ID: 967697817

View in Genome Browser
Species Human (GRCh38)
Location 3:192553865-192553887
Sequence GTTTTCAGTGGTCCCCAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967697817 Original CRISPR GTTTTCAGTGGTCCCCAACC TGG (reversed) Intronic
901135029 1:6987544-6987566 GGTTTTGGTGGTCCTCAACCTGG - Intronic
905245686 1:36611832-36611854 GTTATCTGTGGTCCCCAATCTGG + Intergenic
909758770 1:79263093-79263115 GTTTTCATTTGTCTCCAACAAGG - Intergenic
913218953 1:116644106-116644128 ATTATCAGTGGTCCCCACTCAGG + Intronic
913597222 1:120389932-120389954 GTTTACAATAGTCCCCAAACTGG + Intergenic
914090103 1:144489374-144489396 GTTTACAATAGTCCCCAAACTGG - Intergenic
914308506 1:146444848-146444870 GTTTACAATAGTCCCCAAACTGG + Intergenic
914514249 1:148360644-148360666 GTTTACAATAGTCCCCAAACTGG - Intergenic
914593603 1:149128285-149128307 GTTTACAATAGTCCCCAAACTGG - Intergenic
924706241 1:246504955-246504977 GGTTGCAGTGATTCCCAACCAGG + Intronic
924927826 1:248700196-248700218 GTTTTAAATGCTCCCCAACCAGG + Intergenic
1064346405 10:14536677-14536699 GATTTCTGTGGCCACCAACCTGG + Intronic
1065704533 10:28460035-28460057 GTTCTCAGTGGCTCCCAACCTGG + Intergenic
1067080384 10:43209196-43209218 GTTTTCAGTGTTCAGCACCCTGG - Intronic
1067348882 10:45457856-45457878 GCTTGCAGTGGTCCCCAGCCTGG - Exonic
1071523831 10:86346894-86346916 GGTTTCAGTCTTCCCCAGCCGGG - Intronic
1073529123 10:104215516-104215538 GCTTTCAGTTGTCTCCATCCAGG - Intronic
1076328984 10:129651174-129651196 GTGTCCAGTGGGCCCCGACCCGG + Intronic
1079020478 11:16906624-16906646 GTGTTCAGTGGTGCCCAGGCTGG + Intronic
1081207122 11:40289541-40289563 TCTTTCAGTGGGCACCAACCTGG + Intronic
1083042898 11:59705403-59705425 GTTTTCAGTGATCCCCGATGGGG - Intergenic
1083103428 11:60334147-60334169 GTTCTCAGAGGCCCCCAACATGG - Intergenic
1087789371 11:102391068-102391090 GTTCCCAGTGGTCCCCATCCCGG + Intergenic
1087833835 11:102849643-102849665 GTTTTCAGTGGTTCTCCAACAGG + Intergenic
1090256551 11:125288393-125288415 GAGTTCAGTGGTTCTCAACCTGG - Intronic
1091062526 11:132477112-132477134 GTTATCTGTGGTCTCCAACCTGG - Intronic
1092740383 12:11623064-11623086 GTTCTCAGTGGTGCCAAATCAGG - Intergenic
1093370751 12:18362222-18362244 GTTTTCAGTGGCCCCTAAACTGG + Intronic
1093392471 12:18639038-18639060 GATTTCAGTGCTCCCCCTCCTGG + Intronic
1094681169 12:32668647-32668669 GTTTACAGTGGTTCCCATCTGGG + Intergenic
1094849648 12:34376637-34376659 GCTCTCAGTGGGCGCCAACCAGG + Intergenic
1100571757 12:95849660-95849682 ATCTCCAGTGGTCCTCAACCAGG + Intergenic
1101795013 12:107965004-107965026 GTCATCTGTGGTCCCAAACCAGG + Intergenic
1102943272 12:116962483-116962505 GTTTTCAGTGGTGCCCCCCCAGG - Intronic
1112335768 13:98514346-98514368 TTTTTCTGTGGTCCCCAAAGGGG - Intronic
1114298979 14:21356930-21356952 GTTTTCAGTGTTGCCCAGGCTGG - Intronic
1114967715 14:27983854-27983876 GTTCTCAGTGATCCCAGACCTGG + Intergenic
1122185926 14:99995995-99996017 GTTTTCAGTGGCTTCCAACCTGG + Intronic
1124810910 15:32937173-32937195 CTTCTCAGTGGTTCCCAACCTGG + Intronic
1126789496 15:52208043-52208065 GTTTTCAGTGCTCTCCAAAATGG - Intronic
1126869560 15:52973196-52973218 GTTTTGAATGGTCCCAAACTTGG + Intergenic
1127389770 15:58496109-58496131 GTTCTCAGTGGTTCTCAACTGGG + Intronic
1128377521 15:67088174-67088196 GTTTTCTGTAGTCCCAAACCTGG + Intronic
1129678385 15:77644441-77644463 GGTTCCAGGGGTCCCCAAACAGG + Intronic
1129886323 15:79040331-79040353 GTTGTCAGTGGGCCCCTAACTGG + Intronic
1133525389 16:6600264-6600286 GTTCTCAGTCCTCCCCTACCTGG + Intronic
1133626272 16:7573356-7573378 CTTCTCAGTGGTCTCCAACCTGG - Intronic
1137267465 16:46880970-46880992 GTCTTCAGTGGTCCCAGACCGGG + Intergenic
1139717019 16:68821887-68821909 CTCTTCAGTGGTCCCTCACCAGG - Intronic
1140506024 16:75473350-75473372 GAGTTCAGGGGTCCCAAACCAGG - Exonic
1143539551 17:7561101-7561123 GCTTCCAGTGGGCCCCGACCAGG - Exonic
1143774870 17:9192470-9192492 GATTTCAGTGGTTCTCAATCAGG + Intronic
1150274056 17:63884622-63884644 TTATGCAGTGGTCCCCAACTAGG - Intergenic
1150278369 17:63914156-63914178 TTATGCAGTGGTCCCCAACTAGG - Intronic
1150279469 17:63920788-63920810 TTATGCAGTGGTCCCCAACTAGG - Intergenic
1150544150 17:66136183-66136205 GTTCTCAGCAGTTCCCAACCTGG - Intronic
1152678512 17:81653707-81653729 GTTGTCAGTGGTCACCCACAGGG - Intronic
1152920781 17:83065523-83065545 GTTCTCAGTGGACACCAACGGGG + Intergenic
1154121505 18:11656107-11656129 GTTTCCAGTGCTCCACAATCTGG - Intergenic
1155847195 18:30722967-30722989 GTTCTCAGTGGCCTCCAAGCAGG + Intergenic
1166927556 19:46279283-46279305 GTCTTCAGTGGTCCAGTACCTGG - Intergenic
1168482804 19:56735841-56735863 GTAATCTGTGGTTCCCAACCAGG - Intergenic
927079998 2:19617750-19617772 GTGTTTATTGGTCCCCAGCCAGG - Intergenic
927285385 2:21351774-21351796 GTTTTCTGGGCTCCCCAATCTGG + Intergenic
929764902 2:44836312-44836334 GATTTCAGTTTTCCTCAACCTGG - Intergenic
931555779 2:63502492-63502514 GTTTTAAGTTGTTGCCAACCTGG + Intronic
934907854 2:98221431-98221453 GATTTCAGTGGTGCCAAACAGGG + Intronic
935711518 2:105903015-105903037 TATATCAGTAGTCCCCAACCTGG - Intergenic
937426296 2:121801710-121801732 GGTGTCAGTGGGCCCCAGCCGGG + Intergenic
939595962 2:144122738-144122760 TTTATCAGTGGTCCTTAACCTGG + Intronic
943114262 2:183646663-183646685 GGTCTCAGTAGGCCCCAACCAGG - Intergenic
944612116 2:201421588-201421610 TTTATCAGTGGTTCTCAACCAGG - Intronic
945056567 2:205874460-205874482 GGTTTCAATGGTACCCGACCTGG + Intergenic
946342388 2:219079182-219079204 GTGTCTAGTGGTCCCAAACCTGG + Intronic
947093232 2:226537163-226537185 CTTTTCAGTGGTTCCCCAACAGG + Intergenic
1168810519 20:701666-701688 CTTGTCACTGGTCCCCCACCTGG - Intergenic
1168917595 20:1503968-1503990 GTTTTCAGTGGCCTCAAACCTGG + Intergenic
1169025243 20:2365323-2365345 GTATTCAGTGGTCCCTGACATGG + Intergenic
1172742630 20:37180933-37180955 CTTTCCAGTGGTCTCCAGCCGGG + Intronic
1174590373 20:51640264-51640286 GTCTTCAGTGGTTCTCAACTGGG + Intronic
1178158321 21:29880966-29880988 TTGTTCAGTGGCACCCAACCTGG - Intronic
1180727265 22:17955551-17955573 CTTTTCAGTGGTTCTCAGCCAGG - Intronic
949915085 3:8955167-8955189 GTTCTCAGTGGCCCTCAACCTGG - Intronic
951318530 3:21216861-21216883 GTGTTCAGCAGTCCCCAACTTGG + Intergenic
951716097 3:25648166-25648188 GTTTTCAATGGCCCTCAACCTGG - Intronic
952333879 3:32388504-32388526 GTATTCAGAGGTCACCTACCTGG + Intergenic
952831716 3:37570605-37570627 GTTCCCAGTGGTCCTCACCCAGG - Intronic
955261712 3:57397531-57397553 TGTTTCAGTGGCCTCCAACCTGG - Intronic
956272338 3:67461584-67461606 GTATCTAGGGGTCCCCAACCTGG + Intronic
959723425 3:109517134-109517156 GTTCTCAGTGATGCCAAACCAGG - Intergenic
961252534 3:125519677-125519699 GTTTTCAGTGGTCGCGTAGCTGG - Intronic
962373629 3:134841424-134841446 GTGTTCAGTGGTGAGCAACCTGG - Intronic
967697817 3:192553865-192553887 GTTTTCAGTGGTCCCCAACCTGG - Intronic
969664758 4:8550832-8550854 CTTTTCAGTGGCCCCCGAACTGG - Intergenic
972265716 4:37457315-37457337 GTTTTCAGTTGACCACAACATGG + Intronic
977804753 4:101283774-101283796 GTTATTAGTGGTACCCAACCTGG - Intronic
980518695 4:133901512-133901534 GTTTTCAGTGGTGGCAAACCTGG + Intergenic
981272534 4:142861324-142861346 GATTTCAGTGGCTCCAAACCAGG - Intergenic
981311902 4:143305680-143305702 GTTTGCAGTTGAGCCCAACCTGG + Intergenic
983019676 4:162659982-162660004 GTTTTCAGTGGTCCCATATTTGG + Intergenic
995512641 5:112923699-112923721 TATTTCAGTGGTTCTCAACCAGG + Intergenic
997721207 5:136079550-136079572 CTGCTCAGTGGTCCGCAACCGGG + Intergenic
1008418112 6:51266792-51266814 GTTCCCTGTGGTCCCCCACCAGG - Intergenic
1009467521 6:63990556-63990578 GTTCTCAGTGATCCCCAATGTGG - Intronic
1011497006 6:87946700-87946722 TATTGCAGTGGTCCCCAACTGGG - Intergenic
1013597729 6:111675043-111675065 GTATCCAGTTGTCCCCACCCTGG - Intronic
1017193602 6:151678577-151678599 GTTATCAGTGGTTCCCAACTTGG - Intronic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1018407576 6:163503936-163503958 TTTTTCAGTGTTGCCCAAGCTGG + Intronic
1020154220 7:5709167-5709189 GTCCTCAGAGGTCCCCAACCTGG + Intronic
1022493885 7:30841058-30841080 GTTCTCAGTGGTGCTCCACCTGG + Intronic
1022953833 7:35363635-35363657 GCTTTCCTGGGTCCCCAACCAGG + Intergenic
1023189240 7:37561636-37561658 GTTTTCAGCTGTCCACAGCCAGG - Intergenic
1024174800 7:46827933-46827955 GTGTTCATTGGCCTCCAACCAGG - Intergenic
1024340484 7:48253224-48253246 GCTTTCAGTGGCCTCCAACCTGG + Intronic
1027954074 7:84857482-84857504 GTCCTCTGTGGTCCCCACCCAGG + Intergenic
1030917440 7:115333178-115333200 GTCTTCAGTTGTCCACAAACTGG + Intergenic
1035445758 7:158942022-158942044 GCCTGCAGTGGTCCCCAACCAGG + Exonic
1040569551 8:48595700-48595722 GTCTGCACTGGTCCTCAACCCGG + Intergenic
1040594684 8:48825697-48825719 GGTGTCAGTGGTCCCCAGACTGG + Intergenic
1041503109 8:58560540-58560562 GTTTTCAGAGGCCTCCAACCTGG - Intronic
1048119140 8:131560112-131560134 GTTTTCAGTTTTCCCCAATTCGG - Intergenic
1051332165 9:16033900-16033922 GTTGTCAGTGGTGCCCACACAGG + Intronic
1051486863 9:17618103-17618125 GTTTGCATTGGTTCTCAACCGGG + Intronic
1052993486 9:34536728-34536750 GTGTGCCCTGGTCCCCAACCTGG - Intergenic
1058302851 9:103398278-103398300 GTTTTCAGGGGTCCCCATCCGGG + Intergenic
1059356262 9:113701839-113701861 GAATTCAGTGGTTCCCACCCCGG + Intergenic
1059821610 9:117979392-117979414 GTGTTCATCGGTCCTCAACCAGG - Intergenic
1185669294 X:1792919-1792941 GTTCTCAGAGGACCCCATCCAGG - Intergenic
1186445883 X:9628386-9628408 ATTTTCAGTGGTTCTCAAGCAGG - Intronic
1189188235 X:39072440-39072462 GTTTCCTGGGTTCCCCAACCAGG - Intergenic
1191624148 X:63250340-63250362 GTTTTCAGTGGTCTGCAATTTGG - Intergenic
1191637248 X:63392734-63392756 GTGTTCAATGGTGCCCAGCCTGG + Intergenic
1195631348 X:107058833-107058855 GATTTCAGTAGTCTGCAACCTGG - Intergenic
1196238734 X:113314327-113314349 TTTTTCAGTGGTGCCAAACATGG + Intergenic
1198421733 X:136475212-136475234 GCTTTCAGAGGTCCCTAAACAGG + Intergenic
1199756839 X:150872909-150872931 CTGTTCAGTTGGCCCCAACCTGG + Intronic