ID: 967685930

View in Genome Browser
Species Human (GRCh38)
Location 3:192416250-192416272
Sequence ATCAAATGGAAGTTTGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 248}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967685930 Original CRISPR ATCAAATGGAAGTTTGGACA AGG Intronic
900873954 1:5327904-5327926 ATCAAAGGGAAGTTAGGGAAGGG + Intergenic
903467267 1:23560273-23560295 TTCAATTAGAATTTTGGACAAGG + Intergenic
904659928 1:32076754-32076776 ATCAGATGGAAGTTCTGTCAGGG - Exonic
905420196 1:37837342-37837364 ATCAAATGGAATTGTGGGCTGGG - Intronic
906026704 1:42680427-42680449 AGCACCTGGAAGGTTGGACAGGG + Intergenic
908933779 1:69348526-69348548 ATAAAGAGGAAATTTGGACACGG - Intergenic
909086116 1:71171986-71172008 ATCAAATGAGATTTTGGACTTGG - Intergenic
910409748 1:86928328-86928350 ATCAAATGCAAGGTTGAAGAAGG - Intronic
913562992 1:120042028-120042050 ATGAAATGGAAGGTAGGCCAGGG - Intronic
913635131 1:120751562-120751584 ATGAAATGGAAGGTAGGCCAGGG + Intergenic
914283588 1:146201390-146201412 ATGAAATGGAAGGTAGGCCAGGG - Intronic
914396500 1:147274374-147274396 ATCAAGTTGAAGTTGGAACAAGG - Intronic
914403890 1:147350521-147350543 AATAAATGGAGCTTTGGACATGG - Intergenic
914544619 1:148652126-148652148 ATGAAATGGAAGGTAGGCCAGGG - Intronic
914622008 1:149418883-149418905 ATGAAATGGAAGGTAGGCCAGGG + Intergenic
915665356 1:157439514-157439536 ATCAGATGAAACTTTGGACTTGG - Intergenic
916236829 1:162597480-162597502 ATCAAATTGAAACTTGGAAATGG + Intronic
917841869 1:178986777-178986799 ATCAAAGGGAAGTTCTGAGATGG - Intergenic
920028828 1:203023090-203023112 ATCAGATTCCAGTTTGGACAGGG + Exonic
920062724 1:203238937-203238959 ATTAAATGAAAGTCTGTACATGG + Intronic
922451588 1:225742081-225742103 TGCAAATGAAAGTCTGGACACGG + Intergenic
923924976 1:238616039-238616061 AACATAAGGAAGTTTGGGCAGGG + Intergenic
924001274 1:239555330-239555352 ATCACATGGAAGTTTGGTTGTGG + Intronic
1068273402 10:54759459-54759481 ATCAAAAGGAAGTATTGAAATGG - Intronic
1070948499 10:80412334-80412356 ATGAAAGGCAATTTTGGACAGGG - Intronic
1072825330 10:98599821-98599843 TTCAAATGGATGTTTCCACAGGG + Intronic
1078199313 11:9165861-9165883 ACCAATTGGAAGTTTGTAGAGGG - Exonic
1079668989 11:23142552-23142574 ATCAAATGGAAATATTGACCGGG + Intergenic
1081005811 11:37737275-37737297 ATAGAATAGAAGTTTGGAGATGG + Intergenic
1082614666 11:55343976-55343998 ATCAAAGGGAAAGTTGGAAACGG - Exonic
1084920281 11:72464176-72464198 ATCAAATGGCTGATTGGAGAAGG + Intergenic
1085020847 11:73206165-73206187 ACCAGATGGATGTTTGGTCATGG + Intergenic
1086582549 11:88415770-88415792 ACCAAATGGAAGTGGGAACAAGG - Intergenic
1090050644 11:123375628-123375650 ATAAAGAGGAAGTTTGGAGAAGG + Intergenic
1091037606 11:132247621-132247643 ATCAAAAGGAAGTATGGCCAGGG + Intronic
1092652391 12:10648158-10648180 ATCAAATGGAATTTAGGCAATGG + Intronic
1092848742 12:12608213-12608235 TTCCAATGGATGTTTGGAAAGGG + Intergenic
1096204549 12:49709872-49709894 AACCAATAGAAGTATGGACAGGG + Intronic
1096410397 12:51373102-51373124 CTCAGATGGGAGTTTGGACTTGG + Intronic
1099424366 12:82504188-82504210 AAAAAAGGGAAGTTTTGACAGGG - Intergenic
1099448070 12:82775542-82775564 TGCAAATGGAAGTTAGGAGAGGG + Intronic
1102853480 12:116273443-116273465 ATAAAATGGAAATTAGGAAAAGG - Intronic
1103426056 12:120835127-120835149 ATTAAAAGGAAGTTGGAACAGGG - Intronic
1103664632 12:122553212-122553234 ATCAAATGGAAGGAAGGGCAGGG + Intronic
1106682710 13:32024792-32024814 ATCAAATGGAAGTTTACCCTGGG + Intergenic
1107222125 13:37995372-37995394 TTCACATGCAAGTTTGGACAGGG - Intergenic
1108501094 13:51070636-51070658 ATCAAATGGAAGTATAGATTAGG - Intergenic
1108758158 13:53529459-53529481 ATAAAATGGCAGTTTGTACCTGG - Intergenic
1109723082 13:66301880-66301902 ATAAACTGGAAGTTTGAAAAAGG - Intergenic
1111066727 13:83103697-83103719 ACAAAATAGAATTTTGGACATGG + Intergenic
1111579302 13:90201945-90201967 ATCAAATAGCAGTTTGGAAATGG + Intergenic
1112165863 13:96919093-96919115 GCCAACTGGAAGTTTGGACTGGG + Intergenic
1117435863 14:55714718-55714740 ATCAAAGAGAAGAATGGACAGGG - Intergenic
1119807302 14:77490712-77490734 ATCAAAGGGAAGGATGGACGTGG - Intronic
1120232700 14:81857089-81857111 ATCCAACTGAAGTTTGGTCATGG + Intergenic
1121555476 14:94833354-94833376 ATCAAATCCAAGTGTGAACAGGG + Intergenic
1123188056 14:106538938-106538960 AACAAATGGAAACTTAGACAAGG - Intergenic
1123880358 15:24673475-24673497 AATAAAAGGAAATTTGGACAAGG - Intergenic
1124572856 15:30882193-30882215 ATCAGATTCCAGTTTGGACAGGG - Intergenic
1127515696 15:59690922-59690944 ATCAGATGAAACTTTGGAAAGGG - Intergenic
1128622132 15:69160095-69160117 ATTAAATGGAGGTTTAGACGCGG + Intergenic
1131142200 15:89986279-89986301 ATCAATTGGCAGGTTGGGCATGG + Intergenic
1135181311 16:20276869-20276891 AGCAAATGAAAGATTGCACAGGG - Intergenic
1142953637 17:3505121-3505143 AGCTAATGGAAGTGTGGAGATGG - Intronic
1144133880 17:12274119-12274141 ATAAAATGGTAGCTTGGAAAAGG + Intergenic
1144415298 17:15041006-15041028 ATCAGACGGAAGTATGGACTTGG - Intergenic
1145827401 17:27887398-27887420 ATCAAATTGAAATGTGGACCCGG + Intronic
1146190247 17:30759034-30759056 ATCAAAAGGAAATTTTGAAAAGG - Intergenic
1148512371 17:48182690-48182712 ATCAAATGAAAGAATGCACAAGG - Intronic
1148684356 17:49492762-49492784 ATCAAATGGGAATTTTGAAAGGG - Intergenic
1150317085 17:64178148-64178170 ATCAAATGGAAGTAAGGATCAGG - Intronic
1150897525 17:69231009-69231031 ATACAATGGAAATTTGGGCAGGG - Intronic
1150911436 17:69391572-69391594 TTCAAATGGAAGTAAGGAAAAGG - Intergenic
1150920947 17:69481704-69481726 ATGAAGAGGAAATTTGGACATGG - Intronic
1151219095 17:72598777-72598799 ATCAAAGGGAGGTTTGCACAAGG + Intergenic
1153929991 18:9869877-9869899 CTCAAGAGGAAGTTTTGACAGGG + Intergenic
1153936292 18:9927183-9927205 ATTAAGTGGATGTCTGGACAGGG + Intronic
1154956251 18:21258491-21258513 ATCAGAAGGAAGTTTGGCCTAGG - Intronic
1156027949 18:32677750-32677772 ATAAAATGAAAGTGAGGACAGGG - Intronic
1157269306 18:46259058-46259080 ATAAAATGGGAGTTAGGAGATGG - Intronic
1162592705 19:11603184-11603206 AGCAAATGAAAGTTTGGGCAGGG + Intronic
1164190672 19:22914560-22914582 CTCTAATGGAAGTTTGTAAATGG + Intergenic
925438281 2:3860517-3860539 ATCACAGGGAAGTTTGTAAAAGG - Intergenic
925714857 2:6774421-6774443 ATGAAATGAAAGTTTGGGCTGGG + Intergenic
925752688 2:7103960-7103982 AGAAAATGGAAGCTTGGACAGGG - Intergenic
926527892 2:14005628-14005650 ATCGAATGGTAGATTGGAAAAGG + Intergenic
926862438 2:17322962-17322984 CTGAAATGAAAGATTGGACATGG + Intergenic
926870967 2:17416748-17416770 AAGAAAAGGAAATTTGGACATGG - Intergenic
929362300 2:41108039-41108061 GTCTAATAGAAGTTTGGTCAAGG - Intergenic
932152243 2:69383922-69383944 ATAAAATGGAATTTTGGGGATGG - Intronic
932847695 2:75152264-75152286 ATCAAATTGAGGTTTGGGTAGGG - Intronic
934511650 2:94948987-94949009 AACAAATGGAACCTTAGACAAGG - Intergenic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
938490768 2:131759857-131759879 ATCAGATGGACGTCTGGCCATGG - Intronic
938934130 2:136114035-136114057 TTCAAATGGAAGTTTAGAAATGG - Intergenic
939073534 2:137571953-137571975 ATCAGATAGAAGTTTGGGAAAGG + Intronic
939441364 2:142254632-142254654 ATCAAATTCAAGTTTGCAGATGG - Intergenic
939617642 2:144378767-144378789 ATGAGAGGGAAATTTGGACACGG - Intergenic
939725517 2:145716294-145716316 ATCAAATGGAATTATGTACGTGG + Intergenic
940102514 2:150057831-150057853 ATCAAATGCAAGTTTGCCCCTGG + Intergenic
940440593 2:153711511-153711533 ATTAAATGGAAGTTCAGAGAAGG + Intergenic
941552471 2:166934398-166934420 ACCTAAGGGAACTTTGGACATGG + Intronic
942132302 2:172892377-172892399 CTGAAATGGAAGGTTGGCCAGGG - Intronic
943082485 2:183272019-183272041 ATCAAAAGCAAGTTTTAACAAGG - Intergenic
943343893 2:186714579-186714601 ATCAAATGAAAGTTTAGAATTGG + Intronic
943395640 2:187329355-187329377 CTCAAATGAGACTTTGGACATGG + Intergenic
944656051 2:201877614-201877636 ATGAAATGGACGTTTGGAAGAGG - Intronic
945437887 2:209840191-209840213 AGTAAATGGAAGCTTGGACTGGG + Intronic
945507156 2:210656052-210656074 ATTAAATGGAAGTTTGAAAGAGG - Intronic
945875229 2:215271451-215271473 ATATAATGAAAGTTTGGATAAGG + Intergenic
947114422 2:226753483-226753505 ATCAAATGTAAGTTTATTCACGG - Intronic
947883296 2:233540979-233541001 TTCAAATGGAAGATGGCACATGG - Intronic
1169828214 20:9792819-9792841 ATCAAGTGGAAGTTGGCACCTGG + Intronic
1169890121 20:10443653-10443675 ATAAGATGGAGGTTTGGGCAGGG + Intronic
1170884462 20:20328170-20328192 ATCATGTGGAGGTTTGGACTTGG + Intronic
1171762633 20:29221634-29221656 ATCAAAAGAAAGTTTGAACTCGG - Intergenic
1172509871 20:35493168-35493190 ATCAAGTGGAAGTAGGGATATGG + Intronic
1175011897 20:55745938-55745960 ATAAAATGGGAGATTGGATAGGG - Intergenic
1176699038 21:10020758-10020780 ACCAATAGGAAGTTTGGAAATGG + Intergenic
1179669132 21:42933245-42933267 ATCAGAAAGAAGCTTGGACACGG + Intergenic
1181004164 22:20002003-20002025 ATCATGTGGAAGTTTGGCCCTGG - Intronic
1181875783 22:25939627-25939649 AGCACATGGATGTTTGGAGATGG + Intronic
1185378856 22:50497176-50497198 ATTAAGTGGGAGATTGGACAGGG - Intergenic
949403168 3:3686611-3686633 ATCAGATAGAAATTTGGAAAGGG - Intergenic
950878744 3:16304072-16304094 ATCAAAGTTAAGTTTGGACATGG + Exonic
951374703 3:21899290-21899312 ATCAAAAGGCAGTTTGACCAGGG - Intronic
951542466 3:23795264-23795286 ACCAAATGGACATTTGGATATGG - Intergenic
952195721 3:31073691-31073713 ATCAAATGGAAGCTGGGAAAGGG - Intergenic
952221292 3:31326739-31326761 CTCAGATGAAACTTTGGACATGG - Intergenic
953588377 3:44226826-44226848 ATCAAATGTAAGTGTTGGCAAGG + Intergenic
957555335 3:81759455-81759477 AATAAATGGAAAATTGGACAAGG + Intronic
958216254 3:90582588-90582610 ATCAAAAGAAAGTTTAAACAAGG + Intergenic
958497966 3:94869308-94869330 ATAAAATAGAAGTTTGGTGAGGG - Intergenic
959644896 3:108688026-108688048 ATCAAATGTCAGTTCAGACAAGG - Exonic
962179087 3:133186679-133186701 ATCAAAAGGAAATTTGGATTGGG - Intronic
962523151 3:136215313-136215335 ATCAAATTGAAGGCTGGGCATGG - Intergenic
963187315 3:142433285-142433307 ATCAAAAGGCTGTTTGTACATGG + Intronic
963543270 3:146622886-146622908 ATTAAATGAAAGAATGGACATGG + Intergenic
963828468 3:149982106-149982128 ATCAGATTCCAGTTTGGACAGGG - Intronic
965189079 3:165505852-165505874 ATCAGATGAAACTTTGGACTTGG - Intergenic
965911019 3:173775703-173775725 ATTAAATGGAAGAATGGACATGG + Intronic
967685930 3:192416250-192416272 ATCAAATGGAAGTTTGGACAAGG + Intronic
967792761 3:193566614-193566636 ATCTAATGGAAGTGTGACCAGGG - Intronic
968169049 3:196493810-196493832 AGCAAATGGAAGGCTGGGCACGG - Intronic
969992138 4:11275601-11275623 TTGAAATGGAAGTTTGGAAGGGG - Intergenic
970174346 4:13323457-13323479 TTTAAATAGAAGTTTGGAGAAGG - Intergenic
971641602 4:29140263-29140285 ATCAAATGGAGGTCTAGACTTGG + Intergenic
972284105 4:37631697-37631719 ATCAGCTGGAAGGTTGGGCAGGG - Intronic
972727782 4:41760751-41760773 ATCAAATGCAAGCTTGGACCAGG - Intergenic
973141523 4:46774572-46774594 AACAAATGGCACTTTAGACATGG - Intronic
973346456 4:49060763-49060785 TTCAAATGGATGTTTCTACAGGG + Intronic
974077308 4:57179166-57179188 TTCAAATTGGAGGTTGGACATGG - Intergenic
975752411 4:77537681-77537703 CTCAAATGGATGCTGGGACATGG - Intronic
976070714 4:81236542-81236564 ATGATATGGGAGTGTGGACAGGG - Intergenic
976527271 4:86108554-86108576 ATTAAATGAAAGTATGGACCAGG - Intronic
977870446 4:102083931-102083953 AAGAAAAGGAAATTTGGACATGG + Intergenic
979807354 4:124990925-124990947 ATCAATTGGAAGTTTTATCATGG + Intergenic
980289052 4:130821660-130821682 ACCAAATGCAAGTGAGGACATGG - Intergenic
981185303 4:141794843-141794865 ATAAAATGGAAGGTTGGTCTAGG + Intergenic
982934132 4:161449423-161449445 ATCAAATGGTAGTTTGGGTTGGG + Intronic
983276805 4:165627846-165627868 ATCAAATGAATGTGTTGACATGG - Intergenic
983480576 4:168269019-168269041 AGCAAATGAAAGTTAAGACATGG + Intronic
985045193 4:185933638-185933660 AAAAAGGGGAAGTTTGGACATGG - Intronic
985216019 4:187655484-187655506 ATCAACTGGAAGTATGTAGAGGG + Intergenic
986474111 5:8108084-8108106 ATCAATTAGAAGTTAGGACCTGG + Intergenic
987697728 5:21354405-21354427 CTCAGATGAAACTTTGGACATGG - Intergenic
988587935 5:32523919-32523941 ATCAGATTCCAGTTTGGACAGGG + Intergenic
988754509 5:34232289-34232311 CTCAGATGAAACTTTGGACATGG + Intergenic
989295571 5:39821984-39822006 ATCCAATGGAAATATGGATAAGG + Intergenic
989502389 5:42183245-42183267 AGCAAATCAAAGTTTTGACAGGG - Intergenic
990193592 5:53288931-53288953 CTAAAATGGAATTTTGGAGATGG - Intergenic
990876267 5:60489857-60489879 AACAAATGGAGATTTGAACATGG - Intronic
991742717 5:69697983-69698005 CTCAGATGAAACTTTGGACATGG + Intergenic
991754977 5:69857221-69857243 CTCAGATGAAACTTTGGACATGG - Intergenic
991794290 5:70277721-70277743 CTCAGATGAAACTTTGGACATGG + Intergenic
991822106 5:70573296-70573318 CTCAGATGAAACTTTGGACATGG + Intergenic
991834304 5:70732369-70732391 CTCAGATGAAACTTTGGACATGG - Intergenic
991886669 5:71277263-71277285 CTCAGATGAAACTTTGGACATGG + Intergenic
993316855 5:86419083-86419105 ATGAAATGAATATTTGGACATGG - Intergenic
993745997 5:91597756-91597778 AGCAATGGGAAGTTTGGACTAGG - Intergenic
994487984 5:100403075-100403097 ATCAAATCTGATTTTGGACACGG - Intergenic
994612050 5:102055591-102055613 ATCATATGGCATTTTGGAAAAGG + Intergenic
995129561 5:108615640-108615662 AACAAATAGAAGTTTGGAAGAGG - Intergenic
995888502 5:116922782-116922804 ATCACATGTAAATTTGGAAATGG + Intergenic
996038072 5:118780939-118780961 ACAAAATAAAAGTTTGGACATGG + Intergenic
996946666 5:129078725-129078747 ATCATATGGAAGTGTGTGCAAGG + Intergenic
998731193 5:145079440-145079462 ATCAAAAAGAAGTATAGACAAGG - Intergenic
998742751 5:145223611-145223633 ATCTAATGGAAGTCTAAACATGG + Intergenic
1000448717 5:161357824-161357846 AGCAAATGGAAGGTTGGAGTTGG + Intronic
1001679021 5:173542819-173542841 AAGACATGGATGTTTGGACATGG - Intergenic
1004182061 6:13389783-13389805 ATAATATGGTAGTTTGGAAAGGG - Intronic
1005733869 6:28726409-28726431 AACAAATTGAAGTTTAGAGAGGG + Intergenic
1006782470 6:36641337-36641359 AAGAAAAGGAAGTGTGGACATGG + Intergenic
1008458215 6:51736769-51736791 ATAAAATGGGAGATTGGAGAGGG - Intronic
1008557776 6:52691484-52691506 ATGAAATGTAAGTTTGGAGGAGG + Intergenic
1009452925 6:63822512-63822534 CTCAAATGAAAGTTCAGACATGG - Intronic
1010947775 6:81998363-81998385 AACAAAGAGAAGTTTGGACATGG - Intergenic
1011056722 6:83212806-83212828 GTCAAATGGAAGCTTGAAGATGG - Intronic
1011345217 6:86362022-86362044 ATAAAATGGCAGTCTGGGCATGG + Intergenic
1012887539 6:104862186-104862208 ATCAAGTGGAAGTTTCAAAAGGG + Intergenic
1012932397 6:105330594-105330616 AGCAAGTGGAAGTGAGGACAGGG + Intronic
1015459026 6:133467060-133467082 AAGAAAAGGTAGTTTGGACAAGG + Intronic
1015755115 6:136598878-136598900 ATCAAATGGGATTTTAGGCAAGG + Intronic
1016765271 6:147785561-147785583 ATCAAAGGGAAGTCTGGGCTGGG - Intergenic
1018606059 6:165599411-165599433 ATCAGAAGGAAGCTTGGAAAGGG - Intronic
1024141382 7:46466426-46466448 ATCAAATCGATTTTTTGACAGGG + Intergenic
1025525714 7:61807258-61807280 ATCAAAAGAAAGTTTTAACACGG + Intergenic
1025549105 7:62219991-62220013 ATCAAAAGAAAGTTTTAACACGG + Intergenic
1027503194 7:78981293-78981315 ATGAAAGGGAAGTTACGACAAGG - Intronic
1028054345 7:86224474-86224496 AACAAATGGAAGTTTAGACAAGG - Intergenic
1028280116 7:88914189-88914211 ATGAAAAAGAAGTTTGGAAATGG + Intronic
1029041283 7:97577921-97577943 AACATGTGGAAGTTTGGAAATGG + Intergenic
1030151705 7:106412831-106412853 ATGAAATGGGAGATTGGAAATGG - Intergenic
1030388251 7:108892440-108892462 TTAAAATGGAAGTTTGGCCAAGG - Intergenic
1032377651 7:131438712-131438734 ATCAAAAAAAACTTTGGACATGG - Intronic
1033034173 7:137856429-137856451 ATCAAATGCAAGTTTTGCAAGGG + Intergenic
1033246394 7:139719955-139719977 AGCCAGTGGAAGTTTGGAGAGGG - Intronic
1038075078 8:24063718-24063740 ATCTAGTGGAAATTTGGACGTGG + Intergenic
1038958308 8:32490917-32490939 ATAAAATGTAAGATTGGAGATGG - Intronic
1039805870 8:40997534-40997556 ATTAAATAGAAGTCTGGGCATGG - Intergenic
1040565349 8:48561257-48561279 ATGAAATGAAAGTCTGGACATGG - Intergenic
1040883528 8:52234547-52234569 ATCAAATGGTAGTTCTGGCAGGG - Intronic
1042498280 8:69480677-69480699 AACAAATGGAAGTTATGACTAGG - Intronic
1042883136 8:73516624-73516646 CTAAAAAGGAATTTTGGACATGG + Intronic
1042978817 8:74502359-74502381 ATAAAAAGAAAGATTGGACAAGG + Intergenic
1043252425 8:78091655-78091677 ATCAAATGGAATTGTACACATGG + Intergenic
1044337721 8:91007208-91007230 ATCCAATAGAAGTCTGTACATGG - Intronic
1048359286 8:133682335-133682357 GTCTAATGGAAGATTGGAAATGG + Intergenic
1048518765 8:135135110-135135132 CTCAAAGTGAAGTTTGGATAGGG - Intergenic
1048558476 8:135506352-135506374 ATCTGATGGAAGGTTGGACTTGG - Intronic
1048753571 8:137707060-137707082 AGCAAATCAAACTTTGGACAGGG - Intergenic
1048935158 8:139349075-139349097 ATCAAATGGAAGCTTGGATTGGG - Intergenic
1050234373 9:3562654-3562676 ACCATTTGGAAGTTTGGACTGGG - Intergenic
1050239883 9:3624099-3624121 ACCACCTGGAAGTTTGGACTGGG - Intergenic
1051138551 9:13952099-13952121 ATTAAATGGACGGTTGGATAAGG + Intergenic
1051997506 9:23235444-23235466 ATTAATTGGTACTTTGGACAAGG + Intergenic
1052364914 9:27601583-27601605 ATGGAAGGGAAGTTTAGACATGG - Intergenic
1053636144 9:40006957-40006979 ACCAATAGGAAGTTTGGAAATGG + Intergenic
1053760855 9:41349290-41349312 ATCAGATGGACGTCTGGCCATGG + Intergenic
1054317019 9:63604052-63604074 ACCAATAGGAAGTTTGGAAATGG + Intergenic
1054548517 9:66369170-66369192 ACCAATAGGAAGTTTGGAAATGG - Intergenic
1055327360 9:75144766-75144788 AGAAAATGGAAGTTTGGACAAGG - Intronic
1058536904 9:105970703-105970725 AAGAAATGGAAGTTTCGAGAGGG + Intergenic
1059005972 9:110403218-110403240 ATCTTATGGAAGTTAGGAGAAGG + Intronic
1059123884 9:111665275-111665297 ATCAAATGGAAGATAAGAAAAGG + Intronic
1059780100 9:117517059-117517081 ATCAAATGGATATTTGGAGAAGG + Intergenic
1060750198 9:126163740-126163762 ATCATATGGAAGTTTCTAGAAGG - Intergenic
1060783713 9:126432833-126432855 ATCAACTTGAAGGTTGGAAATGG + Intronic
1061739889 9:132694588-132694610 ATGAAATGGAAATTTGGGGAGGG + Exonic
1185834979 X:3337158-3337180 AACAAAGGGACGTTTGGGCATGG + Intronic
1186696445 X:12038276-12038298 ATCAAGTGCTAGTTTGGATAAGG - Intergenic
1186836597 X:13444513-13444535 TTCAAATGGGAGTGTAGACAGGG - Intergenic
1187258458 X:17662218-17662240 CTCAATTGGAAGTTTGGGGAAGG - Intronic
1187355872 X:18571049-18571071 ATCACATAGAAGTATGGACTCGG + Intronic
1188349764 X:29113658-29113680 ATGAAAGGGAAGTTTAGAAAAGG - Intronic
1189445738 X:41079133-41079155 ATCAAATGGAAATTGGTAAATGG + Intergenic
1192494801 X:71608669-71608691 ATCAGTTGGAAGTTTGCACTGGG + Intronic
1193191464 X:78575828-78575850 TAGAAATGGAAGTTTGGAGATGG + Intergenic
1194435164 X:93860589-93860611 CTCAAATGAAACTTTGGACTTGG + Intergenic
1194843712 X:98776692-98776714 CTCAAATGAAACTTTGGACTTGG + Intergenic
1195770420 X:108345409-108345431 ATCATCTGGAATTGTGGACAAGG + Intronic
1196500387 X:116374157-116374179 ATAAAATGGAATTTTGGATGAGG + Intergenic
1197312269 X:124919138-124919160 ATCAAATAAAAGTTTGAATAGGG - Intronic
1197569597 X:128132367-128132389 CTCAAATGAAACTTTGGACTTGG + Intergenic
1198100941 X:133421203-133421225 ACCAAATGGACGTTTGCATAGGG + Intergenic
1201079506 Y:10223646-10223668 ATCAAAAGAAAGTTTGAACTCGG + Intergenic
1201414679 Y:13736222-13736244 ATCAAAGGGCAAGTTGGACAAGG - Intergenic