ID: 967682218

View in Genome Browser
Species Human (GRCh38)
Location 3:192377464-192377486
Sequence CAGATTCACCTATTTTAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967682218 Original CRISPR CAGATTCACCTATTTTAAGT GGG Intronic
902645698 1:17796476-17796498 CAGTTTCACCTCTGGTAAGTGGG - Intronic
905724755 1:40241713-40241735 CTGATGCAACCATTTTAAGTAGG + Intergenic
907782055 1:57576025-57576047 TAAATTGAACTATTTTAAGTTGG - Intronic
909299305 1:73991225-73991247 CAGATAAACCCATTGTAAGTTGG - Intergenic
909378655 1:74971027-74971049 CTGATTCACATATTTTTAATGGG + Intergenic
909909121 1:81239101-81239123 CAAATCTACATATTTTAAGTGGG + Intergenic
912309369 1:108604435-108604457 CAGAATCCTCTATTTTTAGTTGG - Intronic
913636857 1:120770769-120770791 CAGAATTACCTGTTTTAAGTTGG + Intergenic
914281856 1:146182243-146182265 CAGAATTACCTGTTTTAAGTTGG - Intronic
914623736 1:149438062-149438084 CAGAATTACCTGTTTTAAGTTGG + Intergenic
914981102 1:152415086-152415108 CAGTTTCATCTCTTTAAAGTTGG + Intergenic
916994923 1:170286147-170286169 AAGTTTCACCTTTTTTTAGTGGG + Intergenic
1064892589 10:20194962-20194984 CACATTATCATATTTTAAGTGGG + Intronic
1065537071 10:26725570-26725592 GAGAATAGCCTATTTTAAGTGGG + Intronic
1068326865 10:55501637-55501659 CTGATTCACCTAATCTAACTTGG - Intronic
1068650911 10:59521747-59521769 TTGTTTAACCTATTTTAAGTTGG - Intergenic
1068846656 10:61683875-61683897 AAGATTCAACTATTTTCAGAAGG + Intronic
1068867167 10:61906477-61906499 CATATCCACCCATTTTAAGAGGG - Intronic
1068872933 10:61964493-61964515 CAGATGAAACTATTTTTAGTTGG - Intronic
1069099148 10:64296446-64296468 CAGATTCACCAATGTTTGGTAGG - Intergenic
1069130390 10:64694139-64694161 AAGATTCACCCAGTTTAATTTGG - Intergenic
1072591188 10:96830304-96830326 CTGCTTCACTTATTTTGAGTTGG - Intergenic
1073626510 10:105103167-105103189 AACATTCGCCTATTTTAAGGGGG - Intronic
1074256689 10:111810030-111810052 CAGCATTTCCTATTTTAAGTAGG + Intergenic
1079928500 11:26526800-26526822 CAGGTTAACATATTTTAATTTGG + Intronic
1081705403 11:45180071-45180093 CAGATTCAAGTGTTTCAAGTTGG - Intronic
1082734690 11:56843176-56843198 AATATTCATCTAGTTTAAGTTGG - Intergenic
1082856760 11:57815227-57815249 CAGATTCAAGTTCTTTAAGTCGG + Intronic
1086185442 11:84009186-84009208 CTGATTCAGGAATTTTAAGTTGG + Intronic
1088823823 11:113477149-113477171 CAGTTTCTCCATTTTTAAGTGGG + Intergenic
1094778967 12:33767453-33767475 CACATCCACTTATTTTGAGTTGG - Intergenic
1097622804 12:61961874-61961896 TAGATCTGCCTATTTTAAGTAGG - Intronic
1098107682 12:67087179-67087201 CACATGCACAAATTTTAAGTAGG + Intergenic
1100999486 12:100343577-100343599 CAATTTCACCTATTTTTAATGGG - Intergenic
1108823492 13:54382331-54382353 CAGAGTCACATATTTTATTTAGG - Intergenic
1109623796 13:64947102-64947124 CATATTCCCTTATTTTAAATAGG + Intergenic
1110051828 13:70911763-70911785 GAAATTCACCTATTTGAACTGGG - Intergenic
1112433112 13:99370321-99370343 CAGATTCACCAATTGTTATTTGG - Intronic
1112867333 13:103921330-103921352 CAAATTGAACTATCTTAAGTTGG - Intergenic
1112912484 13:104505126-104505148 CAGGTTCCCCTATTTAAAATTGG - Intergenic
1115327144 14:32152808-32152830 CAGATTGACCTATTTGGAGTTGG + Intronic
1116787310 14:49301836-49301858 CAGATTCTTCTATATTAAGCAGG + Intergenic
1118993075 14:70813225-70813247 CAGTTTCCTCAATTTTAAGTAGG + Intergenic
1127426219 15:58860969-58860991 CAGATTCACACATTACAAGTAGG + Exonic
1132370185 15:101291414-101291436 TAGTTTCACCTATTTTAACATGG - Intronic
1134259162 16:12637041-12637063 CACCTTCACCTAATTAAAGTGGG + Intergenic
1140797125 16:78449032-78449054 GAAATTCACCTATGTCAAGTAGG + Intronic
1143307246 17:5957181-5957203 CAGATTCTCCTCTATGAAGTGGG + Intronic
1147271698 17:39277001-39277023 CAGATTCACTAATTTTGTGTAGG + Intronic
1149353105 17:55811891-55811913 CAGATTGTCCCATTTTAACTTGG - Intronic
1151011987 17:70510160-70510182 AAAATTCACATATTTTAAGTGGG - Intergenic
1159322417 18:66869653-66869675 CATAGTCACATATTTAAAGTAGG - Intergenic
1165977019 19:39685065-39685087 CAGATTTTTCTATTTTATGTGGG + Intergenic
926161667 2:10494289-10494311 CAGCTCCACCAATTCTAAGTTGG - Intergenic
928215164 2:29355269-29355291 CTGATTCTCCTATTTTCAGCTGG + Intronic
929042113 2:37754814-37754836 TAGATACACAAATTTTAAGTTGG + Intergenic
929482444 2:42323452-42323474 CAGATTCATATAATTTAAATTGG + Intronic
930094481 2:47556531-47556553 CAGGGTCACCAATTTAAAGTTGG + Intronic
932737472 2:74264364-74264386 CAGTTTCACCTGTTATTAGTGGG + Intronic
933301030 2:80541178-80541200 CAGGCTTACATATTTTAAGTTGG - Intronic
934970757 2:98762245-98762267 CAGATTCCCAGATTTTAATTTGG + Intergenic
935358835 2:102230461-102230483 CAGACTCAGCTTTTTAAAGTGGG - Intronic
935457772 2:103290028-103290050 CAGAAATACCTCTTTTAAGTAGG - Intergenic
939298413 2:140300919-140300941 GAGATTCACCTTTTTTAGGTAGG + Intronic
939407490 2:141777365-141777387 CAGATTCACCTTTTATAAATTGG - Intronic
939656386 2:144831286-144831308 CAGCTTAAACTAGTTTAAGTTGG - Intergenic
940397419 2:153206358-153206380 CACAATCACATATTTAAAGTGGG + Intergenic
944948625 2:204720418-204720440 TAGATTCCAATATTTTAAGTTGG - Intronic
1168883817 20:1229279-1229301 GAGACTCAGATATTTTAAGTAGG - Intronic
1173765575 20:45606365-45606387 TATAACCACCTATTTTAAGTTGG + Intergenic
1177649240 21:23939312-23939334 CAGTTTCACCTACATTCAGTAGG + Intergenic
1183612578 22:38920359-38920381 CAGATGCACCTCATTTAATTGGG - Intergenic
1183824555 22:40375072-40375094 TACATTCACCTCTTTTCAGTAGG + Intronic
949814041 3:8039698-8039720 CAGGTGTACCTATTTTAGGTAGG + Intergenic
952518416 3:34129360-34129382 AAGATTCTCCAATTTTAAGGAGG + Intergenic
956041531 3:65150093-65150115 AAGATTAACCTATTTTAATATGG - Intergenic
956063276 3:65370161-65370183 GTGATGCTCCTATTTTAAGTGGG - Intronic
958682462 3:97349335-97349357 CATACTCACATATTTGAAGTTGG - Intronic
961097292 3:124168552-124168574 GAGATTCCCCTAGTTTAACTTGG - Intronic
962060930 3:131926632-131926654 GATGTTCAGCTATTTTAAGTGGG + Intronic
962288523 3:134108836-134108858 TAAATTCACCTATTTTAAAAAGG + Intronic
962878076 3:139551290-139551312 CAGATACAATTATTTTAAGATGG - Intergenic
962959403 3:140296555-140296577 CACTTTCTCCTATTTTAATTGGG + Intronic
964786718 3:160403592-160403614 CAGAATCATCTATTTTAATTTGG + Intronic
964854055 3:161126757-161126779 TAGAATCACCTATTTTTAGCTGG - Intronic
966622515 3:181981111-181981133 TAAATTCACCTATTTTAAACTGG + Intergenic
967682218 3:192377464-192377486 CAGATTCACCTATTTTAAGTGGG + Intronic
972122530 4:35723246-35723268 CAGATGCATCTATTAAAAGTTGG - Intergenic
972959219 4:44431502-44431524 CAAATTCACATATTTTGACTGGG - Intronic
974619726 4:64340186-64340208 GAGATTCACCCCTTATAAGTAGG + Intronic
976012815 4:80512171-80512193 CAATTTCACTTATTTTAGGTTGG + Intronic
978173046 4:105697025-105697047 CAGATTCATTTCTTTTAAATGGG - Intronic
980352177 4:131697937-131697959 CAGATTCACCTCTTCTCTGTAGG + Intergenic
982632987 4:157856211-157856233 CAGATGGACATATTTTAAATGGG - Intergenic
984352662 4:178615055-178615077 GAGATTATCCTAGTTTAAGTGGG + Intergenic
986476776 5:8142586-8142608 CAGATTCACCTCTGGTAACTTGG - Intergenic
987466548 5:18278527-18278549 AAGATTCACTTAGTTTCAGTGGG + Intergenic
989419179 5:41216034-41216056 CAGATTGAACTATTTCAATTGGG + Intronic
990122546 5:52472837-52472859 CACATTCAACCATTTTAGGTAGG - Intergenic
990210244 5:53475535-53475557 CAGTTTCCCCTACTTTATGTTGG - Intergenic
990607427 5:57424257-57424279 CAGATTCACCTACTCCAAGATGG + Intergenic
991284076 5:64950654-64950676 AAAGTTCACCAATTTTAAGTAGG + Intronic
992420687 5:76601618-76601640 AAGATTCACTCATTTTAACTGGG - Intronic
993014014 5:82515271-82515293 CAAATTCAGCTATTTTATCTGGG + Intergenic
994762329 5:103870815-103870837 CAGATTGATCTATTTTATTTTGG - Intergenic
996382902 5:122880129-122880151 CTGCTTCACATATTTTAATTTGG - Intronic
1000454354 5:161430816-161430838 CCCATTCACCTAATGTAAGTAGG + Intronic
1008898224 6:56581825-56581847 CAGATTCAGCTTTTTTGAGTTGG - Intronic
1012155411 6:95813410-95813432 CAGATTCAGCCATTGTCAGTGGG + Intergenic
1012326249 6:97921811-97921833 CAAATTGTCCTATTTTAAATGGG - Intergenic
1016676572 6:146777228-146777250 CAGATTCAACTCTTATCAGTTGG + Intronic
1020991628 7:15204054-15204076 CAGAGTCACATATTTTTAGAAGG - Intronic
1021981649 7:26061285-26061307 TAAAACCACCTATTTTAAGTAGG + Intergenic
1024461112 7:49660501-49660523 TAAATTCACCTATTTAATGTTGG - Intergenic
1026623490 7:71972074-71972096 CGTATTCACCTCTTTTTAGTTGG - Intronic
1030993358 7:116328350-116328372 CATATTAAGCTATTTTCAGTAGG + Intronic
1033761680 7:144442621-144442643 CAGATACACCTTTTTTAAGTGGG - Intergenic
1033982325 7:147180484-147180506 TTGTTTCTCCTATTTTAAGTTGG - Intronic
1037713415 8:21374801-21374823 CAGTTCCACATCTTTTAAGTGGG + Intergenic
1039575595 8:38621449-38621471 AAAATTCACCTATTTTAATTGGG - Intergenic
1043125015 8:76382047-76382069 CAGAATCACCTGTTTTGAATTGG + Intergenic
1043776558 8:84277664-84277686 TAAATACACCTATTTTAAATGGG + Intronic
1044934466 8:97279381-97279403 CAGATGGCCCTATTTTAAGCCGG + Intergenic
1046173362 8:110542899-110542921 CAGACTCACCAATATTAAGGGGG - Intergenic
1046269147 8:111870615-111870637 CTGATTTACTTATTTTAAGCTGG - Intergenic
1047799667 8:128295516-128295538 CAGATTCAATTGTTTGAAGTGGG + Intergenic
1048642786 8:136383045-136383067 TAGATCCACCTAATTTCAGTGGG + Intergenic
1050159198 9:2699401-2699423 CAGTTTTTCCTATTTTATGTTGG - Intergenic
1051319944 9:15892101-15892123 CTGATTCACATTTTTCAAGTTGG - Intronic
1055037790 9:71836874-71836896 TAGATTCTCCTATTTGGAGTTGG - Intergenic
1058789260 9:108424879-108424901 CAGAGTGATCTTTTTTAAGTAGG + Intergenic
1059870970 9:118575827-118575849 CAGAACCTCTTATTTTAAGTAGG + Intergenic
1059890171 9:118793082-118793104 AAAATTCCCCTATTTTGAGTTGG - Intergenic
1060675560 9:125511358-125511380 CAGTTTCTCCTCTCTTAAGTGGG - Intronic
1062692441 9:137849592-137849614 CAGAGTCCTCTTTTTTAAGTTGG - Intronic
1186165011 X:6818420-6818442 CAAATTCATTTACTTTAAGTTGG - Intergenic
1186364763 X:8879868-8879890 GAGATGGACCTATTTAAAGTGGG + Intergenic
1188093509 X:25992573-25992595 CTGATAAACCCATTTTAAGTTGG + Intergenic
1191805361 X:65130123-65130145 CAGAGTCCTCTTTTTTAAGTTGG + Intergenic
1192173579 X:68872124-68872146 CAGATTCCCCTCTTTCAAGGAGG - Intergenic
1194439499 X:93913968-93913990 CACACTCACATATTTTAATTTGG + Intergenic
1195220423 X:102741054-102741076 CAGATTCACCAATGGTAACTCGG - Intronic
1195721006 X:107868091-107868113 AAAATTCACCCATTTTAAGTGGG - Intronic
1196085226 X:111677197-111677219 CATTTTCACTTATTTTAAATGGG + Intronic
1196343958 X:114630220-114630242 TAGATCCAACTATTTTATGTTGG - Intronic
1198390435 X:136168654-136168676 CAGATTCATCCATTTTGAGTTGG + Intronic