ID: 967695238

View in Genome Browser
Species Human (GRCh38)
Location 3:192523550-192523572
Sequence TTTATTATCAGACTTGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 325}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967695238 Original CRISPR TTTATTATCAGACTTGGGTA GGG (reversed) Intronic
900731083 1:4260800-4260822 TTTGATATGAGATTTGGGTAGGG - Intergenic
901276694 1:7996988-7997010 TTCAATATGAGACTTGGGTGGGG + Intergenic
905501458 1:38442489-38442511 CTAATTATCAGAATTGAGTATGG + Intergenic
907615317 1:55918430-55918452 TTCATTATGAGAATTGGGCAGGG + Intergenic
907654192 1:56325511-56325533 TTCAATATGAGATTTGGGTAGGG + Intergenic
909341848 1:74541137-74541159 TTTATTATAAGAGCTGGGTTTGG + Intronic
909457989 1:75871324-75871346 TTTATGATGAGATTTGGGTGGGG + Intronic
911300512 1:96167116-96167138 CTTACTATCAGACATGGGAATGG - Intergenic
911846291 1:102755552-102755574 TTTAATATGAGATTTGGGTGGGG - Intergenic
911859977 1:102934124-102934146 TTAAGTATCAGACTTAGGCAAGG + Intronic
914907227 1:151756573-151756595 TTTATCATCAAAATTGGGCAAGG - Intergenic
915888069 1:159744772-159744794 CTTATGATTAGACTTGGGTAAGG - Intergenic
918448630 1:184638654-184638676 TTTATTATCCCACTAGGGGAAGG + Intergenic
918667374 1:187168316-187168338 TTTATTGTCAGAATAGGATATGG - Intergenic
918930875 1:190855569-190855591 TTTAATATGAGATTTGGGCAGGG - Intergenic
918969513 1:191396613-191396635 TTTAAGATGAGATTTGGGTAGGG - Intergenic
918969780 1:191398539-191398561 TTCAATATGAGATTTGGGTAGGG - Intergenic
919366741 1:196670374-196670396 TTTAAGATGAGATTTGGGTAGGG - Intronic
919573414 1:199276990-199277012 TTTAAGATGAGACTTGGGTGGGG - Intergenic
919720916 1:200834421-200834443 TTAATTTTCAAACTTGGGAATGG - Intronic
921668214 1:217898026-217898048 TTCATTATTAGACCTGGGGAAGG + Intergenic
922530684 1:226342692-226342714 TTCATTATGAGATTTGGGTGGGG - Intergenic
924413600 1:243833559-243833581 TTTAAGATGAGATTTGGGTAGGG + Intronic
1063812216 10:9724121-9724143 TTTAGTACCAGACTTGGCAATGG + Intergenic
1065078574 10:22105176-22105198 TTCAACATCAGACTTGGATACGG - Intergenic
1065277731 10:24102814-24102836 TTCAAGATGAGACTTGGGTAGGG - Intronic
1065613698 10:27499274-27499296 TGTGTAATCAGAGTTGGGTATGG + Intergenic
1067558730 10:47289677-47289699 TTTGTCATCAGAATTGGGCAGGG + Intergenic
1069111201 10:64449078-64449100 TTTTTTATAAGACTTGTGTAAGG + Intergenic
1071200099 10:83212264-83212286 TTTATTATGAGAATTGGCTCAGG + Intergenic
1071899628 10:90106483-90106505 TTCAATATGAGATTTGGGTAGGG - Intergenic
1073911098 10:108345714-108345736 TTTTTGATAAAACTTGGGTATGG - Intergenic
1074640675 10:115377154-115377176 TTTAAGATGAGATTTGGGTAGGG - Intronic
1075130830 10:119737712-119737734 TTAATTCTCAGAATTGGGTAAGG - Intronic
1075178544 10:120188445-120188467 TCTATTTTCAGATTTGGGTTTGG + Intergenic
1076943512 10:133626464-133626486 TTTATTTTGAGATTTGGGGATGG - Intronic
1077846800 11:6034055-6034077 TTGATTTTCTTACTTGGGTAGGG - Intergenic
1078713773 11:13819833-13819855 TTTATTATAAGACTGCAGTAGGG - Intergenic
1079147764 11:17868944-17868966 TTCAATATGAGATTTGGGTAGGG + Intronic
1079739295 11:24037084-24037106 TTCAAGATGAGACTTGGGTAGGG - Intergenic
1079925977 11:26491644-26491666 TTTATTATTACTCTTGGTTATGG + Intronic
1080066383 11:28020005-28020027 ATTATTTTCAGACTTGGCTCTGG + Intergenic
1080341655 11:31272285-31272307 TTCAATATGAGATTTGGGTAGGG + Intronic
1085814587 11:79724038-79724060 TTCAAGATGAGACTTGGGTAGGG - Intergenic
1086053206 11:82618364-82618386 TTCATTATGAGATTTGGGTGGGG - Intergenic
1086990402 11:93297205-93297227 TTTATTACCATACATGGGGAGGG - Intergenic
1088301576 11:108363525-108363547 TTTATTGTCACAATTGGGGATGG + Intronic
1090610053 11:128463076-128463098 TTTATCCTCAGAATTGGGCATGG + Intronic
1090615819 11:128513755-128513777 TTCAAAATCAGACTTGGGCAGGG + Intronic
1090985720 11:131764330-131764352 TTTTTTATCAGGCTTGGAGAGGG + Intronic
1091162745 11:133439765-133439787 TTTATTATAAGACTTAGGTTGGG - Intronic
1091234234 11:134009095-134009117 TTTGTTATCTGTCTTGGGTGTGG - Intergenic
1093022205 12:14214196-14214218 TTTTTTATCATATTGGGGTAAGG - Intergenic
1093845958 12:23971750-23971772 ATAATTAACAGACTTGGGAAGGG - Intergenic
1095087852 12:38077426-38077448 TGTATAATCAGAACTGGGTATGG - Intergenic
1096905322 12:54930332-54930354 TTAATTACCAGACTTAGGTCAGG - Intergenic
1096922941 12:55109176-55109198 TTTAAGATGAGATTTGGGTAGGG - Intergenic
1097976586 12:65692910-65692932 TTCATTATGAGATTTGGGTGGGG + Intergenic
1098154757 12:67586379-67586401 TTTATTATCATACTAGGTCAAGG - Intergenic
1099192938 12:79579093-79579115 TTTGATATGAGATTTGGGTAAGG + Intronic
1099215667 12:79850650-79850672 TTCAGTATCAGATTTGGGTGGGG - Intronic
1100041213 12:90320355-90320377 TTTATTATCTCATATGGGTAAGG + Intergenic
1100051803 12:90458844-90458866 TTTAAGATGAGATTTGGGTAGGG - Intergenic
1100649138 12:96565842-96565864 TTTAAGATGAGATTTGGGTAGGG - Intronic
1101488289 12:105188239-105188261 TTTATTTTCAGACTTTCTTATGG - Intronic
1104127145 12:125858614-125858636 TTAATTGTCTGACTTGGGCAAGG + Intergenic
1104210380 12:126683247-126683269 TTTGAGATGAGACTTGGGTAGGG + Intergenic
1104297500 12:127530243-127530265 TTCAACATGAGACTTGGGTAGGG + Intergenic
1106460880 13:29966853-29966875 TTTATTTTCCGATTTAGGTAAGG - Intergenic
1106956734 13:34947128-34947150 TTTATTCTCATGATTGGGTATGG + Intronic
1107800378 13:44101782-44101804 TTTATTATCTTACTTTGGCAGGG + Intergenic
1108380185 13:49847595-49847617 TTCATTTTCAGACTAGGTTAGGG + Intergenic
1108770811 13:53698835-53698857 TTTGAGATCAGATTTGGGTAGGG - Intergenic
1108968429 13:56341506-56341528 TTTAAGATGAGATTTGGGTAGGG + Intergenic
1109503290 13:63266822-63266844 TTCAATATGAGATTTGGGTAGGG + Intergenic
1109672373 13:65626040-65626062 TTCAAGATGAGACTTGGGTAGGG + Intergenic
1110188477 13:72702608-72702630 GTTATTGTCAGACTTGGAGAGGG + Intergenic
1110909108 13:80933058-80933080 TTCATTATCAGACTGGTGTATGG + Intergenic
1111051086 13:82883813-82883835 TTTAACATGAGATTTGGGTAGGG + Intergenic
1111087565 13:83396020-83396042 TTCATTATCAGACCTAGGCAGGG - Intergenic
1111971897 13:94925437-94925459 TTTAGTATCAGTCCTGGGTTGGG + Intergenic
1112106605 13:96247305-96247327 TTTGAGATGAGACTTGGGTAGGG - Intronic
1112162701 13:96885496-96885518 TTTAGTCTCAGACTTGGCAATGG + Intergenic
1112356927 13:98681406-98681428 GTTAATATCAGACTTGGTTGAGG + Intergenic
1112921571 13:104619662-104619684 TTTATTATCATAACTAGGTAAGG + Intergenic
1113264636 13:108604218-108604240 TTTAAGATGAGATTTGGGTAGGG + Intronic
1113290615 13:108901547-108901569 TATAATTTCAGACTTGCGTAGGG + Intronic
1114404090 14:22438746-22438768 TTGATTATCAGACTTGAAAAAGG - Intergenic
1114962478 14:27911113-27911135 TTCAATATGAGATTTGGGTAGGG - Intergenic
1115311352 14:31981795-31981817 TTAATGATGAGATTTGGGTAGGG - Intergenic
1116164284 14:41312677-41312699 TTTAAGATCAGATTTGGGTGGGG - Intergenic
1116339884 14:43709063-43709085 TTTAAGATGAGATTTGGGTAGGG - Intergenic
1116464883 14:45220383-45220405 TTTGATATGAGTCTTGGGTAGGG - Intronic
1117304454 14:54459979-54460001 TTTAATATGAGATTTGGGTGGGG - Intergenic
1117709360 14:58508836-58508858 TTTATATTCAGACTTGAGTTAGG - Intronic
1119143465 14:72288897-72288919 TTGATTCTAAGACTTAGGTAAGG + Intronic
1119252210 14:73166167-73166189 CTCATTATCAGCCTTGGGCAGGG + Intronic
1120152247 14:81049668-81049690 TTCAAGATGAGACTTGGGTAGGG - Intronic
1120693937 14:87622861-87622883 TTCAACATCAGATTTGGGTAGGG + Intergenic
1121813168 14:96909152-96909174 TTTAAGATGAGATTTGGGTAGGG + Intronic
1122674141 14:103396503-103396525 TTTATAACCAGACTTGGATTAGG + Intronic
1123810548 15:23921213-23921235 GTTAATACCAGACTTGGGCAGGG - Intergenic
1125080949 15:35672395-35672417 TTTTTTTTCAGATTTGGGTTAGG + Intergenic
1125226903 15:37405686-37405708 TTGAACATCAGATTTGGGTAGGG + Intergenic
1126523155 15:49620128-49620150 TTCTTTTTCGGACTTGGGTAAGG - Intronic
1126562783 15:50062137-50062159 TTCAATATGAGACTTGGGTGGGG - Intronic
1127345854 15:58097083-58097105 TTTAAGATGAGATTTGGGTAGGG + Intronic
1133239003 16:4403697-4403719 TTTACTATCACAGTTGTGTAGGG - Intronic
1133776704 16:8902083-8902105 ATCTTTATCAAACTTGGGTAAGG + Exonic
1133993490 16:10728885-10728907 TTTATTATATGTCTTGGGTCAGG + Intergenic
1134827415 16:17295724-17295746 TTTGTTGTCACACTTGGGGAAGG + Intronic
1137803248 16:51280143-51280165 TTTATTACCAAACTTGTGCAAGG - Intergenic
1137843561 16:51664705-51664727 TTTAATATGAGATTTGGGTGGGG - Intergenic
1138848103 16:60591764-60591786 TTTAAGATGAGACTTGGGTGGGG + Intergenic
1139175698 16:64684517-64684539 TTCAATATGAGATTTGGGTAGGG + Intergenic
1139808079 16:69586939-69586961 TGTATTATTAGACATTGGTAGGG + Intronic
1140790083 16:78383170-78383192 TTTAATATGAGATTTGGGTAGGG + Intronic
1141003171 16:80326999-80327021 TTAATTATCACAATTGGGGAAGG - Intergenic
1143624873 17:8103992-8104014 TTTATGATTAGACTTGGGGTTGG - Intronic
1144232105 17:13217912-13217934 TTTATTACCTGGCTAGGGTAAGG - Intergenic
1146035375 17:29401603-29401625 TTTAACATGAGATTTGGGTAGGG + Intronic
1146706340 17:35003264-35003286 TTTCTTGTCAGTCTTGGGTTTGG + Intronic
1149069798 17:52526458-52526480 TTTATGATGAGATTTGGGTGGGG - Intergenic
1149336898 17:55644716-55644738 TTCACTGTGAGACTTGGGTAAGG - Intergenic
1149862976 17:60134419-60134441 TTTAAGATGAGACTTGGGTGGGG + Intergenic
1151052347 17:70992714-70992736 TTCAAGATGAGACTTGGGTAGGG - Intergenic
1151058393 17:71060803-71060825 TTCATGATGAGATTTGGGTAGGG - Intergenic
1155479356 18:26268576-26268598 TTTATCATCACAATTGGGCAAGG + Intronic
1156969447 18:43137399-43137421 TTCATGATGAGATTTGGGTAGGG - Intergenic
1157232554 18:45932305-45932327 TTTATCATCAGATTTGCTTATGG + Intronic
1158194540 18:54869377-54869399 TTTATAATCAGTGTTGGGAAAGG - Intronic
1158644325 18:59231135-59231157 TTTACTATGTGACTTGGGCAAGG - Intergenic
1158766587 18:60457558-60457580 TTCAAGATGAGACTTGGGTAGGG + Intergenic
1158984918 18:62804307-62804329 TTTATGATGAGATTTGGGTGGGG + Intronic
1159459250 18:68702706-68702728 TTTGTTATCACACTTGGGTAAGG + Intronic
1160292130 18:77604345-77604367 TTTAAGATCAGATTTGGGTGGGG + Intergenic
1162837578 19:13331119-13331141 TTTATTATCTTAGTTGGGGAGGG - Intronic
1163776832 19:19223916-19223938 ATTATTATCAGACAGGGGTGGGG + Intronic
1163937757 19:20465339-20465361 TTTATTTACACGCTTGGGTAAGG - Intergenic
1165087693 19:33362669-33362691 TTTACCATCAAACTTGGGCAGGG - Intergenic
1168031864 19:53686607-53686629 CTTATCATCAGACTTGGATGAGG + Intergenic
1168521136 19:57051397-57051419 TTTGAGATGAGACTTGGGTAGGG - Intergenic
925244559 2:2369518-2369540 TTCAATATGAGATTTGGGTAGGG - Intergenic
925371768 2:3350448-3350470 TTTAACATGAGATTTGGGTATGG + Intronic
929466458 2:42149089-42149111 TTTAATATAAGATTTGGGTGGGG + Intergenic
930948789 2:57111253-57111275 TTTAAGATGAGATTTGGGTAGGG - Intergenic
931033385 2:58210453-58210475 TTCAAGATGAGACTTGGGTAGGG + Intronic
932244114 2:70181928-70181950 TTTCTTATCTGATTTGGGGAAGG - Exonic
933606806 2:84391865-84391887 TTTAAGATGAGATTTGGGTAGGG - Intergenic
934030287 2:88038901-88038923 TTCATTATGAGATTTGGGTGGGG + Intronic
934032113 2:88057224-88057246 TTTATTATCACACATAGGCATGG + Intergenic
936920172 2:117680474-117680496 TTTATTATCTTATATGGGTATGG - Intergenic
937165865 2:119816482-119816504 TTTTTCATCGGACTTGGGTGTGG + Intronic
937726839 2:125176531-125176553 TTTAATATGAGATTTGGGCAGGG - Intergenic
938544250 2:132313611-132313633 TTCAAGATGAGACTTGGGTAGGG - Intergenic
938564540 2:132506783-132506805 TTCAAGATGAGACTTGGGTAGGG + Intronic
940489928 2:154346392-154346414 TTCAAGATGAGACTTGGGTAGGG - Intronic
943068879 2:183118108-183118130 TTGATTATCAAACTTAGGTGGGG - Intronic
943144065 2:184019129-184019151 TTTAAGATGAGAATTGGGTAGGG - Intergenic
943375439 2:187071029-187071051 TTTATTGTCACACCTGGGTGGGG - Intergenic
943957751 2:194214680-194214702 TTCAATATCAGATTTGGGTGGGG - Intergenic
945609974 2:211988087-211988109 TTTATTATCAGGCTTGATTAAGG + Intronic
946683605 2:222244158-222244180 TTTATCACCAGCCTTAGGTAGGG + Intronic
947024378 2:225720487-225720509 TTTATTATAAGAATTGGTTCAGG + Intergenic
947544049 2:230998425-230998447 TTCATTAAAAGACTTGGGAATGG - Intronic
1169060516 20:2657510-2657532 CTTATTATCAGACGTGTGTCCGG + Intronic
1169643266 20:7778954-7778976 TTCATTATGAGATTTGGGTGGGG - Intergenic
1170872168 20:20216106-20216128 TTTATTATCAGTCATCGGTTTGG - Intronic
1171873113 20:30546348-30546370 TTCAAGATGAGACTTGGGTAGGG - Intergenic
1172382852 20:34511403-34511425 TTTTCTATCAGTCTTGGGTAAGG + Intergenic
1175251436 20:57612398-57612420 TAAATAATCAGACATGGGTATGG + Intronic
1176421271 21:6518105-6518127 TTCAATATCAGATTTGGGTGAGG - Intergenic
1176937005 21:14878824-14878846 TTTAATATGAGATTTGGGTGGGG + Intergenic
1177416514 21:20800336-20800358 TTTATGATGAGATTTGGGTGAGG - Intergenic
1177501112 21:21956273-21956295 TTCAATATGAGACTTGGGTGGGG - Intergenic
1177547847 21:22581920-22581942 TTTTTTCTCATTCTTGGGTATGG - Intergenic
1177681980 21:24383299-24383321 TTCAAGATGAGACTTGGGTAGGG + Intergenic
1177769983 21:25503650-25503672 TTCATGATGAGATTTGGGTAGGG - Intergenic
1178073791 21:28997085-28997107 TTTAACATCAGACTTCTGTAAGG - Intergenic
1179308777 21:40178689-40178711 TTTCTTTTAAGTCTTGGGTATGG + Intronic
1179696761 21:43126420-43126442 TTCAATATCAGATTTGGGTGAGG - Intergenic
1180028473 21:45183605-45183627 TTTATTTTTAGACTTGGATGTGG + Intronic
1181617829 22:24066891-24066913 GTTTTTATCAGACTTGGATGAGG - Intronic
1181921358 22:26322944-26322966 TTTATTTTGAGAGTTGGGGAAGG - Intronic
1183285164 22:36957688-36957710 TTCAATATGAGACTTGGGTGGGG + Intergenic
1183850185 22:40579159-40579181 TAAATTAGCAGACTTGGCTATGG - Intronic
1184333030 22:43837942-43837964 TGTATTTTCAGCCTTGGGTAGGG + Intronic
951140966 3:19159420-19159442 TATATTATTTGACTTTGGTAAGG + Intronic
951333463 3:21393011-21393033 GTTATTATAAGAATTGGGTGAGG + Intergenic
952080665 3:29753701-29753723 TTTATTATTAGACTCAGTTATGG + Intronic
952280433 3:31917824-31917846 TTTGTTATCAGCCTTAGTTAAGG + Intronic
952728634 3:36616201-36616223 TTTATTTTCAGAGCTGGGTTTGG - Intergenic
952946099 3:38478703-38478725 TTTATCATAGGACTAGGGTAGGG + Intronic
954158178 3:48699626-48699648 TTTCTTATCAGACTTGGCTCAGG - Intronic
955557671 3:60155479-60155501 GTTATTGTCAGAATTGGGGAAGG - Intronic
956187819 3:66579250-66579272 TTCAAGATGAGACTTGGGTAGGG + Intergenic
956789635 3:72670606-72670628 TTTATTAACAGACTCAGGGATGG + Intergenic
957084123 3:75664638-75664660 TTTATTTTGAGATTTGGGGATGG + Intronic
957279262 3:78128519-78128541 TTTAACATGAGACTTGGGTGGGG + Intergenic
957692855 3:83595111-83595133 TTCACTATGAGATTTGGGTAGGG - Intergenic
958137601 3:89516203-89516225 TTTATTATTAGTGTTGGGTTTGG + Intergenic
958831409 3:99094701-99094723 TTTATTTTCATACTAGGGTTGGG + Intergenic
958836713 3:99155177-99155199 TTCATTATGAGATTTGGGTGGGG + Intergenic
962718908 3:138153955-138153977 TTTAAGATGAGATTTGGGTAGGG + Intergenic
962955384 3:140261500-140261522 TTTATTCTAAGACTTGGGTAGGG - Intronic
964989275 3:162786206-162786228 TTCAAGATGAGACTTGGGTAGGG + Intergenic
965264811 3:166529462-166529484 TTTAAGATGAGATTTGGGTAGGG + Intergenic
966039198 3:175460283-175460305 TTTATTTTCAGATGTGAGTATGG + Intronic
967352709 3:188531828-188531850 CATATTATCAAACTTGGGAAGGG + Intronic
967611075 3:191506682-191506704 TTCATGATGAGATTTGGGTAGGG + Intergenic
967695238 3:192523550-192523572 TTTATTATCAGACTTGGGTAGGG - Intronic
971544275 4:27865607-27865629 TTTATGATCTGATTTGGGGATGG - Intergenic
971977712 4:33711453-33711475 TTCATTATGAGATTTGGGTGAGG + Intergenic
972020363 4:34305570-34305592 TTTAGCATGAGATTTGGGTAGGG + Intergenic
972074263 4:35064744-35064766 TGAACTATCAGACTTGGGTTCGG + Intergenic
972124042 4:35741162-35741184 TTTAAGATGAGACTTGGGTTGGG - Intergenic
972135260 4:35885322-35885344 TTTATTATGAAATTTGGGTGGGG - Intergenic
974154745 4:58056332-58056354 TTTAATATGAGATTTGGGTGGGG + Intergenic
974164053 4:58177960-58177982 TTTAACATGAGATTTGGGTAGGG - Intergenic
975767127 4:77680802-77680824 TTTCTTATGAGACTTTAGTAGGG - Intergenic
976194239 4:82517790-82517812 TTTATTATGAGAATTGGCTTAGG - Intronic
976693319 4:87892153-87892175 TTTAGTACCAGACTTGGCAATGG - Intergenic
976959401 4:90949956-90949978 TTTATTGTCAGACTAACGTAAGG - Intronic
977014779 4:91678709-91678731 TTTAAGATAAGATTTGGGTAGGG - Intergenic
978262337 4:106774453-106774475 TTCAAGATCAGACTTGGGTTGGG - Intergenic
978323637 4:107525784-107525806 TTTAAGATAAGATTTGGGTAGGG + Intergenic
979027878 4:115599559-115599581 TTAAATACCAGATTTGGGTAAGG - Intergenic
979102884 4:116644887-116644909 TTCAATATGAGACTTGGGTGGGG - Intergenic
979780832 4:124650135-124650157 TTTATTAACATACTTCTGTAGGG - Intergenic
979948964 4:126867721-126867743 TTCAATATGAGACTTGGGTAGGG - Intergenic
980273886 4:130623013-130623035 TTCAATATGAGACTTGGGTGAGG - Intergenic
980606974 4:135105184-135105206 TTTAAGATGAGATTTGGGTAGGG - Intergenic
980849634 4:138365484-138365506 CTCATGATTAGACTTGGGTATGG + Intergenic
981141370 4:141273173-141273195 TTTATTAGCACAAGTGGGTAGGG + Intergenic
981771476 4:148314396-148314418 TTTATTATCAGTCATCGGAAAGG + Intronic
983110089 4:163738930-163738952 CTTCTTTTCAGTCTTGGGTATGG - Intronic
983164947 4:164463957-164463979 TTTATTCACAGATTTGGTTATGG - Intergenic
983530576 4:168805939-168805961 TTTGATATGAGATTTGGGTAGGG - Intronic
984338430 4:178422137-178422159 TTTGATATGAGATTTGGGTAGGG - Intergenic
985446868 4:190026926-190026948 TTTATTTTGAGATTTGGGGATGG - Intronic
988322261 5:29713513-29713535 TTTAAGATCAGATTTGGGTGGGG + Intergenic
988366619 5:30309195-30309217 TTTGATATGAGACTTGGGCAGGG - Intergenic
990031304 5:51262607-51262629 TTTATAATGAGATTTGGGTGAGG - Intergenic
990632941 5:57690951-57690973 TTTTTTATCAGCCTAAGGTATGG + Intergenic
990830511 5:59951976-59951998 TTTAAGATGAGATTTGGGTAGGG - Intronic
992517696 5:77512110-77512132 TTTATTAGCTTACTTGTGTATGG + Intronic
993442308 5:87972579-87972601 TTCAAGATGAGACTTGGGTAGGG + Intergenic
994557466 5:101321861-101321883 TTTAACATCAGACTTGGCTGAGG - Intergenic
995731792 5:115251868-115251890 TTGATTATTAGACTGAGGTATGG - Intronic
997707226 5:135967743-135967765 TTTATTATTATATTTGTGTATGG + Intergenic
998973417 5:147617530-147617552 ATTATTATCAGGCTTGTTTACGG + Intronic
999026430 5:148237046-148237068 TTCAATATGAGATTTGGGTAGGG + Intergenic
1000518612 5:162271920-162271942 TTTATCATCAGAGATGGGAATGG - Intergenic
1000575261 5:162968600-162968622 TTTATGATGAGATTTGGGTGAGG - Intergenic
1002946683 6:1768000-1768022 TTTATTATGAAACTAGGGTTTGG - Intronic
1003880248 6:10474020-10474042 TTTAAGATGAGATTTGGGTAGGG - Intergenic
1004379821 6:15122999-15123021 TTTCTTCCCAGTCTTGGGTATGG + Intergenic
1005776288 6:29134805-29134827 TTTAATATCAGCCTTGGTTCTGG + Intergenic
1006476650 6:34259779-34259801 TTTCTTCCCAGTCTTGGGTATGG - Intergenic
1006966944 6:37997061-37997083 TTTATTATGTGAATTAGGTAGGG + Intronic
1007780372 6:44249540-44249562 TTTAGTACCAGACTTGGCAATGG - Exonic
1008705337 6:54151609-54151631 CTCATTATAATACTTGGGTAGGG + Intronic
1009732837 6:67633097-67633119 TTCAATATGAGATTTGGGTAGGG - Intergenic
1011344864 6:86358195-86358217 ATTCTTATCCGGCTTGGGTAAGG + Intergenic
1011885951 6:92096113-92096135 TTTAAGATGAGACTTGGGTAGGG - Intergenic
1011933250 6:92739791-92739813 TTTAAGATGAGATTTGGGTAAGG + Intergenic
1012389636 6:98723023-98723045 TTTAATCTCACACTGGGGTAGGG - Intergenic
1013566457 6:111369105-111369127 CTTAGTATTAGAGTTGGGTATGG - Intronic
1013987264 6:116209994-116210016 GTTAGTAACAAACTTGGGTATGG - Intronic
1014407306 6:121067958-121067980 TTTATGATGAGATTTGGGTGGGG - Intergenic
1014518617 6:122410063-122410085 TTTATAATCTGTATTGGGTAGGG + Intronic
1014613955 6:123579704-123579726 TTTAAGATGAGATTTGGGTAGGG - Intronic
1014632766 6:123806816-123806838 TTTATTATGTGACTTGATTAAGG + Intronic
1014832159 6:126115546-126115568 AATATTTTCAGACTTGGGCAGGG - Intergenic
1015050816 6:128837443-128837465 TTTAACATGAGATTTGGGTAAGG - Intergenic
1016168604 6:140978997-140979019 TTCAAGATGAGACTTGGGTAGGG + Intergenic
1016337328 6:143021185-143021207 TTCAATATGAGATTTGGGTAAGG + Intergenic
1017985396 6:159439011-159439033 TTTAACATGAGACTTGGGCAGGG + Intergenic
1019605751 7:1909441-1909463 TTTATTAGCAGCCATGGGCATGG + Intronic
1022607957 7:31834886-31834908 TTTAAGATGAGATTTGGGTAGGG - Intronic
1023019302 7:35996127-35996149 TTTATTATTAGACTTGAGGATGG + Intergenic
1024754873 7:52518063-52518085 TTTAACATGAGATTTGGGTATGG + Intergenic
1026419596 7:70220382-70220404 TTTAGTATCAGACGTGTGTTAGG + Intronic
1026546754 7:71329808-71329830 TTCAATATGAGATTTGGGTAAGG + Intronic
1028011221 7:85647763-85647785 TTTATTCCCAGTCTTGGGTATGG - Intergenic
1030543687 7:110866100-110866122 TTTATGATCAGGCTTTGCTATGG - Intronic
1030570868 7:111222010-111222032 TTTGTAATTAGTCTTGGGTAGGG - Intronic
1031293294 7:119967209-119967231 TTAAATATGAGACTTGGGTGGGG - Intergenic
1031760228 7:125705067-125705089 TTTAATAGAAGATTTGGGTAAGG - Intergenic
1031762692 7:125734344-125734366 TTTAATATGAGATTTGGGTAGGG + Intergenic
1031839963 7:126726006-126726028 TTCAACATCAGATTTGGGTAGGG + Intronic
1033363213 7:140652534-140652556 TTTATTGTCATAATTGGGAAAGG + Intronic
1033720940 7:144059053-144059075 TTCATGATGAGACTTGGGTGGGG + Intergenic
1035261484 7:157664353-157664375 TTCATTATCAGACTTCTGTGGGG + Intronic
1035893822 8:3374856-3374878 TTTATTAGAAGACTTTGGCAGGG - Intronic
1036566302 8:9941216-9941238 TTCATGATGAGATTTGGGTAGGG - Intergenic
1037153654 8:15672558-15672580 TTTATCATAATACTTGGGAATGG - Intronic
1038157354 8:25002236-25002258 ATTATTTACAGAATTGGGTAGGG + Intergenic
1040077969 8:43259471-43259493 TTTGACATGAGACTTGGGTAGGG + Intergenic
1041825818 8:62095452-62095474 TTTAAGATGAGACTTGGGTCAGG + Intergenic
1042086024 8:65109927-65109949 TTTAAGATGAGATTTGGGTAGGG - Intergenic
1042312810 8:67395829-67395851 TTTAAGATGAGATTTGGGTAGGG - Intergenic
1042776082 8:72432737-72432759 TTTATGATGAGATTTGGGTGGGG + Intergenic
1043062347 8:75519701-75519723 TTTAATATGAGATTTGGGTAGGG + Intronic
1046159682 8:110344256-110344278 TTAATTTTTAGACTTGGGCAGGG + Intergenic
1047545771 8:125814564-125814586 TTCAATATGAGACTTGGGTGGGG - Intergenic
1048150243 8:131886784-131886806 TTTATTATAAGACTTTTGTGGGG + Intergenic
1048867493 8:138771480-138771502 TAAATTATCAGACTTGGAAAGGG - Intronic
1050016581 9:1240349-1240371 TTTATTATCTGAGTTGGGCAGGG + Intergenic
1050604863 9:7290257-7290279 TTTATCCTCAGAGCTGGGTATGG + Intergenic
1051415187 9:16832543-16832565 TTTATTATAGAACTTGGGTTCGG - Intronic
1055848444 9:80595199-80595221 TTTAAGATCAGATTTGGGTGGGG - Intergenic
1055886056 9:81064085-81064107 TTCATTATGAGATTTGGGTGGGG - Intergenic
1056504091 9:87240385-87240407 TTTCCTATCACTCTTGGGTAAGG + Intergenic
1058848406 9:108985979-108986001 TATTTTCCCAGACTTGGGTAAGG + Intronic
1059498316 9:114728870-114728892 TTTAAGATGAGATTTGGGTAGGG + Intergenic
1186830966 X:13389939-13389961 TTCAATATGAGACTTGGGCAGGG - Intergenic
1186860351 X:13666770-13666792 TTTATTATGGGCCATGGGTAGGG - Intronic
1188124706 X:26352788-26352810 TTTAAGATGAGATTTGGGTAGGG + Intergenic
1188573235 X:31614908-31614930 TTTATTATCAGAATTATGAAAGG + Intronic
1188621123 X:32225544-32225566 TTTAATATGAGATTTGGGTGGGG - Intronic
1188662530 X:32776703-32776725 TTTGAGATGAGACTTGGGTAGGG + Intronic
1188764074 X:34068962-34068984 ATTAATATCAGACTTGACTAGGG + Intergenic
1188823795 X:34805313-34805335 TTTATTTTAAGATTTGGATATGG + Intergenic
1189025530 X:37389733-37389755 TTGAATATGAGATTTGGGTAGGG + Intronic
1192967486 X:76194867-76194889 TTTATGATGAGATTTGGGTGGGG + Intergenic
1193332793 X:80254861-80254883 TTCAATATGAGACTTGGGTGGGG - Intergenic
1193501218 X:82276993-82277015 TTGAATATAAGATTTGGGTAGGG + Intergenic
1193547407 X:82846740-82846762 TTGAATATGAGATTTGGGTAGGG - Intergenic
1193781362 X:85705795-85705817 TTTATACTCAAACTAGGGTAAGG + Intergenic
1194358936 X:92922941-92922963 CTTATTTTCAGACTTGGCTCTGG + Intergenic
1194448864 X:94017595-94017617 TTTAAGATGAGACTTGGGTGGGG - Intergenic
1194453653 X:94076593-94076615 TTTGATATGAGATTTGGGTATGG - Intergenic
1194505509 X:94729335-94729357 TTTAAAATGAGATTTGGGTATGG + Intergenic
1194522580 X:94936561-94936583 TTAAATATGAGATTTGGGTAGGG - Intergenic
1194543927 X:95208098-95208120 TTCAATATGAGATTTGGGTAGGG + Intergenic
1196109026 X:111926371-111926393 TTAATTGTCAGACATGGCTAGGG - Intronic
1196664714 X:118304411-118304433 TTCATGATGAGATTTGGGTAGGG + Intergenic
1197441145 X:126493247-126493269 TTTATGGTGAGATTTGGGTAGGG - Intergenic
1197800488 X:130342663-130342685 TTTACTATCAGATGGGGGTAGGG + Intronic
1197865070 X:131008988-131009010 TTTATGATGAGATTTGGGTGGGG - Intergenic
1198026165 X:132709483-132709505 TTTATTATCAGTCTCTGGTGCGG + Intronic
1198641850 X:138764814-138764836 TTTATTTTTAGACTTTTGTAAGG + Intronic
1200791307 Y:7301955-7301977 TTTAAGATTAGACTTGGGTGGGG + Intergenic
1200944983 Y:8825837-8825859 TTTAAGATGAGATTTGGGTAGGG + Intergenic