAGG + Intergenic
917995831 1:180437488-180437510 TTGTAGTGGTATGAGAGCAGAGG + Intronic
918266320 1:182845450-182845472 TTGTTGTGGTATGAGAGAAGAGG - Intronic
919493130 1:198229672-198229694 TGATTGTTGTATGAAAGCAGAGG + Intronic
919639239 1:200033353-200033375 CTGTTGTACCATGAGAGGAGGGG + Intronic
919873375 1:201841901-201841923 CTGTTGTAGTGTGAGAGCAGAGG - Intronic
922891587 1:229066025-229066047 TTGTTGTGGTATGAGAGTAGAGG - Intergenic
1064068238 10:12202372-12202394 TTGTTGTGGTGTGAGAGCAGAGG - Intronic
1064429100 10:15256143-15256165 CTGTTGAAGCAGGACAGCAGGGG - Intronic
1065551424 10:26871790-26871812 TTCATGTACCATCAAAGCAGGGG - Intergenic
1067315867 10:45161429-45161451 TTGTTGTGGTGTGAGAGCAGAGG + Intergenic
1067402195 10:45987254-45987276 CTGTTGTAGTGTGAGAGCAGAGG - Intronic
1067549825 10:47226443-47226465 AAGTTGGAGCATGAGAGCAGAGG + Intergenic
1067870547 10:49956894-49956916 CTGTTGTAGTGTGAGAGCAGAGG - Intronic
1069038605 10:63671347-63671369 TAGATGTGGCATGAAAGCAGGGG + Intergenic
1069411844 10:68162211-68162233 TTATTGTAGGAGGAAAGGAGGGG + Intronic
1072155853 10:92723048-92723070 GAGTTGTTGCATGCAAGCAGAGG - Intergenic
1073160894 10:101393686-101393708 TTATTGTAGTATGAGAGTAGTGG + Intronic
1079044591 11:17089907-17089929 TTGTTGTAGCTTGTATACAGTGG - Exonic
1080053250 11:27878610-27878632 TTGTTGAAGCATGAATGAAAAGG - Intergenic
1080223813 11:29937304-29937326 ATGATGTAGAAAGAAAGCAGGGG - Intergenic
1080893394 11:36428495-36428517 TTGTTGGAGCATGAATGGATGGG + Intronic
1082195569 11:49300437-49300459 TTAGTGAAGCATGAAAGCTGAGG + Intergenic
1082685292 11:56231308-56231330 TTGTTGTGGTATGACAGTAGAGG - Intergenic
1083039979 11:59676329-59676351 TTGTTGTGGTGTGAGAGCAGAGG + Intergenic
1085682984 11:78595521-78595543 TTGCTGTGGCATGAAAGCAGAGG - Intergenic
1086131572 11:83407289-83407311 ATGTTGCAGCCTGAAAGCACAGG - Intergenic
1086583234 11:88423474-88423496 TTGTTATAGCCTGAAAACAGAGG - Intergenic
1086660369 11:89409135-89409157 TTAGTGAAGCATGAAAGCTGAGG - Intronic
1087233805 11:95696264-95696286 TTGTTGTGGTATGAGGGCAGAGG - Intergenic
1091853431 12:3719470-3719492 CTTTTGGAGCATGAAAGGAGGGG - Intronic
1091977568 12:4837636-4837658 TTGTTGTGGTGTGAGAGCAGAGG + Intronic
1092781886 12:11995325-11995347 TGTTTGTTGCGTGAAAGCAGAGG - Intergenic
1092987897 12:13864777-13864799 TTGTTGGAGATTTAAAGCAGTGG + Intronic
1093425968 12:19029449-19029471 TTCTTGTGTTATGAAAGCAGAGG - Intergenic
1094443686 12:30507169-30507191 TTGTTGTGGTGTGAAAGCAAAGG - Intergenic
1094573312 12:31661199-31661221 TTGTGGTATCCTGGAAGCAGGGG + Intronic
1095257692 12:40059411-40059433 TTGTTGTGGTGTGAGAGCAGAGG - Intronic
1097698329 12:62796152-62796174 TTGTTGTGGGATGAGAACAGAGG - Intronic
1097798103 12:63885095-63885117 TTGTTGTAGTGTGAGAGTAGAGG - Intronic
1098131318 12:67353428-67353450 TTGTAGGAGCATAAAAGCAAGGG + Intergenic
1098817164 12:75182168-75182190 TTGTTGAAGCATTCATGCAGAGG - Intronic
1100963828 12:99991233-99991255 TTGTTGTGGTGTGAGAGCAGAGG - Intergenic
1101185128 12:102268528-102268550 TTGTAGTAGCATTAAAACATAGG + Intergenic
1101297962 12:103445300-103445322 TTGTTGTGGTGTGAGAGCAGAGG + Intronic
1102896891 12:116605292-116605314 TTTTTGTAGCCAGAAAGGAGGGG + Intergenic
1104408716 12:128540677-128540699 TTGTTGTGGGGTGAGAGCAGAGG - Intronic
1105531253 13:21222477-21222499 TTATTGTGGAATGAGAGCAGAGG + Intergenic
1107325922 13:39242291-39242313 ATGTTGTAGTATCTAAGCAGGGG + Intergenic
1108276943 13:48820641-48820663 TTGTTGTTCCAGGAGAGCAGGGG - Intergenic
1108830690 13:54474801-54474823 TTGTTGTGGTATGAGAGCAGAGG - Intergenic
1108954983 13:56141951-56141973 TTTTTCTAGGATGAAAACAGTGG - Intergenic
1109331865 13:60940908-60940930 TTGTTGTGGGATGAGAGCAGAGG - Intergenic
1109352671 13:61205072-61205094 TTGTTTTTGCATAAAAGCAAGGG - Intergenic
1113794321 13:113048406-113048428 TTATTATAGCAAGAAAGCACTGG - Intronic
1115443217 14:33460053-33460075 TTGTAGTAGCATCAAAGATGTGG + Intronic
1116619263 14:47177644-47177666 CTGTTGTGGCATGAGGGCAGTGG + Intronic
1117252212 14:53949314-53949336 CTGAGGTATCATGAAAGCAGAGG + Intergenic
1118189527 14:63567907-63567929 TTGTGGGAGAAAGAAAGCAGCGG - Intergenic
1118955013 14:70473002-70473024 TTGTTGCAGTGTGAGAGCAGAGG - Intergenic
1120945073 14:89987206-89987228 CTGTTGTAGTGTGAGAGCAGAGG - Intronic
1121245349 14:92457964-92457986 ATGCGGAAGCATGAAAGCAGGGG - Intronic
1121606397 14:95243482-95243504 TTGTTGAAGAAGGAAAACAGAGG - Intronic
1122804584 14:104250106-104250128 TGGTCAGAGCATGAAAGCAGGGG - Intergenic
1124391527 15:29262980-29263002 TTGTTGTGGTGTGAGAGCAGAGG + Intronic
1124868519 15:33517636-33517658 TTGTTGCTGCAAGAAAGCAGGGG - Intronic
1127787734 15:62371214-62371236 TTGTTGTGGCATGAGAGTAAAGG - Intergenic
1129156886 15:73723644-73723666 TAGTTGTTGCCTGACAGCAGAGG + Intergenic
1129579673 15:76794043-76794065 TTGCTGTGGCATGAGAGCAGAGG + Intronic
1130095483 15:80852652-80852674 ATGTTGGGACATGAAAGCAGAGG - Intronic
1131983919 15:98022498-98022520 TTGTTGTGGTATGGGAGCAGAGG - Intergenic
1132189561 15:99839920-99839942 CTGTTCTAGCATGGAAGCAGCGG + Intergenic
1132366501 15:101261608-101261630 TTGTTATGGTGTGAAAGCAGAGG - Intergenic
1133256415 16:4519217-4519239 TTGTTATGGTGTGAAAGCAGAGG - Intronic
1133924954 16:10184532-10184554 TTGAAGTAGCCTGGAAGCAGGGG + Intergenic
1135678837 16:24439871-24439893 TTGTTGTAGCGTGAGAGTAGAGG + Intergenic
1138827582 16:60339066-60339088 TCGTTGCAGCATGAAACCAAAGG + Intergenic
1139556345 16:67713279-67713301 TTATTGTGGTGTGAAAGCAGAGG - Intronic
1140164861 16:72540612-72540634 CTGTGGTGGTATGAAAGCAGAGG + Intergenic
1140530507 16:75661842-75661864 CTGTTGTGGTATGAGAGCAGAGG - Intronic
1140536680 16:75716137-75716159 TTGTTGTGGTGTGAGAGCAGAGG - Intronic
1142859843 17:2754936-2754958 TTTTTTTAGCATGACATCAGTGG - Intergenic
1145099783 17:20065132-20065154 TTGTTGTGGTGTGAGAGCAGAGG - Intronic
1148192334 17:45688288-45688310 TTGTTGTAGCCTCAAAGGAGTGG + Intergenic
1148329193 17:46803179-46803201 TTATTGCAGGGTGAAAGCAGAGG + Intronic
1151192576 17:72409129-72409151 TTGTTGTGGGGTGAGAGCAGAGG - Intergenic
1151837626 17:76593722-76593744 TTGTTGTTGAGTGAGAGCAGAGG + Intergenic
1152543466 17:80989028-80989050 TTCTTGTAGCATGTAAGCCAGGG - Intergenic
1152922800 17:83074141-83074163 TTCCTGTAGCATGAAACCAAAGG + Intergenic
1153877140 18:9384083-9384105 TTGGTCTAGGATGATAGCAGAGG + Intronic
1155233133 18:23793644-23793666 TTGTTGTGGTATGAGAGTAGAGG - Intronic
1155293644 18:24365819-24365841 TTGCTGTAGTAGGAGAGCAGAGG - Intronic
1155382833 18:25243323-25243345 TTGGTATAGCATGTAAGCTGAGG - Intronic
1155793125 18:29998400-29998422 TTGTTCTAGCATTAAACCAAAGG - Intergenic
1156919054 18:42497059-42497081 TTGTTGTCCCCTGAAAGAAGAGG - Intergenic
1157409713 18:47453652-47453674 TTGTTGTGGTGTGAGAGCAGAGG + Intergenic
1157807300 18:50667738-50667760 TTGTTGTGGTGTGAGAGCAGAGG - Intronic
1158855561 18:61540250-61540272 TGGTTTTAACATGAAAGCTGGGG + Intronic
1159168602 18:64734505-64734527 TTGTTGAAACATAAAAGCAATGG + Intergenic
1161532253 19:4796917-4796939 TTGGTGTTGCATCAAAGGAGTGG + Exonic
1161690092 19:5727273-5727295 TTGTTGTAGGATGAAAATACAGG - Exonic
1162919453 19:13891783-13891805 TTATTGTAGCCTGGACGCAGTGG + Intronic
1164529487 19:29037390-29037412 TTGGTTTAGCTTGAAACCAGAGG + Intergenic
1164699845 19:30277493-30277515 TTGTTTTAAAATGAAAGAAGAGG + Intronic
1165876737 19:39013130-39013152 GTGTTGTAGCAGGAGAGAAGTGG + Intronic
1166025784 19:40083280-40083302 TTGTTTTAAGATGAAAGGAGAGG + Intronic
1167869893 19:52359612-52359634 TTGTGGTGGCGTGAGAGCAGAGG - Intronic
1168302214 19:55411813-55411835 TTATTGTGGCATGAGAGCAGAGG - Intergenic
1168451133 19:56467405-56467427 TTGTTGTGGTGTGACAGCAGAGG - Intronic
927261999 2:21101374-21101396 GTGCTATAGCATGAAAGCAGAGG + Intergenic
927802168 2:26111245-26111267 TTATTGTAGCAACAAAACAGTGG - Intronic
930479550 2:51929001-51929023 TTGTTTTCACATGAAATCAGGGG + Intergenic
930800032 2:55434219-55434241 TTGTTGTGGTGTGAGAGCAGAGG + Intergenic
931065101 2:58577326-58577348 TTCTTATAGCATGAAACCAAAGG + Intergenic
932632201 2:73354704-73354726 TTGTTGTGGTGTGAGAGCAGAGG - Intergenic
933171255 2:79128346-79128368 TTGTTTTCACATGTAAGCAGAGG + Intergenic
934018363 2:87915745-87915767 TTGCTGTAACAAGAAAACAGTGG - Intergenic
934106065 2:88695490-88695512 TTGTTGTGGTGTGAGAGCAGAGG + Intronic
935700058 2:105803919-105803941 TGGCTGTTGCATGAAAGCTGAGG + Intronic
935985209 2:108665974-108665996 TTGTTGTGGTGTGCAAGCAGAGG - Intronic
936137644 2:109909618-109909640 TTGTTGTGGTGTGCAAGCAGAGG - Intergenic
936207053 2:110461867-110461889 TTGTTGTGGTGTGCAAGCAGAGG + Intronic
936392944 2:112092292-112092314 TGGTTGAAGCAGGAAAACAGAGG + Intronic
936956806 2:118030607-118030629 TTGTTGTAGGGTTAAAACAGAGG + Intergenic
937433440 2:121860336-121860358 TTGTTGTGGTATGAAGGCAGAGG + Intergenic
938417202 2:131113451-131113473 TTGTTGTGACGTGAGAGCAGAGG + Intronic
939109502 2:137990758-137990780 TTGTTGTGGTGTGAGAGCAGAGG - Intronic
940467499 2:154050370-154050392 GTGATGTAGCATGAGAGCACAGG - Intronic
943387310 2:187217712-187217734 TGGTTGTAGTGTGAAAGCAGTGG + Intergenic
943471890 2:188304847-188304869 TTGTTGTTGTATGAGAGCAGAGG - Intronic
943886818 2:193228650-193228672 TTGTTGTGGTGTGACAGCAGAGG + Intergenic
944469316 2:200036112-200036134 TTGTTGTAACATTAAAGGAAAGG - Intergenic
944514092 2:200493867-200493889 TTGCTGTAACATCAAATCAGGGG + Intronic
1168794431 20:602148-602170 TTGTTTTACAATGAAAGCACAGG + Intergenic
1169261876 20:4145201-4145223 TTGTTGGGGCATGACAGCAGAGG + Intronic
1169620655 20:7503245-7503267 TTGTGGTGGCTTGAAAGGAGAGG - Intergenic
1169963247 20:11186789-11186811 TTGTTATGGTATGAAATCAGAGG - Intergenic
1170200022 20:13732307-13732329 TAGTTGTAGTGTGACAGCAGAGG + Intronic
1172354809 20:34272270-34272292 TTGTGGTGGTGTGAAAGCAGAGG - Intergenic
1172791346 20:37507568-37507590 TTGCTGAAGCATGAAATGAGAGG - Intronic
1172896282 20:38302598-38302620 TTGCTTCAGAATGAAAGCAGTGG - Intronic
1173915540 20:46705798-46705820 TTGTGTAAGGATGAAAGCAGAGG + Intergenic
1174307698 20:49626173-49626195 TTGCTGTAGTGTGAGAGCAGAGG - Intergenic
1175012508 20:55754077-55754099 TTGTTGCAGTGTGAGAGCAGAGG - Intergenic
1175299457 20:57932649-57932671 TTGTTGTGGTGTGAGAGCAGAGG - Intergenic
1178373981 21:32051184-32051206 TTGTTGTGGAGTGAGAGCAGAGG + Intergenic
1178529433 21:33362914-33362936 TTGTTGTGGCATGAGAGCAGAGG + Intergenic
1179500352 21:41804809-41804831 TTGTGGGAGCATGAAATAAGGGG - Intronic
1180153810 21:45967321-45967343 TTGTTGTGGTGTGAGAGCAGAGG + Intergenic
1184592750 22:45496116-45496138 TTGTTGGTGCATGAATGGAGAGG - Intergenic
949312288 3:2713321-2713343 TTGCTGTGGTGTGAAAGCAGAGG + Intronic
949759431 3:7453159-7453181 CTGTTGTGGTATGAGAGCAGAGG - Intronic
950140300 3:10610741-10610763 TCTTTATAGCATGAAAGCAGAGG - Intronic
950930541 3:16784677-16784699 TTGTTGCAGTGTGAGAGCAGAGG - Intergenic
951499475 3:23367958-23367980 TTGTTGTGGTGTGAGAGCAGAGG + Intronic
953222085 3:40980691-40980713 TTGTTGTGGTGTGAGAGCAGAGG + Intergenic
956618543 3:71197853-71197875 TTATTTTTGCATGAAAGCAGTGG + Intronic
960024915 3:112998116-112998138 TTGTTGTGGTATGAGAGCAGAGG - Intronic
962396604 3:135020057-135020079 TTGTTGTACCAAGTTAGCAGAGG - Intronic
962406485 3:135104912-135104934 TTGTCTTAGCAGAAAAGCAGTGG + Intronic
962879214 3:139560333-139560355 TTGCTATAGCATAAAAGCCGGGG - Exonic
962881512 3:139581523-139581545 TTGTTGTAGCATGTATCCATAGG - Intronic
965082545 3:164053538-164053560 TTGTTGTGGTGTGAGAGCAGAGG - Intergenic
965422510 3:168479412-168479434 TTGTTTTAGCTTGAAAGCTTTGG - Intergenic
965484652 3:169263764-169263786 TTGTTTTAGCATGAAGGAACTGG + Intronic
965667896 3:171115560-171115582 GTGTTGTAGCAGGAAGGCTGGGG + Intronic
966365717 3:179185368-179185390 TTATTGTAGTGTGAGAGCAGAGG - Intronic
967195519 3:187022297-187022319 TTGTTGTGGTGTGAGAGCAGAGG + Intronic
967226801 3:187299651-187299673 TTGGTGGAACAAGAAAGCAGAGG + Intergenic
967681442 3:192368742-192368764 TTGTTGTAGCATGAAAGCAGAGG - Intronic
970300023 4:14671341-14671363 TTGATTTAGCAAGAAAACAGTGG - Intergenic
971678424 4:29666324-29666346 TTGTTGAAGTATAAGAGCAGGGG - Intergenic
971879850 4:32357449-32357471 TTGTCGAAGAATGAATGCAGAGG - Intergenic
972030517 4:34451325-34451347 TTGTTGTGGTAGAAAAGCAGGGG + Intergenic
974389672 4:61249928-61249950 TTACTGTAACATTAAAGCAGCGG + Intronic
975755269 4:77565618-77565640 TGGTTGCTGCAGGAAAGCAGAGG - Intronic
977103318 4:92846466-92846488 TTGTAGCAACATGAATGCAGTGG - Intronic
977528086 4:98168036-98168058 TTGTTGTAGTGTGAAAGCAGAGG + Intergenic
978715389 4:111836729-111836751 TTACTGTAACAGGAAAGCAGTGG - Intergenic
979657217 4:123209389-123209411 TTGCTGTGGTATGAGAGCAGAGG + Intronic
980765716 4:137301360-137301382 TTGTTGTGACATGAGAGTAGAGG - Intergenic
980864184 4:138535489-138535511 TTGTTGTGGTGTGAAAGCAGAGG - Intergenic
981483752 4:145263435-145263457 TTGTTGTGGCATGAGATCACAGG - Intergenic
981505199 4:145492118-145492140 CTGTTGTAGTGTGAGAGCAGAGG - Intronic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
982271649 4:153595901-153595923 TTGCTCTAGCATTCAAGCAGAGG + Intronic
983709068 4:170692627-170692649 TTGTTGTGGCATGGGAGCAGAGG - Intergenic
984977441 4:185242184-185242206 TTGTTGTGGTATGAAAGTAGAGG - Intronic
984983185 4:185302536-185302558 TTGTTGTGGTGTGAAAGCAAAGG + Intronic
985691388 5:1314638-1314660 TGCTTGAAGCATGAAAGCTGTGG + Intergenic
986590986 5:9370115-9370137 TTGTTTAAAGATGAAAGCAGAGG - Intronic
987836496 5:23169639-23169661 TTGTTGTGGTGTGATAGCAGAGG - Intergenic
989425761 5:41293665-41293687 TTGTTGTTGAAGGTAAGCAGAGG - Intergenic
989624466 5:43415986-43416008 TTTTTGTGGTATGAGAGCAGAGG + Intergenic
990232458 5:53728089-53728111 TTGTTGTGGTGTGAGAGCAGAGG + Intergenic
993545278 5:89203914-89203936 TTGTTGTGGGGTGAGAGCAGAGG + Intergenic
994045957 5:95309665-95309687 TTGTTGTGGTAGGAGAGCAGAGG + Intergenic
999962110 5:156766964-156766986 TTGTTGAACCAGGAAAGCACTGG - Intronic
1000447136 5:161336015-161336037 TTTTTGTAGCAATAAAGCTGAGG - Intronic
1001147528 5:169197774-169197796 TTGTTGCATCAGGAAAGCTGAGG - Intronic
1001217169 5:169866787-169866809 TTGTTGTGGTGTGAGAGCAGAGG - Intronic
1001612723 5:173016373-173016395 TTATTGTGGTGTGAAAGCAGAGG + Intronic
1002295036 5:178225708-178225730 TTGTTGTAGTGTGAAAGCAGAGG - Intronic
1003022725 6:2525461-2525483 TTGCAGTATCATGGAAGCAGTGG + Intergenic
1003322991 6:5069014-5069036 TTGTTGTAGCATGTCTGAAGAGG - Intergenic
1003391403 6:5716444-5716466 TTGTTGTGGAATGAGAGCAGAGG - Intronic
1003688655 6:8329766-8329788 GTGTTCTAGCATGCATGCAGGGG - Intergenic
1004324358 6:14660942-14660964 TTGGTGTAGAAAGAATGCAGTGG - Intergenic
1004687203 6:17957768-17957790 TTGTTGTGGTGTGAGAGCAGAGG + Intronic
1004996961 6:21202967-21202989 GTGTTGTAGCATGAGGCCAGTGG + Intronic
1005479141 6:26239109-26239131 CTTTAGTGGCATGAAAGCAGTGG + Intergenic
1005651123 6:27885990-27886012 TTGTAATAACATGAAAGTAGAGG - Intergenic
1005879548 6:30045395-30045417 TTGTTGTGGTATGAGAGCAGAGG - Intergenic
1007368041 6:41408234-41408256 TGGTGGTTGCATGAAAGCAAGGG + Intergenic
1007938009 6:45750989-45751011 ATGGTGTAGTGTGAAAGCAGAGG + Intergenic
1010120725 6:72372941-72372963 TTGTCTTATTATGAAAGCAGTGG - Intronic
1010384098 6:75258978-75259000 TTGTTGTACCTTAAAAGGAGTGG + Exonic
1011239725 6:85258190-85258212 TTGTTGTGGTGTGAGAGCAGAGG - Intergenic
1013880180 6:114889085-114889107 TTGTTGTTCCATGAAGTCAGGGG + Intergenic
1016475955 6:144428205-144428227 TAGTAGTAGCATGGAAGCAGGGG + Intronic
1016556081 6:145340386-145340408 TTTATGTTGCATGACAGCAGAGG - Intergenic
1019224278 6:170497298-170497320 ATGTTGAGGCAGGAAAGCAGGGG + Intergenic
1020862394 7:13511093-13511115 TAGTTTTAGAATGAGAGCAGAGG - Intergenic
1021084583 7:16407515-16407537 CTGTTTTAGCATGAAAGTATAGG - Intronic
1022022324 7:26412778-26412800 TTGCTGTAGCATCCAAGAAGTGG + Intergenic
1022556222 7:31300174-31300196 TTGTTGTAAGATAAAAACAGAGG - Intergenic
1023069711 7:36417484-36417506 TTGTGGTGGTATGAAAACAGAGG - Intronic
1024368005 7:48545018-48545040 TTGTTGTGGTGTGAGAGCAGAGG + Intronic
1024532697 7:50406623-50406645 TTGGAGTAGCAGGAAACCAGGGG - Intergenic
1024678007 7:51655196-51655218 ATGTTGTAGCATGAAAGGTTGGG - Intergenic
1024714971 7:52068776-52068798 TTATTGTAGCATGCAAGGACAGG + Intergenic
1025239811 7:57261828-57261850 TTGTTGGAGAAGGAAAGGAGGGG - Intergenic
1025270470 7:57508142-57508164 TTGTTGTGGTAGAAAAGCAGGGG - Intergenic
1025887531 7:65611677-65611699 TTGCTGCAGCATGAAAGAAGTGG + Intergenic
1025948022 7:66119686-66119708 TTGTTGTCGAGTGAGAGCAGAGG + Intronic
1026443442 7:70463432-70463454 TTGTTGCAGCGTGCAAGAAGTGG + Intronic
1030764167 7:113388535-113388557 TGTTTATAGCATGAAGGCAGGGG - Intergenic
1031240151 7:119227635-119227657 CTATTGTAGTAGGAAAGCAGAGG - Intergenic
1031854882 7:126910233-126910255 TTGCTGCAGTATGAAAGAAGTGG - Intronic
1034139035 7:148799463-148799485 TTGCTGTAGCATGAAGGAGGAGG + Intronic
1034561180 7:151880163-151880185 TTGTCGTAGCGTGAGAGCAGAGG + Intergenic
1034743733 7:153503378-153503400 TTGGTGAAGCAAGAAGGCAGAGG + Intergenic
1038412219 8:27367590-27367612 TTGTTGTAGCAGAATATCAGAGG + Intronic
1038737058 8:30179758-30179780 TTGTTGTAGAATTAAAGGGGGGG + Intronic
1039011858 8:33102364-33102386 TTGTTTTAGGATGAAATGAGAGG + Intergenic
1040747382 8:50661949-50661971 TTCATGTAGCATGAGAACAGAGG + Intronic
1041767150 8:61430871-61430893 TTCTTCTAGCAAGAAATCAGTGG + Intronic
1042533777 8:69839310-69839332 TTGTTGCGGTATGAGAGCAGAGG - Intergenic
1042975451 8:74464321-74464343 AAGTTGTAGCATTATAGCAGAGG + Intronic
1043558987 8:81468725-81468747 TTGTTGTAGTATGAGAGCAGAGG - Intergenic
1043913131 8:85887667-85887689 TTGTGATAACATGAAGGCAGAGG + Intergenic
1044645648 8:94440631-94440653 TTGTTGTGGTGTGAGAGCAGAGG - Intronic
1044943034 8:97362655-97362677 TTGATTTAGCATCAAAGAAGAGG - Intergenic
1044995253 8:97831989-97832011 TTGTTGTGGTATGAGAGCAGAGG + Intronic
1045497735 8:102722382-102722404 ATGGTGTAGCATGAGAGCAGGGG - Intergenic
1047882974 8:129216947-129216969 TGGTTGTATCAGGCAAGCAGAGG + Intergenic
1048038409 8:130700294-130700316 TTGTTTAAGCATAAAAGCAGGGG + Intergenic
1048372463 8:133791406-133791428 ATGTTGTAGAATGAAATGAGAGG + Intergenic
1050796786 9:9556326-9556348 TTGCTGTCTCAGGAAAGCAGAGG + Intronic
1051974334 9:22930828-22930850 TTGGGATAGCATGAAAGCAGTGG - Intergenic
1055250114 9:74293709-74293731 TTGTTGTGGTGTGAGAGCAGAGG - Intergenic
1056002726 9:82234029-82234051 TTTTTGAAGCATCAAGGCAGAGG + Intergenic
1056342240 9:85648042-85648064 ATGTTGTAGCAGGATAGCACAGG + Intronic
1056494187 9:87139939-87139961 ATGGTGTCGCATCAAAGCAGTGG + Intergenic
1057711419 9:97449178-97449200 TTGTTGTGGTGTGACAGCAGAGG - Intronic
1059243995 9:112834097-112834119 CTGTTGTTGCCTGAGAGCAGAGG - Intronic
1185936407 X:4261959-4261981 TTGTTGTGGTGTGAGAGCAGAGG - Intergenic
1186255134 X:7709710-7709732 TTGTTGCAGTTTGAGAGCAGAGG + Intergenic
1186487140 X:9942238-9942260 TTGCTGTGGCGTGAGAGCAGAGG - Intronic
1194503622 X:94707200-94707222 ATGTTGTAGGAGGAATGCAGTGG - Intergenic
1194871666 X:99140429-99140451 TTGTTGTGATATGAGAGCAGAGG - Intergenic
1196673537 X:118394745-118394767 TTGTTATAGCCTTAGAGCAGGGG + Intronic
1196783620 X:119403772-119403794 TTGTTGTGGTGTGAGAGCAGAGG - Intronic
1198952536 X:142087910-142087932 ATGTCAGAGCATGAAAGCAGAGG + Intergenic
1199126170 X:144123393-144123415 TTGCTGTAACAAGAAAACAGTGG + Intergenic
1201612356 Y:15857586-15857608 TTGTTGTCGTATGAAAGTAGAGG - Intergenic