ID: 967696733

View in Genome Browser
Species Human (GRCh38)
Location 3:192541677-192541699
Sequence AAGAACTCCCTTACATTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 1, 2: 2, 3: 10, 4: 216}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967696732_967696733 25 Left 967696732 3:192541629-192541651 CCTTCAGATGATTTTTTTTGCTC 0: 1
1: 5
2: 11
3: 57
4: 543
Right 967696733 3:192541677-192541699 AAGAACTCCCTTACATTTCTTGG 0: 1
1: 1
2: 2
3: 10
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967696733 Original CRISPR AAGAACTCCCTTACATTTCT TGG Intronic
902779408 1:18694776-18694798 ACTAAGACCCTTACATTTCTGGG + Intronic
905459029 1:38109489-38109511 AAAAATTCCCTTAAATATCTGGG - Intergenic
905481054 1:38262224-38262246 AAGCCTTCCCTTACATTTCATGG - Intergenic
907529640 1:55081736-55081758 AAGAACTCACTCACATTACGCGG - Intronic
907596505 1:55725301-55725323 AAGAAGTCCCTGCCTTTTCTGGG + Intergenic
908034186 1:60034177-60034199 AATTACTCCCAAACATTTCTGGG - Intronic
909506362 1:76395141-76395163 ATGACCTCCTTTACATTTTTTGG - Intronic
911383667 1:97147438-97147460 AAAGAATCCCTTACATTTGTTGG + Intronic
914782240 1:150796012-150796034 AAGAACTGTACTACATTTCTGGG - Intergenic
918840249 1:189526576-189526598 CAAAACTCCCTAACATTTTTTGG - Intergenic
919083769 1:192896009-192896031 AAGAACTCCCTTTCATATTGTGG - Intergenic
919791772 1:201295844-201295866 AAGAGTTCCTTTACAGTTCTTGG - Intronic
922073181 1:222216507-222216529 AAGAACTCCCTTACATTTCCAGG + Intergenic
924849788 1:247815449-247815471 AACAACTCCATTTCATTCCTTGG - Exonic
1064715337 10:18171234-18171256 AAGAATAACCCTACATTTCTTGG - Intronic
1065200773 10:23310862-23310884 AAGATCTCTCTTATATTTCCTGG + Intronic
1065760032 10:28973733-28973755 AAGGACTCCGTTACATAGCTCGG + Intergenic
1066351202 10:34638676-34638698 AAGTACTGCTTTCCATTTCTGGG + Intronic
1068259961 10:54566945-54566967 AAGAAGTCCCATCCATTGCTGGG - Intronic
1068975820 10:63007958-63007980 AAGAACTTCTTTCCATCTCTTGG - Intergenic
1069092286 10:64215082-64215104 AACAACTTCCTTACCTTTCAGGG - Intergenic
1069272337 10:66544803-66544825 AAGAACTTTCTTGCATTTCATGG + Intronic
1070080630 10:73182946-73182968 AGGCACTCTCTTACCTTTCTTGG + Intronic
1070329916 10:75409445-75409467 CAGCCCTCCCTTCCATTTCTCGG - Intergenic
1075995458 10:126873186-126873208 AAGAAATCCCTTACATTCATGGG - Intergenic
1076517257 10:131053517-131053539 AAGAATCCCCTTCCCTTTCTAGG + Intergenic
1077084811 11:744210-744232 AAAAACTACCTTCCACTTCTAGG + Intergenic
1078677677 11:13439039-13439061 AAGAACTTCCTGACACTTCAAGG + Intronic
1082916043 11:58438590-58438612 AAAAGCTCCCATACATTCCTGGG + Intergenic
1082984980 11:59160776-59160798 TAGAGCTCACTCACATTTCTTGG - Intergenic
1085830101 11:79890911-79890933 AAGCACTCGCTTACAATTTTGGG - Intergenic
1089149509 11:116354039-116354061 AATGACTCCTTTACATCTCTGGG + Intergenic
1090823484 11:130366303-130366325 CAGAACACCTTTTCATTTCTAGG - Intergenic
1092100241 12:5877404-5877426 AACAACTACCTCAAATTTCTTGG - Intronic
1093280406 12:17188412-17188434 CAAAACAACCTTACATTTCTGGG + Intergenic
1093861661 12:24173967-24173989 AAAAGCACCCTTAGATTTCTGGG - Intergenic
1094439672 12:30461011-30461033 AAGAAATCACTGACATATCTCGG - Intergenic
1097569051 12:61308337-61308359 AAGAAGTCACTTTCATTGCTGGG + Intergenic
1097691171 12:62735898-62735920 GAGAACTACCTTCCATTTCCAGG - Intronic
1097943817 12:65344238-65344260 AAGTACTCCTTTAAAATTCTGGG + Intronic
1099013406 12:77318713-77318735 AACAACTTAATTACATTTCTGGG + Intergenic
1099569419 12:84297069-84297091 ATGAAGTCACTTACAGTTCTAGG + Intergenic
1101869646 12:108554423-108554445 AAAAACACCCTTGCATTCCTGGG - Intronic
1107391169 13:39965790-39965812 AACAACTCCCTTGCAATTTTTGG + Intergenic
1107398699 13:40047607-40047629 AAGAAATCCCACACACTTCTTGG - Intergenic
1107727524 13:43314332-43314354 AAGTACTTCCTTCCCTTTCTTGG - Intronic
1107776637 13:43850959-43850981 AAGAAATACCTTACATATATAGG + Intronic
1107842857 13:44477452-44477474 AATGGCTCCCTTTCATTTCTGGG + Intronic
1111163475 13:84425867-84425889 AAGAAATCACTTAAATTTCTTGG + Intergenic
1111468066 13:88643614-88643636 AAAAAAGCCGTTACATTTCTGGG + Intergenic
1114661724 14:24350471-24350493 ACTAACTCCCTTGCACTTCTTGG + Intergenic
1115314056 14:32007956-32007978 GTGAACTCCCTGACAGTTCTAGG + Intronic
1116287740 14:42994066-42994088 AGGAACTGACTTACATTCCTAGG - Intergenic
1118448406 14:65873413-65873435 AAGAACCTCCTTACTTTTCATGG - Intergenic
1119012217 14:71005077-71005099 AAGAGGTCTCTTAAATTTCTTGG - Intronic
1120159460 14:81130054-81130076 AAGAACTACCTTGCCTTTCTTGG + Intronic
1122183735 14:99973244-99973266 AAGAACTCTCACACATTTTTTGG - Intronic
1124955963 15:34360441-34360463 AGGGATTCCCTTACATTCCTAGG - Intronic
1126124373 15:45282199-45282221 ATGAACTCTCTCACACTTCTGGG - Intergenic
1127518077 15:59715461-59715483 AAGAACTCAGTATCATTTCTAGG - Intergenic
1128475898 15:67996639-67996661 AACAACTCCCTTCTATTTCCTGG + Intergenic
1130572550 15:85060985-85061007 ATGAACTCCCTTAGTTTTTTTGG + Intronic
1131309741 15:91278863-91278885 AAGAACTCTATTTCATTTCATGG + Intronic
1131330089 15:91489786-91489808 AGGAACTCCCATTCATTGCTGGG - Intergenic
1131823665 15:96298068-96298090 GAGAACTCTCTTTCAATTCTTGG - Intergenic
1133258034 16:4530291-4530313 AAGAATTCACTTACATTGGTTGG + Intronic
1133955922 16:10443837-10443859 AAGAACTGGGTTACATTGCTAGG + Intronic
1136738262 16:32484289-32484311 ATGAACTCCCTAATATTCCTTGG - Intergenic
1138699673 16:58849088-58849110 ATAGACTCCCTCACATTTCTGGG + Intergenic
1140171846 16:72612890-72612912 ACAAACTCCTTTACATTTATAGG + Intergenic
1140436321 16:74950014-74950036 AAGCACTCCATTTCTTTTCTGGG - Intronic
1140628627 16:76824810-76824832 ACAAACTCCTTTTCATTTCTTGG + Intergenic
1140922876 16:79554970-79554992 CTGAACTCACTCACATTTCTGGG - Intergenic
1143758110 17:9081230-9081252 AAAAATTCCCTCACACTTCTTGG + Intronic
1144036819 17:11374013-11374035 AAGAACTCATGTACCTTTCTGGG - Intronic
1144144077 17:12380534-12380556 GAGAACCCCCTTCCCTTTCTAGG + Intergenic
1144159857 17:12547215-12547237 AAGCACTGCCTTCCATTTGTGGG - Intergenic
1145829329 17:27902589-27902611 AATAACTCCCATCCATTTCCTGG - Intergenic
1146599046 17:34196980-34197002 CAAAACATCCTTACATTTCTAGG - Intergenic
1146635201 17:34498937-34498959 AAGGTATCCCTCACATTTCTAGG - Intergenic
1154336155 18:13466616-13466638 AAGAAGTTCCTTCTATTTCTAGG - Intronic
1156511288 18:37639067-37639089 ATGATCTCACTTACATGTCTAGG + Intergenic
1157096163 18:44687303-44687325 AAGAAATCCTTAACATTCCTAGG - Intronic
1158295084 18:55987482-55987504 AAAAAACCCTTTACATTTCTGGG + Intergenic
1163943390 19:20515055-20515077 AAGAACTCCCTTACTATCTTCGG - Intergenic
1165182789 19:33987286-33987308 AAGAACTACCTAAGATTCCTGGG + Intergenic
1165562649 19:36693519-36693541 CAAAACTTCCTTACATTTCATGG + Intronic
1167031791 19:46967134-46967156 AAGGACTCCCTTACAATTCTAGG - Intronic
925710037 2:6730240-6730262 AAGAACTGCCTTGGACTTCTGGG + Intergenic
927506238 2:23616673-23616695 AAGATCTCTCTTACAGTTCATGG - Intronic
928697232 2:33861656-33861678 CAGCACTCCCTGGCATTTCTTGG + Intergenic
931615957 2:64158125-64158147 AAGCAGTCCCTTAGATTGCTTGG + Intergenic
932482178 2:72050659-72050681 AACACCAACCTTACATTTCTGGG - Intergenic
936935079 2:117831996-117832018 AAGAACAATCTTCCATTTCTGGG + Exonic
938939355 2:136155471-136155493 AAGCACACCCTTACATTTGTAGG - Intergenic
940973560 2:159919865-159919887 AAGACCTCCCTCAGATTTCCAGG + Intergenic
942305193 2:174600239-174600261 AACTACTCCCTTGCATGTCTTGG - Intronic
943787193 2:191890933-191890955 AAGAACTACCATACATTGCAGGG - Intergenic
944523761 2:200597735-200597757 AAGAATGCCCTGACATTTGTGGG + Intronic
946073962 2:217058299-217058321 AAGAACTGACTTGCCTTTCTAGG - Intergenic
946234151 2:218312353-218312375 AAGAATTACATTACATTCCTGGG + Intronic
947226111 2:227841938-227841960 GAGAATTCCCTTCCCTTTCTAGG - Intergenic
947491219 2:230596016-230596038 AAAAACACCCTTACATTCTTAGG + Intergenic
947684771 2:232073263-232073285 AAGAGCTGCTTTTCATTTCTTGG - Intronic
1170124552 20:12948996-12949018 AAGAACTGCCTAACATTGGTTGG + Intergenic
1170283709 20:14681148-14681170 TTGAACTCTCTTACATTGCTGGG + Intronic
1170707079 20:18753986-18754008 TAGAACAGCCTTACCTTTCTAGG + Intronic
1173575283 20:44109402-44109424 TAGAACTTTCTTACTTTTCTGGG - Intergenic
1173587130 20:44191200-44191222 AAGAACTCCAGTGGATTTCTGGG - Intergenic
1175618806 20:60425823-60425845 AAGAACAATCTTCCATTTCTGGG - Intergenic
1177324022 21:19560346-19560368 TAGAACACAGTTACATTTCTTGG + Intergenic
1177713764 21:24813004-24813026 AAGAACTGCCCTAAATTTATAGG - Intergenic
1178952409 21:36995886-36995908 AAGAATTCCTGTACATTTCTAGG + Intergenic
1182168409 22:28200929-28200951 AAAAGCACACTTACATTTCTTGG + Intronic
1184902269 22:47453854-47453876 AAGAAGTCACTTCCATTTCCTGG - Intergenic
950478931 3:13232808-13232830 CAGAATTCCCTTCCATTTCATGG - Intergenic
952615710 3:35270382-35270404 AAGTACTCTCTTTTATTTCTGGG + Intergenic
953430605 3:42836711-42836733 AGTAACTCCCTTTCCTTTCTTGG - Intronic
956388338 3:68744908-68744930 TAGGACTCCTTTACATTTCAGGG - Intronic
957485349 3:80854615-80854637 AATAAATCCCTTACATGCCTCGG - Intergenic
957882728 3:86241524-86241546 GAGAACTCACTCACATTTCTAGG + Intergenic
958788544 3:98625123-98625145 AAGAAGTCCCTTACCTTAGTGGG + Intergenic
959562580 3:107799457-107799479 AAAAACTACCTTTCTTTTCTAGG - Intronic
960658784 3:120035257-120035279 TAGCAATCCCTGACATTTCTTGG - Intronic
961964491 3:130888302-130888324 AAGCACTCCCTTAGATTCCCTGG + Intronic
967200815 3:187070973-187070995 AGGAACTTCCTTACATCTGTAGG + Intronic
967381347 3:188862379-188862401 AAGAAGTTACTTACTTTTCTTGG + Intronic
967439438 3:189489928-189489950 AAGTACTTCCGAACATTTCTTGG + Intergenic
967462703 3:189764971-189764993 AAGAACTCTTTTAGATGTCTGGG + Intronic
967696733 3:192541677-192541699 AAGAACTCCCTTACATTTCTTGG + Intronic
967792823 3:193567550-193567572 TTAAACTCTCTTACATTTCTGGG - Intronic
971812218 4:31440837-31440859 AAGTATTCTGTTACATTTCTTGG + Intergenic
972007372 4:34127777-34127799 AACAACTCTTTTACATTTCTAGG + Intergenic
972903524 4:43715470-43715492 AGGCACTCTCTTACATTACTAGG + Intergenic
973574092 4:52268445-52268467 GAGAATTCCCTTCCCTTTCTAGG + Intergenic
973727888 4:53793903-53793925 TAGGAATCCCTGACATTTCTGGG + Intronic
973894478 4:55397577-55397599 AAGACTTCCCTAAAATTTCTTGG + Intronic
975173728 4:71262662-71262684 AATAACTCCCTTCTATTTCAAGG - Intronic
976908448 4:90269035-90269057 AACATCTGCCTTACATATCTGGG - Intronic
976913015 4:90331801-90331823 AAAAGCTGTCTTACATTTCTTGG - Intronic
979068988 4:116176996-116177018 ACTAACTCACTTACATATCTGGG + Intergenic
979491700 4:121335657-121335679 CATAACTCCTTCACATTTCTAGG + Intronic
980132604 4:128830660-128830682 AAAAGCTCCCTTTCATTTTTAGG + Intronic
980186101 4:129463051-129463073 ATGAATTACCTTGCATTTCTAGG + Intergenic
980250351 4:130306916-130306938 AACAATTCCCTTAAAATTCTAGG - Intergenic
981344196 4:143656277-143656299 AAAAACTATCTTTCATTTCTAGG + Intronic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
988990764 5:36668551-36668573 TATACCTCCCTTACCTTTCTTGG + Intronic
995078116 5:108011922-108011944 AAGCAATTGCTTACATTTCTAGG + Intronic
995339140 5:111037258-111037280 AAGGAGTCCTTTACATTTTTTGG + Intergenic
999415089 5:151388067-151388089 GAGAACCCCCTTCCCTTTCTAGG + Intergenic
999526374 5:152410639-152410661 AATAACTCCCCTATATCTCTGGG + Intronic
999623466 5:153495507-153495529 GAAAATTCCCTTTCATTTCTTGG - Intronic
1000225195 5:159254672-159254694 ATGAACCCCCTGGCATTTCTAGG - Intergenic
1001619525 5:173071671-173071693 AGCAACTCCCATACATTTCTTGG - Intronic
1005195701 6:23281221-23281243 AAGAAATGCTTTACAATTCTTGG + Intergenic
1005213220 6:23493752-23493774 AAAAAGTCCCTGACCTTTCTAGG + Intergenic
1010343154 6:74781097-74781119 AAGAACTCCCTTAGTTGCCTGGG - Intergenic
1011479916 6:87783754-87783776 AAAAACTCTCTTACCTCTCTCGG - Intergenic
1011985445 6:93438037-93438059 AAATACTTCATTACATTTCTTGG + Intergenic
1012901864 6:105015741-105015763 AAGAACTAATTTTCATTTCTTGG - Intronic
1012993560 6:105950119-105950141 AAGAACTCCCTGGCATTTCTGGG + Intergenic
1016233504 6:141833519-141833541 AGGAACTCCCTCACTTTGCTGGG + Intergenic
1017453353 6:154575205-154575227 AGTAACTCCCTTGCATTTCCAGG + Intergenic
1017517573 6:155170846-155170868 AAGAAATTCCTTTCATTTATAGG + Intronic
1017589100 6:155959403-155959425 AAGAACTCCCTTACTATCATGGG + Intergenic
1017652588 6:156597030-156597052 AATAAATCCCTTACATTTTGAGG - Intergenic
1020558528 7:9699563-9699585 ATGTATTCTCTTACATTTCTAGG - Intergenic
1020861745 7:13502250-13502272 AAAAAATCACTTACTTTTCTGGG + Intergenic
1021262227 7:18472376-18472398 AAGAACTCCATTCTCTTTCTAGG - Intronic
1021372011 7:19860870-19860892 AACAACTACCTTACCTCTCTTGG + Intergenic
1021754471 7:23837982-23838004 CTGAACTTCCTTACTTTTCTTGG - Intergenic
1022478859 7:30729901-30729923 AAGAACTGCCTCTCATTCCTAGG - Intronic
1022526582 7:31041861-31041883 GAGAACTCCCTTGAACTTCTGGG + Intergenic
1022592788 7:31681748-31681770 AAGACCTCCCTTTTAGTTCTTGG + Intergenic
1025549886 7:62231994-62232016 ATGAACTCCCTAATATTCCTCGG - Intergenic
1025920393 7:65906639-65906661 AGGAACTCACATTCATTTCTGGG - Intronic
1027808528 7:82861486-82861508 AATATTTCCCTTACATATCTGGG - Intronic
1030375507 7:108748803-108748825 AAGAACTGCTTAACATTTATAGG + Intergenic
1030975334 7:116115007-116115029 TAGATCTACCTTACTTTTCTTGG - Intronic
1033764679 7:144475449-144475471 AGGAACTCCCTTTAATTTTTGGG + Intronic
1037499378 8:19470633-19470655 AATCATCCCCTTACATTTCTAGG - Intronic
1037881248 8:22574558-22574580 CAGAACTCCCCTACAGTTCTGGG + Intronic
1038930000 8:32183089-32183111 AAGAACTCCATTACATTCTAGGG + Intronic
1041571882 8:59346486-59346508 AAGAAATCCCTTTCTCTTCTTGG - Intergenic
1041791679 8:61702779-61702801 AAAACCATCCTTACATTTCTGGG - Intronic
1042820331 8:72923290-72923312 GAGAATTCCTTTCCATTTCTAGG - Intronic
1044274104 8:90280223-90280245 GAGAATCCCCTTACCTTTCTAGG - Intergenic
1044845534 8:96376889-96376911 AAGAGCCCCCTCACTTTTCTGGG - Intergenic
1046039290 8:108882923-108882945 AAGAAGTCCTTGACTTTTCTTGG + Intergenic
1046063290 8:109164854-109164876 AAGAAATGGCTTACATTGCTGGG - Intergenic
1046199567 8:110906357-110906379 CAGCAATCCCTTACATTCCTGGG - Intergenic
1046309148 8:112412282-112412304 TAGAACACCCTTTTATTTCTAGG + Intronic
1047059076 8:121202800-121202822 ATGAATTTCCTTGCATTTCTAGG - Intergenic
1048348240 8:133594630-133594652 AACAACTCCCTTGAATTTATAGG - Intergenic
1048474566 8:134731829-134731851 ATGAATTCCCTTTCCTTTCTGGG - Intergenic
1048655785 8:136534407-136534429 GAGAATCCCCTTACATTTATAGG + Intergenic
1048837467 8:138534857-138534879 AAGAAATCACTTACATAACTTGG + Intergenic
1050188743 9:3002718-3002740 ATTAACTCCCTTACACTTCAAGG - Intergenic
1050215993 9:3324478-3324500 AAGAACTCCCTTATATTTAAGGG - Intronic
1050601015 9:7251191-7251213 TAGAACAACCTTATATTTCTGGG + Intergenic
1050880650 9:10696048-10696070 AATAACTCCCCGACACTTCTAGG + Intergenic
1051617387 9:19019128-19019150 AAGAACCCTCTTAATTTTCTTGG + Intronic
1055467909 9:76583565-76583587 AAAAACTCCATTAGATTTCAAGG + Intergenic
1056008439 9:82299860-82299882 AATATTTCCTTTACATTTCTGGG + Intergenic
1056313417 9:85365883-85365905 AACACCTCCTTTACATCTCTGGG + Intergenic
1056827191 9:89884477-89884499 CAGAACCCGCTTCCATTTCTAGG + Intergenic
1057143513 9:92742884-92742906 AAGAATTCCCTTCCCTTTCATGG + Intronic
1062030712 9:134360753-134360775 AAGAGCCCCCTTACAATTCCTGG + Intronic
1203407537 Un_KI270538v1:56885-56907 AAGAACTTCCTGAGAATTCTTGG + Intergenic
1203407785 Un_KI270538v1:61686-61708 AAGAACTTCCTGAGAATTCTTGG + Intergenic
1188910298 X:35839357-35839379 CAGGACTCCCTTACAAGTCTTGG - Intergenic
1189659624 X:43283480-43283502 AAGAACTCACTTCCAGTTTTGGG + Intergenic
1190426026 X:50335164-50335186 AAGAACTCCCTTACTATCTTCGG - Intronic
1191226326 X:58048320-58048342 AACAACTTCATTACATTCCTTGG - Intergenic
1191775441 X:64808256-64808278 TAGAACTGCCTTGGATTTCTGGG - Intergenic
1192576928 X:72250450-72250472 AAGAACTTCCTTAGATTTGATGG + Intronic
1192868577 X:75163110-75163132 AAAAACTTCCTTACAATTGTAGG + Intergenic
1194154713 X:90373219-90373241 AGGAACTCTCTTTCATGTCTTGG - Intergenic
1195726900 X:107927033-107927055 AAGAATCCCCTTATGTTTCTGGG + Exonic
1197502569 X:127260065-127260087 CAGCACTCCCTTAGCTTTCTCGG - Intergenic
1200255059 X:154576495-154576517 AAGCACTTCCTTATTTTTCTGGG - Intergenic
1200262710 X:154627909-154627931 AAGCACTTCCTTATTTTTCTGGG + Intergenic
1201799320 Y:17937978-17938000 AAGGACTCAATTACATTTTTAGG - Intergenic
1201802233 Y:17967978-17968000 AAGGACTCAATTACATTTTTAGG + Intergenic
1202095610 Y:21245742-21245764 AAGAACTCCCCTACAATCTTTGG - Intergenic
1202362222 Y:24122664-24122686 AAGGACTCAATTACATTTTTAGG + Intergenic
1202362851 Y:24130432-24130454 AAGGACTCAATTACATTTTTAGG - Intergenic
1202507927 Y:25539683-25539705 AAGGACTCAATTACATTTTTAGG + Intergenic
1202508557 Y:25547451-25547473 AAGGACTCAATTACATTTTTAGG - Intergenic