ID: 967686752

View in Genome Browser
Species Human (GRCh38)
Location 3:192426219-192426241
Sequence CCTAATCTATAAAAGGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 1, 2: 2, 3: 43, 4: 283}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967686742_967686752 -3 Left 967686742 3:192426199-192426221 CCCTTGCTAGGCTCCAGTTCCCT 0: 1
1: 1
2: 0
3: 21
4: 209
Right 967686752 3:192426219-192426241 CCTAATCTATAAAAGGAGGGGGG 0: 1
1: 1
2: 2
3: 43
4: 283
967686741_967686752 -2 Left 967686741 3:192426198-192426220 CCCCTTGCTAGGCTCCAGTTCCC 0: 1
1: 0
2: 1
3: 26
4: 242
Right 967686752 3:192426219-192426241 CCTAATCTATAAAAGGAGGGGGG 0: 1
1: 1
2: 2
3: 43
4: 283
967686738_967686752 12 Left 967686738 3:192426184-192426206 CCTGGGCTTTTCCTCCCCTTGCT 0: 1
1: 0
2: 4
3: 43
4: 402
Right 967686752 3:192426219-192426241 CCTAATCTATAAAAGGAGGGGGG 0: 1
1: 1
2: 2
3: 43
4: 283
967686743_967686752 -4 Left 967686743 3:192426200-192426222 CCTTGCTAGGCTCCAGTTCCCTA 0: 1
1: 0
2: 0
3: 16
4: 221
Right 967686752 3:192426219-192426241 CCTAATCTATAAAAGGAGGGGGG 0: 1
1: 1
2: 2
3: 43
4: 283
967686740_967686752 1 Left 967686740 3:192426195-192426217 CCTCCCCTTGCTAGGCTCCAGTT 0: 1
1: 0
2: 0
3: 41
4: 417
Right 967686752 3:192426219-192426241 CCTAATCTATAAAAGGAGGGGGG 0: 1
1: 1
2: 2
3: 43
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967686752 Original CRISPR CCTAATCTATAAAAGGAGGG GGG Intronic
900457157 1:2782759-2782781 CCTCCTCTGTAAAAGGAGGAGGG - Intronic
902793627 1:18785860-18785882 CCTAACCTGTCAAAGGAGGGAGG - Intergenic
902814970 1:18911186-18911208 CCTAATCTGTCAAATGGGGGTGG - Intronic
903060590 1:20666071-20666093 CCTTAGCTACAAAATGAGGGGGG - Intronic
903230363 1:21918621-21918643 CCTCCTCTATAGAATGAGGGTGG - Intronic
903740355 1:25555089-25555111 CCTCATCTGTAAAATGGGGGTGG + Intronic
903993631 1:27290784-27290806 CCTCATCTGTAAAAGGAAAGAGG - Intronic
905383667 1:37583517-37583539 CCTCATCGATAAAAGGAGAGGGG + Intronic
905562080 1:38935489-38935511 CATCATCTGTAAAAGGAGGGTGG + Intronic
905582060 1:39089826-39089848 CCTTATCTATAAAAGGGAGATGG + Intronic
906730811 1:48079571-48079593 CCTCATCTGTAAAACGATGGTGG - Intergenic
907159387 1:52359659-52359681 CCCTATCTATAAAATGAGGGTGG + Intronic
907394646 1:54180687-54180709 CCTAATCTCTAGAATGAGGGTGG - Intronic
907738554 1:57140327-57140349 CCTCATCTGTAGAATGAGGGAGG - Intronic
907899533 1:58725140-58725162 CCCAAGCTAGAAAAGTAGGGAGG - Intergenic
908507673 1:64821676-64821698 CCTATTCGATAAAAGGTGCGGGG + Intronic
908983030 1:69981902-69981924 CCTCATCTATAAAATGGGGATGG - Intronic
910303316 1:85732941-85732963 CCCAATCTAGAAAAGCAGGCTGG + Intronic
910487856 1:87735704-87735726 CCTCAACTATAAAATGAGGGGGG - Intergenic
911095364 1:94050394-94050416 TTTAATCTGTGAAAGGAGGGAGG + Intronic
911707753 1:101034008-101034030 CGAAATCTATTAAAGGAGGAAGG - Intergenic
912725244 1:112053485-112053507 CCTCATCTATAAAATGTGGTAGG + Intergenic
915224452 1:154402275-154402297 CCTTATCTAAAAAGTGAGGGAGG + Intergenic
915471549 1:156128732-156128754 CCTCATCTATAAAAGGGAGAGGG + Intronic
918863652 1:189865470-189865492 CCCAAACTATAAAAGTAGGACGG - Intergenic
920436032 1:205947791-205947813 CCTCATATGTAAAATGAGGGAGG - Intergenic
920513240 1:206566036-206566058 CCTAAGCAAGAAAAGCAGGGAGG + Intronic
921117022 1:212101474-212101496 CTTTATCTATAAAAAGAGGATGG - Intronic
921790929 1:219289753-219289775 CTTAATTTATAAAATGAGGATGG - Intergenic
923721907 1:236474034-236474056 CCTCATCTATAAAATGGAGGTGG - Intronic
923955222 1:239010124-239010146 CCTGATCTATAATAGGAGGAAGG - Intergenic
1065041976 10:21706398-21706420 CCTCATCTATAAAGTGAGGGTGG - Intronic
1066395471 10:35017012-35017034 CCCAAACAATAAAAGGAGGTGGG + Intronic
1071305072 10:84292499-84292521 CTTCATCTATAAAATGAGGATGG - Intergenic
1071437202 10:85658404-85658426 TTTAATCTGTAAAATGAGGGGGG - Intronic
1072963622 10:99952813-99952835 CCTAAAGTAGAAAGGGAGGGAGG + Intronic
1073189131 10:101637754-101637776 CCTTATCTCTAAAAGGAGGAGGG - Intronic
1074889927 10:117727155-117727177 CCTCATCTATAAAATGGGGCAGG + Intergenic
1076357295 10:129862480-129862502 AGAAATCTCTAAAAGGAGGGTGG + Intronic
1077580361 11:3413555-3413577 CCTCATCTATAAAATGGAGGTGG - Intergenic
1079129158 11:17737523-17737545 CCTTATCTGTAAAATGGGGGAGG + Intronic
1081193897 11:40137743-40137765 CCTAACCTATAAAATGTGTGTGG + Intronic
1081800381 11:45854833-45854855 CCTCATCTATAAAATAAGGATGG + Intronic
1083000285 11:59284790-59284812 ACTAATCTACAAAAGGCGGAAGG - Intergenic
1083924993 11:65800694-65800716 CCTCATCTATAAAATGAGGTGGG + Intergenic
1084237287 11:67796383-67796405 CCTCATCTATAAAATGGAGGTGG - Intergenic
1085113084 11:73905688-73905710 CCTTTTCTATAAAAGCAGAGTGG - Intronic
1085260793 11:75203593-75203615 CCTCATCTATAAAAGGAGGGGGG - Intronic
1085483839 11:76845154-76845176 TCTTATCTATAAAATGAGGATGG + Intergenic
1085871171 11:80350924-80350946 CATAAAGTATAAAAGGAAGGGGG + Intergenic
1086400136 11:86454601-86454623 CCCAATCTGTAAAATGAGGATGG - Intronic
1086622743 11:88907141-88907163 CCTCATCTATATAATGAGGATGG + Intronic
1086948880 11:92870937-92870959 CTTTATCTGTAAAATGAGGGTGG - Intronic
1087261286 11:96015349-96015371 CCTCATCTATAAAAGTAGTAAGG + Intronic
1088142054 11:106629353-106629375 CTTAATCTGTCAAATGAGGGGGG - Intergenic
1091341910 11:134822701-134822723 CCTCATCTATAAAGTGAGGATGG - Intergenic
1092295377 12:7193119-7193141 CCTCATCTATAAAATGGGGGTGG - Intronic
1092407954 12:8233976-8233998 CCTCATCTATAAAATGGAGGTGG - Intergenic
1092831711 12:12450292-12450314 CTTCATCTGTAAAAGGAAGGAGG - Intronic
1093773571 12:23046343-23046365 CCTACTTTATAAATGGAGGTAGG + Intergenic
1094244215 12:28269185-28269207 CCCAACCTTTAAAAAGAGGGAGG - Intronic
1094261772 12:28508564-28508586 CCTGATCAATAAAAGGAGGTAGG - Intronic
1094620707 12:32077836-32077858 CCTCTGCTATAAAAGGATGGTGG - Intergenic
1096207594 12:49735991-49736013 CCTAAGGAATAAAAGGGGGGGGG + Intronic
1096802492 12:54120386-54120408 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1096815410 12:54198821-54198843 CCTCATCTATAAAACGGGGATGG - Intergenic
1098078188 12:66756015-66756037 CATAATTTTTAAAAGGATGGGGG - Intronic
1098720454 12:73891147-73891169 TCTAATCTATAAAATGAGAATGG + Intergenic
1100059976 12:90563109-90563131 CCACATCTATAAAAAGAGGGAGG - Intergenic
1101564923 12:105896066-105896088 TCTAATCTATAACAGGATGAGGG + Intergenic
1102568566 12:113813199-113813221 TCTAATCTGTAAAATGATGGGGG + Intergenic
1102799826 12:115722427-115722449 CCTAATCTGTAGAAGAAGGTAGG - Intergenic
1103594270 12:122014127-122014149 TCTTTTCTGTAAAAGGAGGGAGG + Intergenic
1104098947 12:125588228-125588250 CCTTATCTATAAAATGGGGATGG + Intronic
1106089981 13:26582372-26582394 CCTAATCTAAAAAAGAAAGCCGG + Intronic
1107425229 13:40286345-40286367 TCTAAACTTTAAAAGGAGGATGG + Intergenic
1109620679 13:64900911-64900933 TCTAATCTAATACAGGAGGGTGG - Intergenic
1110586040 13:77194669-77194691 CCTCATCCATAAAAGGTGGGTGG + Intronic
1110785057 13:79514136-79514158 CCTAATACATTAAAGGAGAGAGG - Intronic
1111270987 13:85884919-85884941 CCTAATTAATAAAATGAGGGAGG + Intergenic
1111554540 13:89863060-89863082 CCTAAACTATAAAAGGCAGGGGG + Intergenic
1115227177 14:31115830-31115852 CCTAATCTATAAAATGAGAGTGG - Intronic
1116135063 14:40912515-40912537 CCTAATCTATAAAATGAGAATGG + Intergenic
1116918573 14:50548939-50548961 CCTACCCCATAAAAGGTGGGTGG + Intronic
1117196007 14:53340777-53340799 CCTCATCTGTAAAACGGGGGTGG + Intergenic
1118718385 14:68576350-68576372 CCTAATCACGAAAAGGAGGAAGG - Intronic
1119696656 14:76718835-76718857 CCTAATCCATAAAGGAGGGGAGG - Intergenic
1119902496 14:78273292-78273314 CCTTATCTGTAAAATGAGTGTGG + Intronic
1120779089 14:88469726-88469748 GCTCATCTTTAACAGGAGGGTGG - Exonic
1121661764 14:95640439-95640461 CACCAACTATAAAAGGAGGGAGG + Intergenic
1122886320 14:104712014-104712036 CCTCATCTATACAATGAGGGAGG - Intronic
1127794575 15:62426960-62426982 CTTAAGCTATAAATGGAGAGGGG - Intronic
1128357613 15:66939247-66939269 CCTACTCCATAAAATGAGGGAGG + Intergenic
1128699660 15:69794929-69794951 CCTCATCTATTAAAAGAGGGAGG + Intergenic
1129204675 15:74029920-74029942 CCAAATCTTTAAAAAGAAGGAGG - Intronic
1129712677 15:77828575-77828597 CCTCATCTATAAAACGGGAGGGG - Intergenic
1129920353 15:79314446-79314468 CATAATCTAGAAAAGGTTGGTGG + Intronic
1130234930 15:82124937-82124959 CCTGCTCTTTGAAAGGAGGGAGG + Intergenic
1130519018 15:84648089-84648111 CCTTATCTGTGAAATGAGGGTGG - Intronic
1130743409 15:86625228-86625250 CCCAATCTGTAAAATGAAGGTGG + Intronic
1133348901 16:5088806-5088828 CCTCATCTATAAAATGGAGGTGG - Intronic
1133872795 16:9705227-9705249 CCTCATCTGTAAAAGGCGGATGG - Intergenic
1136067209 16:27767267-27767289 CCTCATCTATAAAATGAGGAGGG + Intronic
1136372317 16:29844140-29844162 CCTCATCTGTAAAATGGGGGTGG + Intronic
1137479568 16:48840595-48840617 CCCAATCTATATAAGCTGGGAGG + Intergenic
1137904019 16:52300607-52300629 CCTTCTCTATAAAATGAGGGAGG + Intergenic
1138156691 16:54712262-54712284 CTTCATCTATAGAAGGAAGGAGG - Intergenic
1140441477 16:74991346-74991368 CCTAAACTCGAAAAGGTGGGGGG + Intronic
1141309290 16:82897543-82897565 CCTCATCTATAAAATGGGGATGG - Intronic
1141344681 16:83233885-83233907 CCTCATCTATACAAGGAGTGTGG - Intronic
1141983763 16:87566208-87566230 CCTCCTCTGTAAAATGAGGGTGG + Intergenic
1144191821 17:12853400-12853422 CCTGATCTACAGAAGGAGGTGGG + Intronic
1144764888 17:17727253-17727275 CCTCTTCTGTCAAAGGAGGGAGG - Intronic
1145853286 17:28125119-28125141 CCTCTTCTATAAAGGAAGGGTGG + Intronic
1145868745 17:28256802-28256824 CCTAATCTGTAAAATGGGGATGG - Intergenic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146138144 17:30341090-30341112 CCAAATCTTTAGAAGCAGGGTGG + Intergenic
1146176903 17:30670943-30670965 CCTCATTTATAAAATGAGGATGG + Intergenic
1146973777 17:37093855-37093877 CCTCATCTGTAAAATGGGGGTGG - Intronic
1147039796 17:37709800-37709822 CCTCATCTATAAAATGGGGGCGG - Intronic
1148335378 17:46837525-46837547 CCTTATTTGTAAAACGAGGGTGG - Intronic
1148340783 17:46872365-46872387 CCTAATCTGTAAAATGGGGACGG + Intronic
1148888640 17:50791749-50791771 CTTACTCCATAAAAGGAGGATGG - Intergenic
1149203833 17:54220012-54220034 CCTCACCTCTAAAGGGAGGGGGG - Intergenic
1150187072 17:63194013-63194035 CCTCATCTACAGATGGAGGGGGG - Exonic
1151739628 17:75971434-75971456 CCTAATTTTTGAAAGGAGAGAGG - Intronic
1155866461 18:30972262-30972284 CCTAGTATGTTAAAGGAGGGTGG - Intergenic
1158667876 18:59449210-59449232 CCTCATCTATAAAATGGGGATGG + Intronic
1158925866 18:62259249-62259271 CCAAATCTATAAAAAGAGATAGG + Intronic
1159208002 18:65279113-65279135 CCTAAACTTTAAAAGGAAGGCGG + Intergenic
1159419357 18:68196504-68196526 CTTAATGTATACAATGAGGGTGG + Intergenic
1160021376 18:75184315-75184337 CCTCATTTACACAAGGAGGGAGG + Intergenic
1160486346 18:79296688-79296710 CCTAATTTATGAAACAAGGGTGG - Intronic
1162048096 19:8014783-8014805 CCTCATCTCTAAAATGGGGGTGG + Intronic
1162144721 19:8606652-8606674 CCTCATCTATAAAAAGATGAGGG - Intronic
1162461906 19:10818418-10818440 CCTCATCTATCCAAGGAGGATGG - Intronic
1162733363 19:12732160-12732182 CCTCATCTATGAAAAGGGGGTGG - Intronic
1162981916 19:14245967-14245989 CCTCATTTATAAAATGAGGATGG - Intergenic
1164004668 19:21137440-21137462 CCTGATCTCTAAAAGGAAGGTGG - Intergenic
1164026423 19:21357504-21357526 CCTAATCTCTAAAAGAAAGGTGG + Intergenic
1166276004 19:41754495-41754517 CCTGATTTGTAAAAGGAGGATGG - Intronic
1166281255 19:41795539-41795561 CCTGATTTGTAAAAGGAGGATGG - Intergenic
1166395540 19:42437538-42437560 CCTGATTTGTGAAAGGAGGGTGG + Intronic
1166412214 19:42563141-42563163 CCTGATTTGTAAAAGGAGGATGG + Intergenic
1168563418 19:57403052-57403074 CCTAATCAATCATAGGAGGGGGG - Intronic
926034733 2:9627218-9627240 CCTACTCTATGAAAGGGAGGAGG + Intronic
926809012 2:16740075-16740097 CTTCATCTATAAAATGAGGAAGG - Intergenic
928216691 2:29367411-29367433 GCTAATCTGTAAAATGAGGGAGG + Intronic
929420250 2:41783044-41783066 CCTTTTCTATAAAATGAGGAGGG - Intergenic
930225669 2:48790113-48790135 CCTAAGGTCTGAAAGGAGGGAGG - Intergenic
930543510 2:52737440-52737462 CCTAATCTATGAAATGGGTGTGG - Intergenic
933782254 2:85810912-85810934 CCTCATCTGTAAAACCAGGGCGG - Intergenic
935190356 2:100772860-100772882 CCAAAGCTAAAAGAGGAGGGAGG + Intergenic
937215501 2:120310262-120310284 CCTCATCTGTAAAATGAGGGGGG + Intergenic
937418249 2:121734267-121734289 CCTAATGTTCAATAGGAGGGTGG + Intronic
937593111 2:123639137-123639159 CCTCATCTATCAAATGAGAGTGG - Intergenic
938833893 2:135079827-135079849 TCTCATCTATAAAATGAGGTTGG + Intronic
939892169 2:147749395-147749417 CCTAGACCATAAAAGGAGGCTGG + Intergenic
940685994 2:156851722-156851744 CCTTATGTATAAAAGAAGTGTGG - Intergenic
940869829 2:158850412-158850434 CCTAATATCTACAAGGAGAGAGG - Intronic
941113341 2:161442860-161442882 CCTTATCTATAAAATGAAGTTGG - Intronic
941203510 2:162543743-162543765 CCTCATCTATAAAATAAGGAAGG + Intronic
941533473 2:166696041-166696063 CCTAATATCTAAAAGTAGCGAGG + Intergenic
942643680 2:178087991-178088013 CCTCATCTATAAAACGTGAGGGG - Intronic
943272515 2:185825312-185825334 CCTCATCTATAAAATGAGTATGG - Intronic
944639557 2:201709759-201709781 CTTAATCTATTAAAGGACTGTGG + Intronic
945442155 2:209893324-209893346 CCAAATCTTGAAAAGGAAGGAGG + Intronic
1169689579 20:8315587-8315609 TCTTATGTATAAAATGAGGGAGG + Intronic
1171527792 20:25829522-25829544 ATCAATCAATAAAAGGAGGGGGG + Intronic
1171549034 20:26026362-26026384 ATCAATCAATAAAAGGAGGGGGG - Intergenic
1171854221 20:30330191-30330213 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1173542393 20:43863877-43863899 CCTCATCTCTAAAACGGGGGTGG + Intergenic
1173620686 20:44433771-44433793 GCTAAACTATTACAGGAGGGTGG + Intergenic
1175177934 20:57124690-57124712 CGTTATCTATAAAATGAGGAAGG + Intergenic
1175436120 20:58950348-58950370 CTTAATTTGTAAAAGAAGGGAGG + Intergenic
1175709557 20:61208307-61208329 CCTCATCTACAAAATGGGGGTGG + Intergenic
1177918100 21:27116047-27116069 CCTCTTCTATAAAATGAGGAAGG + Intergenic
1177922146 21:27165246-27165268 TTTAAACTATAAAATGAGGGTGG + Intergenic
1178471482 21:32897433-32897455 CCTCATCTAGAAAACGAGGATGG - Intergenic
1179123499 21:38570522-38570544 TGTGATCTATAAAATGAGGGTGG - Intronic
1179967600 21:44816499-44816521 CCTCATCTGTAAAGGGAGGGTGG + Intronic
1182413481 22:30206121-30206143 CCTCATCTGTAAATGGAGGCGGG - Intergenic
1182971595 22:34584323-34584345 AGAAATCTATAAAATGAGGGTGG + Intergenic
1183591212 22:38780302-38780324 CCTAGTCCTTAAATGGAGGGTGG - Intronic
950900405 3:16492435-16492457 CCTCATCTATAAAAGGAACACGG - Intronic
951059547 3:18189096-18189118 TCTAAGCTTTAAAAGGTGGGAGG - Intronic
954002374 3:47567709-47567731 CCCCATCTATAAAAGGAAGAAGG + Intronic
954685163 3:52366324-52366346 CCTCATCTATAAAATGAGGATGG - Intronic
959159959 3:102711215-102711237 AATAATCTTTAAAAGGAAGGTGG + Intergenic
961036706 3:123647522-123647544 CCTTACTTATAAAAGGAGGTGGG - Intronic
961301595 3:125925392-125925414 CCTCATCTATAAAATGGAGGTGG + Intergenic
961622606 3:128236400-128236422 CCTCATCTGTAAATGGCGGGGGG + Intronic
961886872 3:130102463-130102485 CCTCATCTATAAAATGGAGGTGG - Intronic
963747227 3:149136615-149136637 CCTGATGTATAAAATGAGGAGGG + Intronic
963837833 3:150074867-150074889 CCAAAGCAATAAAATGAGGGTGG - Intergenic
964339175 3:155690235-155690257 TCTCATCTATAAAAGGAGAGTGG + Intronic
965522878 3:169685930-169685952 CCTAATCAGTAAAATGAGAGAGG - Intergenic
965655190 3:170976065-170976087 CCTAATCTAAACAGGAAGGGAGG + Intergenic
965863302 3:173173093-173173115 CCTAATGTATGAAAGGACAGGGG - Intergenic
966093883 3:176174533-176174555 AATTCTCTATAAAAGGAGGGAGG - Intergenic
967686752 3:192426219-192426241 CCTAATCTATAAAAGGAGGGGGG + Intronic
968833912 4:2948947-2948969 CCTAATCAAGGAAAGGTGGGAGG - Intronic
969063345 4:4456954-4456976 CCTCATTTGTAAAATGAGGGAGG + Intronic
969757949 4:9162231-9162253 CCTCATCTATAAAATGGAGGTGG + Intergenic
969817931 4:9699773-9699795 CCTCATCTATAAAATGGAGGTGG + Intergenic
970991307 4:22216338-22216360 CCTCAGCTATAAAATGAGGATGG + Intergenic
972696862 4:41455306-41455328 CCTTAACTCTAAAAGGAGAGGGG + Intronic
973194508 4:47424330-47424352 CCTTATCTATAAAATGGGGATGG + Intronic
976071565 4:81246216-81246238 CCTCATCTGTAAAATGAGTGTGG + Intergenic
976793579 4:88907867-88907889 CCTCATCTGTAAAATCAGGGAGG - Intronic
978263576 4:106793952-106793974 CCCAATGTATAAGAGGTGGGAGG + Intergenic
980324687 4:131326011-131326033 CATAAGCTATTAAAGGAGAGGGG - Intergenic
982241973 4:153308881-153308903 CCTAAAATATATGAGGAGGGAGG + Intronic
982888034 4:160808437-160808459 CTTTATCTATAAAAGGACAGAGG - Intergenic
983585152 4:169346441-169346463 CTTAATCTATAAAATGAATGTGG + Intergenic
984559310 4:181250209-181250231 CCTCCTCTATAATAGGAGGGAGG - Intergenic
984682614 4:182627288-182627310 CTTAATGTATAAAATGAGGATGG - Intronic
986696196 5:10357121-10357143 CCTAACCCATAAAATGAGGAGGG - Intronic
986927199 5:12769652-12769674 CCTAATTTATAAAAGAAGATGGG + Intergenic
990322438 5:54643079-54643101 TCTAAACTATAAAGGGAGGGGGG + Intergenic
991979610 5:72217630-72217652 CCTAAGCTTTGAAAGGAGGGAGG + Intergenic
995744799 5:115392434-115392456 CCTTATCTTTAAAAGGGAGGAGG - Intergenic
999571305 5:152923037-152923059 CCTCATCTGTAATATGAGGGTGG - Intergenic
1001233402 5:170009363-170009385 CCTGATCAGTAAAAGGATGGGGG - Intronic
1001489376 5:172144852-172144874 CCTCATCTGTAAAAGGGGGTGGG - Intronic
1001780341 5:174363291-174363313 CCTTCTCTATAAAATGGGGGTGG + Intergenic
1002045614 5:176540248-176540270 CCTCATCTGTAAAATGAGGCTGG - Intergenic
1002626587 5:180533905-180533927 CCTAAGCCATAAAGTGAGGGAGG - Intronic
1002827911 6:790479-790501 CCTCATCTGTAAAATGAAGGTGG - Intergenic
1003533124 6:6954247-6954269 CCTCATCTCTAAAACCAGGGTGG + Intergenic
1004007152 6:11647517-11647539 CCTCATCTGTAAAACGAGGAGGG - Intergenic
1004240778 6:13919218-13919240 CCCCATCTATAAAATGAAGGTGG - Intergenic
1004533319 6:16475071-16475093 TCTCATCTATAAAAGGAGTAGGG - Intronic
1005728998 6:28677413-28677435 CATAAAGTATAAAAGGAGGTCGG - Intergenic
1006739438 6:36296833-36296855 CCTAATCTGTAAAAAAAAGGGGG + Intronic
1006847073 6:37069886-37069908 CCTAATCCATACTCGGAGGGTGG - Intergenic
1007090948 6:39184692-39184714 CCACATGTATGAAAGGAGGGTGG + Intergenic
1007454683 6:41967457-41967479 CTTCATCTATAAAAGGAGCTGGG + Intronic
1007940867 6:45780213-45780235 CCTCATCTGCAAAAGGAGAGGGG - Intergenic
1008097008 6:47349333-47349355 CCTAAACTGTAACAAGAGGGAGG - Intergenic
1009049919 6:58263515-58263537 CCTAATATTTAGAAGGAGAGTGG - Intergenic
1009225464 6:61016774-61016796 CCTAATATTTAGAAGGAGAGTGG - Intergenic
1009369463 6:62881738-62881760 CCTAATATCAAAAAGGAGAGAGG + Intergenic
1010442801 6:75917984-75918006 CCTCTTCCATAAAAGGAGGCAGG - Intronic
1010740009 6:79490357-79490379 TCTCATGTATAAAATGAGGGTGG - Intronic
1010907119 6:81504168-81504190 CATTATTTATAAAAGGTGGGTGG + Intronic
1011986964 6:93459229-93459251 CCTAATCTATAAAATGAGGTTGG + Intergenic
1013246399 6:108291265-108291287 TCTTATCTATAAAATTAGGGTGG - Intergenic
1013290089 6:108712370-108712392 CCTCATCTGTAAAATGGGGGAGG + Intergenic
1015805071 6:137100537-137100559 CTTAATCTATTAGAGGAGGCTGG + Intergenic
1015876110 6:137824433-137824455 CTTATTCCATAACAGGAGGGAGG + Intergenic
1016673782 6:146739210-146739232 CCTAATCTATACAAGGATGTTGG - Intronic
1016723527 6:147331496-147331518 CCTCATTTATAAAATGAAGGTGG + Intronic
1018317843 6:162574928-162574950 CCTAATCTATAAAATGTGAAAGG - Intronic
1018668377 6:166160462-166160484 CCTCACATATAAAAGGAAGGTGG - Intronic
1018919260 6:168160074-168160096 CCCTATCTATAAAATGAGGAGGG + Intergenic
1019912881 7:4111910-4111932 CCTTAACTATAAAATGAAGGTGG - Intronic
1020320309 7:6934877-6934899 CCTCATCTATAAAATGGAGGTGG - Intergenic
1022185361 7:27962005-27962027 CCTTATCTATAAAATGAAGATGG + Intronic
1022417771 7:30192550-30192572 CCTCATCTATAAAAAGAAGATGG + Intergenic
1023272247 7:38476762-38476784 CCTCCTCTATAAAAGGAGATTGG - Intronic
1023336607 7:39177215-39177237 CTGAATCATTAAAAGGAGGGTGG - Intronic
1023745128 7:43316020-43316042 CATAATCTATAATAGAAGAGTGG - Intronic
1024803666 7:53110686-53110708 CCTATTCTATAAAATGAGGAAGG + Intergenic
1026445332 7:70479748-70479770 CCTAATCTATAAAACAAAGATGG + Intronic
1026928959 7:74212573-74212595 TCTCATCTATAAAATGAGGTCGG - Intronic
1027505486 7:79012729-79012751 TCTCATCTATAAAAGGAAGGTGG + Intronic
1027603858 7:80275025-80275047 TCTAATTTTTAAAAGGGGGGAGG - Intergenic
1027713574 7:81640563-81640585 ACTATTCTAAAAAGGGAGGGAGG + Intergenic
1027872990 7:83732933-83732955 CATAATCTACAGAAGGAGGTAGG + Intergenic
1028995165 7:97092084-97092106 CCCAAACTATAAAAGGAGTCTGG + Intergenic
1029527266 7:101102622-101102644 CCTCATCTTTAAAACGAGGATGG - Intergenic
1031338505 7:120568734-120568756 CCTTATCAATAAAATGAAGGTGG + Intronic
1031589958 7:123578747-123578769 CTGAATCTATAAGAGGAAGGTGG - Intronic
1033014737 7:137660939-137660961 CATGATCTATAAAAGGATTGGGG + Intronic
1034216098 7:149406872-149406894 CCCATTATATAAAAGCAGGGAGG - Intergenic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1034683915 7:152952999-152953021 TCTCATCTAAAAAAGGAGGATGG + Intergenic
1035160495 7:156946607-156946629 CTTCATCTCTAAAAGGAAGGGGG + Intergenic
1036381202 8:8237553-8237575 CCTCATCTATAAAATGGAGGTGG + Intergenic
1036704695 8:11038310-11038332 CCTTAACTATAAAATGAGCGGGG - Intronic
1036848361 8:12185075-12185097 CCTCATCTATAAAATGGAGGTGG - Intronic
1036869721 8:12427356-12427378 CCTCATCTATAAAATGGAGGTGG - Intronic
1038087868 8:24219861-24219883 CCTAATCTAGAAATGGGGTGAGG - Intergenic
1039762227 8:40590025-40590047 CCTCATCTAAAAAGGAAGGGAGG - Intronic
1040725723 8:50379308-50379330 CCTAGCCTATGAAAGCAGGGGGG + Intronic
1041045771 8:53884553-53884575 CCTCATCTGTAAAACGAAGGAGG - Intronic
1041275804 8:56156683-56156705 CCTGCTCTATAAAAGGCGGATGG - Intergenic
1043763187 8:84095345-84095367 CCAAATCTTTAAAAGGATGCTGG - Intergenic
1043866074 8:85377302-85377324 GCAAGTTTATAAAAGGAGGGAGG - Intronic
1044139010 8:88624976-88624998 CTAAATCTATAAAAGGAATGAGG - Intergenic
1045547969 8:103144947-103144969 CCTCACTTGTAAAAGGAGGGTGG - Intronic
1045994555 8:108347532-108347554 CCAAATTTATAAAAGGAGACGGG + Intronic
1047156512 8:122325417-122325439 CCTCATCTTTAAAATGAGGATGG + Intergenic
1047743909 8:127829536-127829558 TCTATTCTATAAAAAGAGGGTGG + Intergenic
1047764455 8:127979183-127979205 CCTAATATAAAAAAGGAGTTTGG - Intergenic
1048234320 8:132675248-132675270 CCTAATCTGTAAAATGGGCGGGG - Intronic
1048677401 8:136798974-136798996 TCTCATCTCTAAAAGGAGAGAGG + Intergenic
1049419139 8:142509300-142509322 CCTCATCTTTAAAATGGGGGTGG - Intronic
1053454808 9:38225873-38225895 CCTCATCTGTAAAAGGTGGGGGG + Intergenic
1053792030 9:41693472-41693494 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1054149423 9:61589226-61589248 ATCAATCAATAAAAGGAGGGGGG - Intergenic
1054153126 9:61621293-61621315 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1054180435 9:61905492-61905514 CCTCACCTGTAAAAAGAGGGAGG + Intergenic
1054372839 9:64421748-64421770 GCAAATCTATAAAAGAAGGTGGG - Intergenic
1054469183 9:65520329-65520351 ATCAATCAATAAAAGGAGGGGGG - Intergenic
1054472920 9:65552497-65552519 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1054657156 9:67675650-67675672 CCTCACCTGTAAAAAGAGGGAGG - Intergenic
1056071103 9:82987793-82987815 TCTAATCTGTAAAATGAGGGAGG - Intronic
1058148008 9:101432687-101432709 CCTAATCTATTAAATGGGAGGGG - Intronic
1059006429 9:110407736-110407758 CAAAATCTATATGAGGAGGGAGG + Exonic
1059414599 9:114155344-114155366 CCCCATCTATACAAGGAGGAGGG + Intergenic
1059617109 9:115963109-115963131 ACTAATCTCTAAAATGAAGGTGG - Intergenic
1060218602 9:121752881-121752903 CCTCATCTGAAAAAGGAGGAAGG - Intronic
1060238102 9:121880349-121880371 GATCATTTATAAAAGGAGGGAGG - Intronic
1060682023 9:125574852-125574874 TCTCATGTATAAAATGAGGGTGG - Intronic
1061049335 9:128185404-128185426 CCTCATCTGTAAAATGAGGGGGG - Intronic
1187031630 X:15493713-15493735 CCTCCTCTATAAAATGAGGATGG + Intronic
1188709696 X:33379962-33379984 TCTAATCTATAAAGATAGGGTGG - Intergenic
1192152109 X:68718862-68718884 CCTCATCTGTAAAGTGAGGGAGG + Intronic
1193159588 X:78213745-78213767 CCTGATGAAAAAAAGGAGGGGGG - Intergenic
1193431293 X:81409424-81409446 CCTCAACTGTAAAAGGAGAGTGG + Intergenic
1193843060 X:86433058-86433080 CCTAATCTGTAAAATGGGGATGG + Intronic
1196816430 X:119668649-119668671 CCTCATCTATAAAATGTGGAGGG + Intronic
1197918517 X:131562476-131562498 CTTCATCTTTAAAATGAGGGAGG - Intergenic
1198208966 X:134497993-134498015 CCTAAACTATAAAAGGGTGTGGG - Intronic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1199058133 X:143321472-143321494 TCTTATCTATCAAAGGAGGAGGG + Intergenic
1199487422 X:148363177-148363199 CCTTATTTATAAAATGAGAGGGG + Intergenic
1199709576 X:150459606-150459628 CCTCATCTGTACAATGAGGGTGG + Intronic