ID: 967682990

View in Genome Browser
Species Human (GRCh38)
Location 3:192386960-192386982
Sequence TAGGTAAGGAAGCAACAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 203}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967682990 Original CRISPR TAGGTAAGGAAGCAACAGAC AGG (reversed) Intronic
901186365 1:7375905-7375927 TAGGACAGGAAGCAGCGGACTGG + Intronic
901406036 1:9046386-9046408 TAGGCTTGGAAGCAACAGAGTGG + Intronic
902246495 1:15124375-15124397 TAGATAAGGAAGAAAAAGAATGG + Intergenic
903014293 1:20351913-20351935 TAGCTAAGGAAGCAGAAGCCTGG - Intronic
905087207 1:35391352-35391374 AAGGTAAGTAAGCAACAAAGAGG - Intronic
905515053 1:38556539-38556561 AAAGGAAGGAAGCAAGAGACGGG + Intergenic
906724534 1:48034491-48034513 TGGGTAAGGAAGTCACAGAGAGG - Intergenic
907626369 1:56034328-56034350 TTAGAAAGTAAGCAACAGACAGG + Intergenic
910107454 1:83646841-83646863 TAGCTAAGGAGGCAAAAGAAAGG - Intergenic
910433950 1:87186390-87186412 TAGGTAAGGTAGGAACATATTGG - Intergenic
912041637 1:105398044-105398066 ATGGTAGGGAAGCAACAGAGGGG - Intergenic
912412239 1:109487334-109487356 TATGGAAGGAAGCTGCAGACAGG - Intronic
914673393 1:149889021-149889043 ATGTTAAGGAAGCAACTGACTGG - Intronic
914981186 1:152415839-152415861 TAGATCAGCATGCAACAGACAGG + Intergenic
915686484 1:157639493-157639515 TAGGTAAGAAAGGCACAGGCAGG - Intergenic
917051269 1:170926698-170926720 TAGGTAAGAAAGAATCAGAATGG + Intergenic
918336804 1:183523849-183523871 TAGGTAATGAAAAAACAGACTGG - Intronic
919517438 1:198544367-198544389 TAGGCAAGCAAGAATCAGACAGG - Intergenic
919736195 1:200952767-200952789 AAGATAATGAAGCAACAAACAGG - Intergenic
920914177 1:210246260-210246282 TAGCTAAGAAAGCAACAGAGAGG - Intronic
923331171 1:232926227-232926249 TTGGTCAAGAAGCAAAAGACTGG + Intergenic
923554111 1:234987230-234987252 TAGGTAAGGAAGCAACTCAGAGG - Intergenic
923703451 1:236322289-236322311 CAGGCCAGGAAGCAACAGCCTGG + Intergenic
924211383 1:241770688-241770710 AAGGTAAGCAAGACACAGACAGG + Exonic
924503156 1:244655213-244655235 TAGTTAGAGAAGCAGCAGACAGG + Intronic
1063030971 10:2233619-2233641 AAGGTCAGGAACCAACTGACAGG - Intergenic
1064160198 10:12938792-12938814 TAGGGAAGGAGGCACAAGACAGG - Intronic
1065495914 10:26328070-26328092 CAGGCAAGGAAGCAAGAGGCAGG + Intergenic
1067254880 10:44627637-44627659 TAGGAAAAGAAGCAGCAGGCAGG + Intergenic
1068822830 10:61397662-61397684 AAGTTAAGGAAGCAAAAGACAGG + Intergenic
1070348309 10:75566957-75566979 TAGGGAAGGAAGCAAGGGAAGGG - Intronic
1071940988 10:90591745-90591767 TACCTAAGTATGCAACAGACAGG - Intergenic
1071978103 10:90975698-90975720 GAGGTAAGGAAGCAATGGACCGG + Intergenic
1072299148 10:94042104-94042126 TAAATCAGGAAGCCACAGACTGG - Intronic
1073121962 10:101127419-101127441 TAGGTAAGGAAGGGACAGAGAGG + Intronic
1073524635 10:104168569-104168591 GAGGGAAGGAACCAAGAGACAGG + Intronic
1074765869 10:116699597-116699619 TAGGTCAGGATGCCACAGACGGG - Intronic
1078133343 11:8632012-8632034 TAGCTAAGGAAACAAGAGAGAGG + Intronic
1078176027 11:8971374-8971396 TAGGTAACACAGCAACAGAAGGG + Intergenic
1078260362 11:9701129-9701151 TTGGTAAAGGAACAACAGACAGG - Intronic
1080114666 11:28608424-28608446 TAGGGAAAGAAGGAAGAGACAGG - Intergenic
1080893767 11:36432022-36432044 TAGGTAGGGAGGAAACGGACAGG - Intronic
1085350842 11:75797128-75797150 GAGGGAAGGACGCAACAGTCAGG - Intronic
1086171184 11:83837800-83837822 TTGGAAAGGAGGCAACAAACTGG - Intronic
1086497611 11:87420688-87420710 TAGGTAGGGAAGCTACAGAAGGG - Intergenic
1087029793 11:93690945-93690967 AAGGTAAGGAAGAACCAGCCAGG - Intronic
1087730583 11:101774147-101774169 TAAGCAAAGAAGCAACAGAGAGG + Intronic
1088811777 11:113397178-113397200 CAGGAAAGGAAGCAACGGGCTGG - Intronic
1089498059 11:118917787-118917809 TGGGTGAGGAAGTAACGGACTGG - Intronic
1092477986 12:8835420-8835442 CAGGTAAAGAAGCAAAAGGCAGG - Intronic
1093770148 12:23008839-23008861 TAGGAAAGGCAGCAACTGGCTGG + Intergenic
1093989521 12:25574225-25574247 TAGGTAATGGAGGAACAGATGGG - Intronic
1094116432 12:26919538-26919560 TAGGTAAGGAAATAAAAGGCTGG + Intronic
1094199559 12:27781743-27781765 CAGGGAAGGAAGCAAAAGAGAGG - Intronic
1094539348 12:31350264-31350286 TAGTTAGGGAAGGAACAGAACGG - Intergenic
1096700890 12:53381922-53381944 TAGATAAGGAAGTAAGAGAATGG + Intronic
1098006465 12:66002102-66002124 AAAGTAAGGAAGCAAAAGAGAGG + Intergenic
1101391505 12:104304395-104304417 TAGAAAAGGAAGCAACATCCTGG + Exonic
1104181893 12:126389850-126389872 TAGGAACAGAAGCAACAGACAGG - Intergenic
1107709555 13:43138353-43138375 TAGGTAAGAACGCAGAAGACCGG - Intergenic
1108258886 13:48637518-48637540 TAGCTAAAGTAGCAACACACAGG - Intergenic
1111039089 13:82720861-82720883 GAGGTCAGAAAGCAACAGATTGG + Intergenic
1112671473 13:101644111-101644133 CAGGTAAGGGAGCAACAGGGAGG - Intronic
1113317284 13:109195174-109195196 GAGGGAAGGAAGCAAGAGAGAGG - Intronic
1114171642 14:20278766-20278788 GAGGGAAGGAAATAACAGACAGG + Intronic
1115212408 14:30980937-30980959 TAGCTTTGGAAGCAACATACAGG + Intronic
1116623288 14:47233962-47233984 TAGTTCAGGAGGCAACAAACAGG - Intronic
1116870436 14:50064512-50064534 TAGGACAGGAATCCACAGACTGG - Intergenic
1119634267 14:76261365-76261387 TAGATGAGGAAGCCACAGAAAGG + Intergenic
1120139063 14:80907297-80907319 TAGGTAAGGAGGAGACAGAGGGG - Intronic
1121457040 14:94044907-94044929 TAGGTCAGCAAGCTGCAGACAGG + Intronic
1121915280 14:97832636-97832658 CAAGTAAGGAAGCAGCAGATGGG + Intergenic
1122390695 14:101380663-101380685 TAAGACAGGAAGCAAGAGACAGG + Intergenic
1127955460 15:63849027-63849049 GTGGTCAGGAAGCAACAGTCAGG + Intergenic
1129482839 15:75842051-75842073 TAGATTAGGAAGAAAGAGACAGG + Intergenic
1129948542 15:79563353-79563375 TAGGTGAGGAAACAGCAGGCAGG - Intergenic
1130881371 15:88058688-88058710 TAGGGGAGGATGCAACAGATGGG - Intronic
1135460837 16:22641366-22641388 TATGTAAAGAAGAAACAGCCAGG - Intergenic
1136074451 16:27807248-27807270 TAAGAAAGGAAGGAAGAGACTGG - Intronic
1138980057 16:62257310-62257332 TGGGAAAGGAAGAAACAGACAGG - Intergenic
1139630966 16:68231699-68231721 TAAGGAAGGCAGCAACAGGCTGG + Intronic
1140023712 16:71263906-71263928 TAGGGAAGTAAGCAAAAGAATGG - Intergenic
1140158798 16:72462603-72462625 TAGATTAGAAAGCAACAGGCCGG - Intergenic
1140721798 16:77778936-77778958 TAGAAAATGAAGCAACAGGCCGG + Intergenic
1143145311 17:4771613-4771635 CAGGTATGGAACCAACAGAGGGG + Intergenic
1147690844 17:42313498-42313520 TAGGTAGGTAAGCAACCCACGGG + Exonic
1148439648 17:47705147-47705169 AAGGCAAGGCAGCAACAGAAGGG - Intronic
1150467754 17:65408679-65408701 TAGATTGGGAAGCAACACACAGG + Intergenic
1150531561 17:65988921-65988943 AAGGTAAGAAAGCACCAAACAGG + Intronic
1153409431 18:4777287-4777309 AAGGAAAGGAAGCAAGAGAAAGG + Intergenic
1156725640 18:40123025-40123047 TAGGTAAGGAAGAAAAAGCTTGG + Intergenic
1156926184 18:42582923-42582945 AAGGTTAGGAAGGAATAGACTGG + Intergenic
1158784120 18:60688426-60688448 TAGGTAAGGAAGCAATTTAAAGG - Intergenic
1161245772 19:3250981-3251003 TAGGTGAGGAAGGCACAGCCTGG - Exonic
1163872377 19:19832713-19832735 CAGATCAGGAAGCAACAGCCTGG + Intergenic
1167712193 19:51119221-51119243 TAGGAGAGGAAGCAAGAGAGAGG + Intergenic
1168385324 19:55958476-55958498 GAGGTAAGAAAGCTACAGCCAGG + Intronic
929870505 2:45755109-45755131 TGGGTCAGGAAGCAGCAGAGAGG - Intronic
931202634 2:60114197-60114219 GAGGAAAGAAAGAAACAGACAGG + Intergenic
931948877 2:67338822-67338844 TGGGAAAGGAAGCAAGAGAGAGG + Intergenic
932255877 2:70285900-70285922 TAGGTAACGATCCAACTGACAGG + Intronic
933227222 2:79764852-79764874 TAGGTAAAGAGACAACAGAAGGG + Intronic
933448004 2:82406785-82406807 TAGGAAAAGAAGAAACAGAATGG + Intergenic
933463976 2:82626569-82626591 CAGGAAAGGAAGCAAGAGATGGG + Intergenic
934141675 2:89053140-89053162 TAGATAAGGAAGAAAAATACTGG - Intergenic
934227568 2:90147406-90147428 TAGATAAGGAAGAAAAATACTGG + Intergenic
934885127 2:98017800-98017822 TAGTTAAAGAAGCACCAGCCAGG + Intergenic
935480995 2:103589404-103589426 TGGGTATGCAAGCCACAGACAGG - Intergenic
936279925 2:111129770-111129792 TGGGTAAGGAAGAGACAGAAAGG - Intronic
937946170 2:127340254-127340276 TAGGTAACCAAGCCACAGTCAGG + Intronic
937980593 2:127612384-127612406 CAGGGAGGGAAGCAATAGACTGG - Intronic
939583108 2:143974991-143975013 TAGGTAAGAATGAAACAGTCTGG + Intronic
940830495 2:158459450-158459472 TAGTTAAGGACTCAACAGAAAGG + Intronic
941161752 2:162043626-162043648 AAGGTAAGGTAGAAACAGAAAGG - Intronic
948845282 2:240680128-240680150 CAGGTAAGGAGGCCACAGGCTGG - Intronic
948848578 2:240694751-240694773 CAGGTAAGGAGGCCACAGGCTGG + Intronic
1169325679 20:4673623-4673645 GTGGTCAGGAAGCAAAAGACAGG + Intergenic
1171158640 20:22900252-22900274 TAGGTAAGCAAACAACTCACAGG - Intergenic
1172257828 20:33535432-33535454 TAAATAAGGAAGCAACTGAGTGG - Intronic
1175447839 20:59037031-59037053 AGGGTAAGGAAGCAACATCCAGG + Intronic
1177651472 21:23965708-23965730 AAGGTAAGCAAACAACAGGCTGG + Intergenic
1180971602 22:19818986-19819008 TAGGCCAGGAAGCAGCAGACAGG - Intronic
950968942 3:17167486-17167508 TGGGTAAGGAACAAACAGAATGG + Intronic
951519079 3:23594492-23594514 TAGGTGTGGAAGCCACAGAGAGG - Intergenic
953238336 3:41125885-41125907 TTGATAAGGAAGCAAAACACGGG + Intergenic
953577907 3:44128053-44128075 CAGGGAAGGAAGCACCAGGCAGG + Intergenic
953706141 3:45232011-45232033 TCAGTAAGGATGCATCAGACTGG - Intergenic
954808901 3:53235973-53235995 GAGGGACGGCAGCAACAGACAGG + Intronic
955422665 3:58754425-58754447 TACGAGAGGAAGCAAGAGACTGG - Intronic
956186592 3:66568378-66568400 CAGGGAGGGAAGCAACACACTGG - Intergenic
959641247 3:108638755-108638777 TGGTTAAGAAAACAACAGACTGG - Intronic
963580468 3:147120548-147120570 TAAGTAAGTAAGCAACTGAGGGG + Intergenic
967229496 3:187324121-187324143 AAGGTAAGGAAGCAACAATGAGG + Intergenic
967682990 3:192386960-192386982 TAGGTAAGGAAGCAACAGACAGG - Intronic
967725913 3:192862234-192862256 GAGGTAAGGAAACTATAGACTGG + Intronic
968798127 4:2722832-2722854 TAAGTAAGTAAGTAAGAGACAGG + Intronic
969719780 4:8887167-8887189 CAGGCAAAGAAGCAACAGAGAGG - Intergenic
971652150 4:29292165-29292187 TAGGTCATGAAGCCACAGAATGG + Intergenic
978185058 4:105847595-105847617 TAAGTAGGTAAGCCACAGACTGG - Exonic
979322253 4:119337951-119337973 AAGGTTAGGAAGCAAGAGAAGGG + Intergenic
981210649 4:142100255-142100277 AAGGTGGGGAAGCAACAGGCTGG - Intronic
982756791 4:159229488-159229510 TAGGCAATGAAACACCAGACAGG - Intronic
985616251 5:923475-923497 GAGGGGAGGAAGGAACAGACAGG + Intergenic
985921616 5:2981730-2981752 TAGGCAAGAAAGCAACAAAGAGG + Intergenic
990607091 5:57422210-57422232 TCGGTAAGGTAGCCATAGACAGG + Intergenic
991999491 5:72421525-72421547 AAGGTAAGGAAGCAAATGAGTGG - Intergenic
993320671 5:86465057-86465079 CAAGCAAGGAAGCAATAGACAGG - Intergenic
993527015 5:88977507-88977529 TAGGTGAGAAAGGAACAGCCTGG + Intergenic
998574167 5:143295248-143295270 TAGGTATGGCAGAAACAGAGAGG - Intronic
999357046 5:150945449-150945471 TAGCTAAAGAAGTAGCAGACGGG - Intergenic
999923367 5:156347191-156347213 TAGGTGATGAAGCAATAGAATGG + Intronic
1000656467 5:163885184-163885206 AAGCTCAGGAAGAAACAGACTGG + Intergenic
1001670448 5:173469015-173469037 TATGTAAGGAAGCCACATTCAGG + Intergenic
1004482430 6:16033524-16033546 TTGGTAAGGTTGCAACAGGCAGG - Intergenic
1005232382 6:23717279-23717301 TAATAAAGTAAGCAACAGACTGG - Intergenic
1005298536 6:24449391-24449413 TAAGAAAGGAGGCAACAGGCGGG + Intronic
1007388000 6:41532264-41532286 ATGGCAAGGAGGCAACAGACTGG - Intergenic
1007501454 6:42300874-42300896 TAGGTAATGAGGAAGCAGACAGG + Intronic
1009639637 6:66316887-66316909 CAGTGAAGGAAGCAAGAGACGGG - Intergenic
1011629765 6:89312055-89312077 TGGGGAAGGAAGCTACAGAGGGG + Intronic
1012983384 6:105852872-105852894 TAAATAAGGAAGCAACTGAGTGG - Intergenic
1013590938 6:111619226-111619248 TAGTGAAGGAAGCCACAGGCTGG + Intergenic
1014851204 6:126341440-126341462 TAGAAAAGGAAGCAACAGATGGG - Intronic
1017929120 6:158937440-158937462 ACGGAAAGGAAGAAACAGACTGG - Intergenic
1018591732 6:165433060-165433082 TTGGTAAGCAAAGAACAGACTGG + Exonic
1018959084 6:168433978-168434000 TAAGCCAGGAAGCAGCAGACAGG + Intergenic
1019022010 6:168927279-168927301 GAAGTAAAGAAGCATCAGACAGG - Intergenic
1020260361 7:6527358-6527380 TAGCTAAGGAAGCAAAGGAGTGG - Intronic
1020498065 7:8881568-8881590 TAGGTAGTGGAGCAACAAACTGG + Intergenic
1021772177 7:24015768-24015790 CAGCAAAGGAAACAACAGACTGG + Intergenic
1023010652 7:35922205-35922227 GAGGAAAGGTAGAAACAGACAGG + Intergenic
1023245233 7:38196094-38196116 TACGTAAGGAAACAACAGGCTGG - Intronic
1023677673 7:42647517-42647539 TAGGAAAAGAAGAAACAGAGAGG + Intergenic
1023713561 7:43020267-43020289 TAGCCAAGGAAGCTACAGTCAGG - Intergenic
1023779581 7:43643421-43643443 AAGGCAAGGAAGCAACAGACAGG + Intronic
1025055781 7:55763862-55763884 GAGGAAAGGCAGAAACAGACAGG - Intergenic
1025124293 7:56332328-56332350 CAGGAAAGGTAGAAACAGACAGG + Intergenic
1025608829 7:63058968-63058990 GAGGAAAGGCAGAAACAGACAGG - Intergenic
1026277889 7:68896142-68896164 TAGGGAAGGAAGTCACTGACAGG - Intergenic
1027400314 7:77799303-77799325 AAGGGAAGGAAGCAAAGGACAGG - Intronic
1028733213 7:94177249-94177271 CAGGTCAAGAAGCAACAGAAGGG - Intergenic
1031134229 7:117868643-117868665 TAGGTAAGGAATCAGAGGACAGG - Intronic
1033327525 7:140391926-140391948 TTTGCAAGGAAGCAACAGGCAGG - Intronic
1033511241 7:142062168-142062190 TAGGTTAGGAAGAAACACCCAGG - Intronic
1033514357 7:142091513-142091535 TAGGTTAGGAAGAAACACCCAGG - Intronic
1034707712 7:153161157-153161179 GAGAAAAGGAAACAACAGACAGG + Intergenic
1035640744 8:1183155-1183177 TAGGTAAGGACACAGCAGCCAGG + Intergenic
1036417597 8:8564872-8564894 TGGGAAAGGAAGAAAAAGACAGG + Intergenic
1036465766 8:8995549-8995571 AAGGGAAGGAAGCATAAGACAGG - Intergenic
1037552064 8:19984437-19984459 CAGGTAAGGAAGGAGCAGGCTGG + Intergenic
1039239832 8:35544533-35544555 CAGGTAAGGCAGGAACAAACAGG + Intronic
1041809364 8:61890292-61890314 TAGATTAGGAAGCAACAGATTGG - Intergenic
1041816027 8:61972396-61972418 GAGGGAGGGAAGCAAAAGACAGG - Intergenic
1042224852 8:66507485-66507507 TAGCTAGGGAATCAAAAGACCGG - Intronic
1042836908 8:73087290-73087312 GAGGTAAGCAAGGCACAGACAGG - Intronic
1042908499 8:73799661-73799683 TATGTCAGGAAGCACCACACAGG + Intronic
1043664807 8:82795695-82795717 AGGGTAAGGAAGCAACAGATGGG - Intergenic
1045652640 8:104355509-104355531 TAGGTAAAGAAAAAACAGACAGG + Intronic
1047026192 8:120827047-120827069 TAGGAAAGGAAGAAAGAGGCAGG - Intergenic
1047652620 8:126939679-126939701 TAGGTGAGGAAGAAACAGAAGGG + Intergenic
1052256356 9:26461472-26461494 TAGGAAGGGAGGCATCAGACTGG - Intergenic
1052390123 9:27869814-27869836 TGGGTAAAGGAGCAACAGAGAGG + Intergenic
1053296400 9:36917332-36917354 TAAATAAGGAAGCAACTGAGTGG + Intronic
1057239256 9:93393475-93393497 AGGGTAGGCAAGCAACAGACCGG + Intergenic
1058772647 9:108251379-108251401 AAAATAAAGAAGCAACAGACTGG - Intergenic
1059331775 9:113540125-113540147 CAGATAATGAAGCAACAGAGGGG - Intronic
1059972178 9:119679154-119679176 TAGGTAAGTAAGCAGGAGAGTGG - Intergenic
1187025296 X:15429151-15429173 TAGGTTGAGAAGCAAGAGACAGG - Intronic
1187373081 X:18726438-18726460 TAGGGAATGAAGTAACTGACTGG + Intronic
1188209907 X:27409608-27409630 CAAGCAAGTAAGCAACAGACTGG + Intergenic
1188247184 X:27850659-27850681 CAGGTAAGGAAGCAAAGGGCTGG - Intergenic
1190202239 X:48372261-48372283 TACGTTAGGAAGCAAAAGGCAGG - Intergenic
1190208299 X:48423152-48423174 TACGTTAGGAAGCAAAAGGCAGG + Intergenic
1191183287 X:57584448-57584470 TAGGGAGGGAAGCAACATAAAGG + Intergenic
1191214087 X:57917951-57917973 TAGGGAGGGAAGCAACATAAAGG - Intergenic
1192796014 X:74424208-74424230 TAGGTCAGGAAGAAACAGAAAGG + Intronic
1193262727 X:79427849-79427871 TAAGAAAGGAAGCAAGAGACAGG - Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1195082701 X:101386225-101386247 TAGGTCAGGAAGCAAAAAAAGGG - Intronic
1196759902 X:119191667-119191689 TAGGCAAGGAGGGACCAGACAGG + Intergenic
1198206797 X:134473184-134473206 TATGTAAGAAAACAACAGGCCGG - Intronic
1198699347 X:139381080-139381102 CTGGTTAGAAAGCAACAGACTGG - Intergenic
1200078281 X:153562717-153562739 TAGATCAGGAAGAAACAGCCTGG + Intronic
1200217306 X:154373706-154373728 GAGGGAAGGAAGCCGCAGACTGG + Intronic