ID: 967686942

View in Genome Browser
Species Human (GRCh38)
Location 3:192428568-192428590
Sequence CTTGACAGTGACTCTTCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967686942 Original CRISPR CTTGACAGTGACTCTTCTCT TGG Intronic
900264189 1:1749177-1749199 CTTGGCACAGACCCTTCTCTGGG - Intergenic
901158966 1:7160481-7160503 CTTGAAACAGACTCTTCCCTAGG + Intronic
904197912 1:28799815-28799837 CTGGACACTGACTTTTCCCTGGG - Intergenic
906158459 1:43628665-43628687 GTTAACAGTGACTCTCCTCTAGG - Intergenic
906667651 1:47632811-47632833 CTTGAAATTCTCTCTTCTCTTGG - Intergenic
911173859 1:94798880-94798902 CTTAACAGTGGCCATTCTCTGGG + Intergenic
913287728 1:117241869-117241891 CTCAACACTGAATCTTCTCTCGG + Intergenic
915338287 1:155161061-155161083 CTGAACCTTGACTCTTCTCTGGG - Intergenic
916854012 1:168731254-168731276 GTAGACAGTGGCTCTTCTCCAGG + Intergenic
917797545 1:178542802-178542824 CTTTACAGTAACTCTCCTCCTGG + Intronic
918215446 1:182389654-182389676 CTTGAGAGTTTCTCTTCTTTCGG - Intronic
918331985 1:183470522-183470544 CTTGAAAGTGCCTCTTCACCTGG + Intergenic
919794393 1:201312441-201312463 CTAGAAGGTCACTCTTCTCTGGG + Intronic
921411962 1:214845477-214845499 CTAGAAGGTGTCTCTTCTCTAGG - Intergenic
922375804 1:224964007-224964029 CTTGAAAGAGTCTCTTTTCTTGG - Intronic
924458160 1:244234631-244234653 CTTGTCAGGGAGGCTTCTCTTGG - Intergenic
924637363 1:245800816-245800838 GCTGACAATGACTCTTTTCTTGG + Intronic
1064871367 10:19941170-19941192 CTTGAAAATGTCTATTCTCTGGG - Intronic
1067253375 10:44609148-44609170 CTTGACATTGAACCTTATCTTGG + Intergenic
1069244871 10:66191734-66191756 ATTGAAAATGACTCTTCTTTGGG + Intronic
1071307181 10:84309747-84309769 CTTGACAAAGATTCTTTTCTTGG - Intergenic
1071447402 10:85761605-85761627 CTTGTCATTGCCTCTTCTTTAGG - Intronic
1071948520 10:90676141-90676163 CTTGACATTGACTGTCCTCATGG - Intergenic
1074009510 10:109462702-109462724 TATGACAAGGACTCTTCTCTTGG - Intergenic
1074210819 10:111332993-111333015 CTTGAAAGTGAGTCTACTCCTGG + Intergenic
1074441936 10:113485457-113485479 CATGACAATGACTCTTATCCTGG - Intergenic
1076259091 10:129051365-129051387 CGTGACAGTGACAGCTCTCTGGG - Intergenic
1076574084 10:131452495-131452517 CATTCCAGTGTCTCTTCTCTTGG + Intergenic
1081149616 11:39610857-39610879 CTTGACAGAAAATCTTCTCTGGG - Intergenic
1084726914 11:70947904-70947926 CTTGGCAGGGACTTTACTCTGGG - Intronic
1084769785 11:71335158-71335180 CTGGGCATTGACTCTTCTCCAGG + Intergenic
1086085108 11:82945696-82945718 CTTGAAAGTGAGGCTTCACTGGG + Intronic
1086210899 11:84317385-84317407 CTTGACAGTATCCCTGCTCTAGG + Intronic
1087368500 11:97251454-97251476 CTTCACTGTGATTCTTCTATTGG - Intergenic
1090157879 11:124460553-124460575 TTTGACAGTCATTCTCCTCTGGG - Intergenic
1090462515 11:126904840-126904862 TTTTACAGTTTCTCTTCTCTGGG - Intronic
1090469384 11:126966607-126966629 CATCTCAGTGACTCTTCTCTAGG + Intronic
1095285661 12:40407460-40407482 CTTGACCCTGACTGTGCTCTTGG - Intronic
1096282920 12:50272247-50272269 CTAAAAAGTGACTCTTCTCTAGG + Intronic
1097314627 12:58159029-58159051 CTTCAAAGTGATTCTTTTCTTGG - Intergenic
1098735392 12:74095651-74095673 TTTTACAGTTCCTCTTCTCTAGG + Intergenic
1101065268 12:101014418-101014440 CTTCCCACTGACTCTCCTCTAGG - Intronic
1101941036 12:109098950-109098972 CCTGACAGTGCCACTCCTCTCGG - Intronic
1105034520 12:132909007-132909029 CTTGACTTTTACTCTTTTCTTGG + Intronic
1105569257 13:21585026-21585048 CTATACAGTGACTCTTCTGGGGG - Intronic
1107989639 13:45807633-45807655 TTTTACACTGAGTCTTCTCTAGG - Intronic
1108011517 13:46018134-46018156 CTTGAAAAAGACTCTTCTTTTGG - Intronic
1108938198 13:55913136-55913158 CTTGACAGTTATTCTACTTTTGG + Intergenic
1109838348 13:67888178-67888200 CTTGATTGTGACTCCTCTCACGG + Intergenic
1111983345 13:95040047-95040069 GGTGCCTGTGACTCTTCTCTGGG + Intronic
1114794267 14:25694871-25694893 ATAGAAAGTGAATCTTCTCTGGG + Intergenic
1116056465 14:39870512-39870534 TTTGCCAGTGATTTTTCTCTTGG + Intergenic
1125416841 15:39462767-39462789 CATGACTGTGCCTCTTCTCAGGG - Intergenic
1126435273 15:48631312-48631334 CTAGAAAGTGGCTCTTCTCAGGG + Intronic
1130049646 15:80473222-80473244 CTTAACCGTGACTGTTTTCTTGG + Intronic
1132473918 16:122915-122937 CTTGACAGTGCATCTCCTCTGGG - Intronic
1133337930 16:5018305-5018327 CTTGACACCTACTTTTCTCTGGG - Exonic
1135980862 16:27145933-27145955 CTTGACAGTGACTCTGTTCCAGG + Intergenic
1139635591 16:68256475-68256497 CTCCACAATGACTATTCTCTTGG + Intronic
1139681987 16:68572395-68572417 CTTGACAGGGACTTTTCTGTTGG + Intronic
1145884704 17:28373859-28373881 CTGGTTAGTGACTCTTCTCTCGG - Intronic
1147933733 17:43999252-43999274 CTTGACAGTGACTCTGGTAGGGG + Intronic
1148146200 17:45366649-45366671 TGTGACAGTCCCTCTTCTCTGGG + Intergenic
1149346555 17:55742849-55742871 CTTGTCCTTGACTCTTGTCTTGG + Intergenic
1150466957 17:65402209-65402231 CTTTCCAGATACTCTTCTCTTGG - Intergenic
1151191577 17:72402016-72402038 CTAGACACTGACTTTTATCTGGG - Intergenic
1151264737 17:72945982-72946004 CCTGATTGTGAGTCTTCTCTAGG - Intronic
1152511251 17:80790552-80790574 CGTGGCAGTGACTCCTCTATGGG - Intronic
1153964101 18:10165398-10165420 CTTCACAGTGCGTCTTCTGTTGG - Intergenic
1156354477 18:36329470-36329492 CATGACAATGACTCCACTCTAGG - Intronic
1157766688 18:50302734-50302756 CTTGAACCTGACTTTTCTCTTGG - Intergenic
1158673850 18:59500895-59500917 CTTGCCTGTGACTCAGCTCTGGG - Intronic
1160089024 18:75808523-75808545 CTTGACACTGAGACTTCACTTGG + Intergenic
1163413759 19:17172983-17173005 CTCGACAGTGACGCTTTTGTGGG - Intronic
1165369191 19:35392101-35392123 GATGTCAGTGACACTTCTCTGGG - Intergenic
925153098 2:1630007-1630029 ATAGACAGTGACTCTTCTAATGG + Intergenic
926128312 2:10285302-10285324 CTGGAGAGTGACTCTTCCCCCGG - Intergenic
926539269 2:14154542-14154564 CTTGACAGACACTGTGCTCTTGG + Intergenic
927459081 2:23282260-23282282 CTAGACATTGAATCTTCTGTGGG - Intergenic
927733078 2:25492946-25492968 TTTGACAGAGCCTCTTCTGTAGG + Intronic
932878429 2:75476652-75476674 GTTGACACTAATTCTTCTCTAGG - Intronic
934151852 2:89154627-89154649 CTTGACGGTGAGTCTTTTCATGG + Intergenic
934215408 2:90027279-90027301 CTTGACGGTGAGTCTTTTCATGG - Intergenic
934219994 2:90073874-90073896 CTTGACCGTGAGTCTTTTCACGG - Intergenic
936872826 2:117153815-117153837 CATGATAGTGACACTTTTCTAGG - Intergenic
937858361 2:126689141-126689163 CTTTACATTGACTCTGCTGTGGG - Intronic
937858867 2:126692752-126692774 CTTTACATTGACTCTGCTGTGGG - Intronic
938403046 2:131009827-131009849 GTTTACACTGACTTTTCTCTTGG + Intronic
938929227 2:136071744-136071766 CTCCACATTGACTCTTCCCTGGG - Intergenic
940378316 2:152983847-152983869 ATTTACAGTGACTTTGCTCTTGG - Intergenic
942212533 2:173685855-173685877 CATGACAGGGACGCTGCTCTAGG + Intergenic
943060241 2:183035932-183035954 CTTGAGTGTGAATTTTCTCTGGG - Intronic
945835256 2:214832196-214832218 CTTCACAGTTACTCTTCATTTGG + Intergenic
947933855 2:233986324-233986346 CTGGAGAGTGACTCTCCTTTAGG + Intronic
948515768 2:238503181-238503203 CTTCTCAGTGGCCCTTCTCTGGG + Intergenic
1168927950 20:1598441-1598463 CTTGACAGTGAGGATTCTTTTGG + Intronic
1169084086 20:2816255-2816277 CCCTACAGTGACTCCTCTCTTGG + Intergenic
1173655400 20:44697034-44697056 TTTGACAATGACTCTTTTCCTGG + Intergenic
1173859320 20:46271979-46272001 CCTAAAACTGACTCTTCTCTGGG + Intronic
1177859372 21:26434986-26435008 GTTGACAGTGACTATTCACTTGG + Intergenic
1178944797 21:36937797-36937819 CTTGAGAGTGACATTTCACTGGG - Intronic
1179234020 21:39529201-39529223 CTGGACAGCGACTCTTGCCTGGG - Intergenic
1181905376 22:26190761-26190783 CTTCTCTGTGACTTTTCTCTTGG - Intronic
952759301 3:36899748-36899770 TTTGAAAGTGATTCTTTTCTTGG - Intronic
953958863 3:47251765-47251787 CTTGCCAGTGTATCTTCTCTTGG + Intronic
954666293 3:52254687-52254709 TTTGACAGTGACACTGCACTGGG - Exonic
955053700 3:55437618-55437640 CTTGACATAGAATCATCTCTGGG + Intergenic
955791412 3:62592148-62592170 CTTCACAGTGACTCTTCATATGG + Intronic
955937493 3:64115257-64115279 CTTTACAGTGACACTGGTCTGGG - Intronic
956086373 3:65615382-65615404 CGTGACAATTCCTCTTCTCTTGG - Intronic
956429531 3:69171587-69171609 CTTCACACTGAGTCCTCTCTTGG + Exonic
956678992 3:71760286-71760308 CTTGACAGTGTCTCCCCTCATGG - Intergenic
957118704 3:76060789-76060811 CTTGTCTGTGACTCTTAACTTGG + Intronic
957181261 3:76881120-76881142 ATTGCCAGTGACTATTTTCTGGG - Intronic
959516466 3:107272738-107272760 CTTCACACTGAATTTTCTCTTGG + Intergenic
960363602 3:116744317-116744339 GTTGATAGTGATTCTTCTCTCGG - Intronic
961212657 3:125137740-125137762 CTTCCCAGTGACTCATCTATTGG - Intronic
961843979 3:129745246-129745268 CTTGAAATTCACTCTTCTCTTGG + Intronic
964388036 3:156170025-156170047 CTTGAGACTGGCTTTTCTCTGGG + Intronic
964460454 3:156919375-156919397 CTTGATAGTGACTCTGTTCTTGG + Intronic
965688527 3:171330876-171330898 CTTGGCATTTACTCTTCTTTGGG - Intronic
966033400 3:175378487-175378509 CTTGATAGTGATTGTTCACTTGG + Intronic
966856009 3:184194137-184194159 CTTGACAATGTCTCTTCTAGAGG - Intronic
967541371 3:190671779-190671801 GCAGACAGTGACTCATCTCTTGG + Intergenic
967686942 3:192428568-192428590 CTTGACAGTGACTCTTCTCTTGG + Intronic
969029978 4:4204090-4204112 CTTGACCCTGCCTCTCCTCTCGG + Intronic
970520175 4:16875597-16875619 CTAGATAGAGACTCTTCTATTGG - Intronic
971441384 4:26691245-26691267 CTTGAGATGGACTCTACTCTTGG + Intronic
972742267 4:41898687-41898709 CATGACACTGCCTCTTCTCATGG - Intergenic
973603040 4:52560748-52560770 CTGGACTGTGACTCTTCCCTAGG + Intergenic
974891549 4:67890208-67890230 CTTGACTGTATCTCTTTTCTTGG + Intergenic
979109488 4:116734069-116734091 CTGAACTGTGACTATTCTCTAGG - Intergenic
981933801 4:150217996-150218018 CTTGAAAGTGGCCCTTCGCTTGG + Intronic
984691401 4:182730633-182730655 CTTTCCATTGACTCTTTTCTCGG - Intronic
985241428 4:187934588-187934610 TTTGACAGTCACACTCCTCTAGG - Intergenic
985792350 5:1936764-1936786 ATTGACAGTTAATCTTCCCTTGG + Intergenic
986588651 5:9345973-9345995 CTTGAGGGTGATTCTTCTCCAGG - Intronic
987485137 5:18516898-18516920 CTTCACGGTGATTCTTCTATTGG + Intergenic
990807656 5:59684135-59684157 CTTGACATTGAGTTTTGTCTTGG - Intronic
993102211 5:83554419-83554441 CTTGCCAGTGACTCACCTCATGG + Intronic
994817886 5:104607849-104607871 AATGATAGTCACTCTTCTCTAGG + Intergenic
998232928 5:140372998-140373020 CTTGCCAGTTACTCTTCGCTAGG - Intronic
998378867 5:141709774-141709796 CTTCACATTGACACTTTTCTGGG - Intergenic
999492136 5:152061607-152061629 CTGGACAGTGTCTCTGCTGTGGG + Intergenic
1000440592 5:161258735-161258757 CCTGACAGTGGCTCTTTTTTTGG + Intergenic
1001833565 5:174810505-174810527 CCTCACATGGACTCTTCTCTGGG + Intergenic
1002578422 5:180192033-180192055 CTAGAGAGAGACTCTGCTCTTGG - Intronic
1002665286 5:180818876-180818898 CTTGGCTGGGACTCTTCTCTAGG - Intergenic
1003335656 6:5169672-5169694 TTTGAAAGTGATTCTTGTCTTGG + Intronic
1003641783 6:7881636-7881658 CTTGACAGTTGTGCTTCTCTAGG + Exonic
1003965761 6:11250672-11250694 CTTGACAATGACTGTTCCTTTGG + Intronic
1004675552 6:17838474-17838496 CTTTTCAGTGACTCGTCTTTGGG - Intronic
1005934458 6:30509574-30509596 CCTGACACTCAATCTTCTCTTGG + Intergenic
1006120480 6:31801831-31801853 CTTTAAAGTGACTTTTCTGTTGG - Intronic
1009315740 6:62217998-62218020 CTCCAGAGTCACTCTTCTCTGGG - Intronic
1009411485 6:63370225-63370247 CTTGTCAGTTACTCTGTTCTGGG - Intergenic
1013056412 6:106587591-106587613 CTAGCCAGTTTCTCTTCTCTTGG - Intronic
1013992700 6:116273355-116273377 CTTGATAGAAACTCTTCTATAGG + Intronic
1016410468 6:143777600-143777622 CATGACCATGACTCTGCTCTAGG - Intronic
1018317956 6:162575969-162575991 CTTGACTGTGCCTCTTCCCTTGG + Intronic
1021662505 7:22934423-22934445 CTTAACAGTAACTCTCTTCTTGG + Intergenic
1022599720 7:31746254-31746276 TTTGTCACTGATTCTTCTCTGGG - Intergenic
1024563197 7:50661565-50661587 CTTCACCGGCACTCTTCTCTAGG + Intronic
1025024786 7:55507323-55507345 CTTGCCTGTGACTCTTTTCTTGG + Intronic
1027867940 7:83672451-83672473 GCTGACAGTAGCTCTTCTCTAGG + Intergenic
1032433183 7:131879705-131879727 CTTGACAGTGTCTCCTCCCAAGG + Intergenic
1032659860 7:133970796-133970818 CTTGCCAGCCACCCTTCTCTTGG + Intronic
1033628715 7:143136127-143136149 ATCCACAGTGACTCTTCCCTGGG + Intronic
1034903672 7:154924852-154924874 CTTGCCAATGCCTCTTCTTTGGG - Intergenic
1035124812 7:156600928-156600950 CTGGCCAGGGACACTTCTCTTGG - Intergenic
1035400489 7:158562055-158562077 CCTGACAGAGAGACTTCTCTTGG - Intronic
1037753113 8:21695518-21695540 ATTGGCAGTGACTCTACTCTTGG - Intronic
1040420845 8:47239189-47239211 CCTGACACTGACTCTCCTCCTGG - Intergenic
1043054620 8:75422177-75422199 CTTTACAGTGTCTATTTTCTAGG + Intronic
1044845848 8:96380268-96380290 CTTGACAGTGAATTTGCTCAGGG + Intergenic
1045546135 8:103130372-103130394 CCTGACAGGTGCTCTTCTCTGGG + Intergenic
1046614342 8:116459695-116459717 TTTGACAGTGACTATCTTCTTGG - Intergenic
1046732136 8:117737202-117737224 CTTGATAGTTACTCTGCTCTAGG - Intergenic
1048043965 8:130756012-130756034 GTTGACAGAGACTGTTTTCTTGG + Intergenic
1051349270 9:16183846-16183868 ATAAACAGTGGCTCTTCTCTGGG - Intergenic
1051427379 9:16946453-16946475 CTTGAAAGAGAAACTTCTCTTGG - Intergenic
1051596512 9:18829675-18829697 CTTGACAGGGACTCCTCTATAGG + Intronic
1055274086 9:74594633-74594655 CTTAACAGTGATTGTTTTCTGGG + Intronic
1059496079 9:114710553-114710575 CTTGACACCTGCTCTTCTCTTGG + Intergenic
1060961230 9:127682201-127682223 ATTCATAGTGACTCTTCTCCTGG + Intronic
1061799296 9:133105383-133105405 CTGGTCAGTGTCTCTTCTCGGGG + Intronic
1189748432 X:44194021-44194043 CTTAGCAGTGGCTCTTCCCTGGG + Intronic
1191914799 X:66189916-66189938 CTCGAAAGTGACTGTTCACTTGG - Exonic
1193798277 X:85903714-85903736 CTTGACAGTGATTTTTTTCCTGG - Intronic
1197137018 X:123073216-123073238 CTGGACACTTACTCTTTTCTAGG + Intergenic
1197241279 X:124125715-124125737 CCTGACAGTGAATATTCCCTTGG - Intronic
1197795535 X:130293961-130293983 CTTGACCCTAGCTCTTCTCTTGG + Intergenic
1199538944 X:148936466-148936488 CTTCACCATGACACTTCTCTAGG + Intronic
1200896715 Y:8383679-8383701 CTTGATAATGACTCTTCTATGGG - Intergenic