ID: 967702209

View in Genome Browser
Species Human (GRCh38)
Location 3:192606359-192606381
Sequence GAGGACTACCAGAAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 592
Summary {0: 1, 1: 0, 2: 10, 3: 61, 4: 520}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967702206_967702209 -9 Left 967702206 3:192606345-192606367 CCGTAACTGACACTGAGGACTAC 0: 1
1: 0
2: 0
3: 9
4: 127
Right 967702209 3:192606359-192606381 GAGGACTACCAGAAAGAGGAGGG 0: 1
1: 0
2: 10
3: 61
4: 520

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967702209 Original CRISPR GAGGACTACCAGAAAGAGGA GGG Intronic
900002674 1:23424-23446 GAGGACTTTCAGGAAGAGGTGGG + Intergenic
900022392 1:193949-193971 GAGGACTTTCAGGAAGAGGTGGG + Intergenic
900534838 1:3171714-3171736 GGGTCCTTCCAGAAAGAGGAAGG - Intronic
900690948 1:3980075-3980097 GAGGACTGTCACAGAGAGGAAGG - Intergenic
901061146 1:6472467-6472489 GAGGGCTGTCAGAAAGAGGGGGG + Intronic
902538872 1:17138363-17138385 GACGAATCCCTGAAAGAGGATGG - Intergenic
902759727 1:18573295-18573317 GAGGGCTCCCTGGAAGAGGAGGG - Intergenic
902879950 1:19365420-19365442 GTGGATTTCCAGAAAGAGCACGG + Intronic
903655797 1:24948153-24948175 GGGGACCCCCAGGAAGAGGAAGG + Intronic
904284390 1:29444572-29444594 GAGGGCTGCCTGAAAGAGGTGGG + Intergenic
904368795 1:30035397-30035419 GAGGGCTTCCTGAAAGAGGTGGG + Intergenic
904801501 1:33096258-33096280 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
906132952 1:43472212-43472234 GAGGACTCTCAGATACAGGAAGG - Intergenic
906360768 1:45156276-45156298 GGGGATTACCAGAGAGAGAAAGG + Intronic
906920908 1:50063571-50063593 GAGGTCTTACAGAAAGAGGGTGG - Intronic
909125521 1:71663631-71663653 AAAGACTATCAGAAAGAAGATGG - Intronic
909346968 1:74601607-74601629 GAAGACTTCCCAAAAGAGGAAGG + Intronic
909596095 1:77407784-77407806 GGGGACTACTAGAGAGGGGAGGG - Intronic
909758592 1:79260596-79260618 GAGGTAGACCAGAATGAGGAAGG + Intergenic
910017555 1:82546350-82546372 GAGGAGCATCAGAAAGAGGGAGG + Intergenic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
911063414 1:93766635-93766657 GCGGACTCTAAGAAAGAGGAAGG - Intronic
911679415 1:100697609-100697631 GAGGACTACTAGAGTGAAGAGGG - Intergenic
911699771 1:100938965-100938987 GCAGACTACTAGAGAGAGGAGGG - Intronic
912253982 1:108040248-108040270 GAGGTCTACCAGGCAAAGGAGGG - Intergenic
912268758 1:108188215-108188237 GGGGACTACAAGAACGGGGAGGG + Intronic
912379110 1:109237310-109237332 GAGAACTACCAGACAGAGAAGGG + Exonic
915433827 1:155887957-155887979 GGGGACTACCAGAAGGGGGAGGG - Intergenic
915473159 1:156137696-156137718 GAGGACGACGAGGATGAGGATGG + Exonic
915480455 1:156181021-156181043 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
915514659 1:156405851-156405873 GAAGAGTTTCAGAAAGAGGAGGG + Intronic
916114373 1:161474660-161474682 GAGGATTACCATTAACAGGAAGG - Intergenic
917393092 1:174560718-174560740 AAGGACTACTAGAAGGGGGAGGG - Intronic
917730314 1:177868580-177868602 GGGGACTACTAGAGGGAGGAGGG - Intergenic
918581201 1:186132136-186132158 GAGGAGGAAGAGAAAGAGGAGGG - Intronic
918586234 1:186192177-186192199 GATGACTAGCAGAAAGGGGAAGG + Intergenic
918830635 1:189392824-189392846 GTGAACTACCAGAAGGTGGAGGG + Intergenic
919459412 1:197858412-197858434 GGGGACTACTAGAGGGAGGAGGG - Intergenic
920206977 1:204299350-204299372 GAGGACAGGAAGAAAGAGGAGGG + Intronic
921132504 1:212231979-212232001 GAGGACTCCCAGAGCAAGGAGGG - Intergenic
921395784 1:214667994-214668016 GAGGACTACTAGATGGGGGAAGG + Intergenic
921685977 1:218089550-218089572 GAGGAATACTAGAGAGGGGAGGG + Intergenic
921961266 1:221036863-221036885 GAGGCCTACCAGAGGGTGGAGGG - Intergenic
922346224 1:224699025-224699047 AAGGACTATCAGAAAGGGCAGGG - Intronic
922658585 1:227408718-227408740 GAGGACTTACTGATAGAGGAAGG - Intergenic
922682958 1:227616172-227616194 AAGGAATACAAGAAAGAGGTGGG - Intronic
923666460 1:236002712-236002734 GAGGACTTCAAGAAAAAGAAGGG + Intronic
923754407 1:236777558-236777580 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
924256893 1:242191758-242191780 CAGGACTTCAAGAAAGAAGAGGG + Intronic
924276437 1:242392245-242392267 GGTGACTACTAGAAAGAGGAGGG + Intronic
1063295678 10:4803253-4803275 GAGGAGCACCAGGAAGGGGAAGG + Intronic
1063355583 10:5395524-5395546 GAGGACTAGCAGCAGGTGGACGG - Intronic
1063758584 10:9044942-9044964 GGGGACTACGTGAAAGGGGAAGG - Intergenic
1063776324 10:9269158-9269180 GAGGACTACTCGAAGGTGGAGGG + Intergenic
1063979284 10:11440809-11440831 GGGTATTACCAGAAAGAGGCCGG - Intergenic
1064493435 10:15884145-15884167 GTGGGATACCAGGAAGAGGAAGG + Intergenic
1064619031 10:17195442-17195464 GGGGACTACTAGAGAGAGAAGGG + Intronic
1064892018 10:20186568-20186590 GAGGCCTACCAGAGGGCGGAGGG - Intronic
1065313432 10:24438528-24438550 CAGGAGTACAAGCAAGAGGAGGG - Intronic
1067154579 10:43767126-43767148 GTGGACTACTAGAGGGAGGAAGG + Intergenic
1067799600 10:49349923-49349945 GAGGTGGAGCAGAAAGAGGAAGG + Intergenic
1067918368 10:50425584-50425606 GAGGATTACTAGACAGGGGAGGG + Intronic
1068018975 10:51556709-51556731 GGGAACTACCAGACTGAGGAAGG + Intronic
1068121223 10:52783906-52783928 TATGACTAACAGAAAGAGGTGGG + Intergenic
1068137487 10:52965219-52965241 CAGGACTACCAGCAGCAGGAGGG - Intergenic
1068262610 10:54601972-54601994 GAGGCCAACCAGAAGGTGGAGGG + Intronic
1069228479 10:65974579-65974601 GAGGATTACTAGACAGGGGAGGG + Intronic
1069232945 10:66035087-66035109 GAGGACTGCCAGGCAAAGGAAGG - Intronic
1070154358 10:73824509-73824531 GAGGTCTCCCAGAAAGAGCCAGG + Intronic
1071020166 10:81044623-81044645 AGGGACTACCAGAAGGTGGAGGG - Intergenic
1071318933 10:84432408-84432430 GGGGACTACTAGACAGGGGAGGG - Intronic
1073150295 10:101306866-101306888 GAAGTGTACCAGAAAGAGCATGG + Intergenic
1073419086 10:103409440-103409462 GAGGACTCCCAGAGAGTGGGAGG + Intronic
1073556313 10:104455752-104455774 GAGGAAAACCAGTAAGAGGATGG + Intergenic
1073644694 10:105288673-105288695 GGGGTCTACCAGAGAGTGGAGGG - Intergenic
1073665425 10:105527125-105527147 GAGGCCTACCAGAGAGTGGAGGG + Intergenic
1073894927 10:108144343-108144365 GGGGACTACCAGAGGGAGGAGGG - Intergenic
1074368658 10:112880741-112880763 GAGGAATAGCAGAAAGAACATGG + Intergenic
1075600190 10:123761910-123761932 GAGGACTTCCAGAAGGAGGAGGG - Exonic
1075810667 10:125222519-125222541 GTGGACTCCCAGTAAGTGGATGG + Intergenic
1077829653 11:5852533-5852555 GAGGACTACTAGAGGGAGGAGGG - Intronic
1077893144 11:6434052-6434074 GAGGACAATAAGAAAGAGAAAGG - Intronic
1078259296 11:9689758-9689780 GAGGGCTCCCAGAGAGAGAACGG + Intronic
1078478427 11:11655008-11655030 GAGGACCACAAGAAGGAGGAGGG + Intergenic
1078507971 11:11966166-11966188 GAGGACTGCCTGGAAGAGGTGGG + Intronic
1079047341 11:17117515-17117537 GAGGAGTAGCAGAAAAAGTAAGG - Exonic
1079370552 11:19848440-19848462 GAGGAGGACCAGAGAAAGGAGGG - Intronic
1079465513 11:20725903-20725925 GAGGACTACTAGAGTGGGGAAGG - Intronic
1079473169 11:20799860-20799882 GGGGACTACTAGAAGGAGGAAGG - Intronic
1079485500 11:20932283-20932305 GAGATCTACCAGAGATAGGAAGG + Intronic
1079885021 11:25976731-25976753 GAGGAGAAGCAGAAAGAGAAGGG + Intergenic
1080106109 11:28512961-28512983 GAGGAGGAAGAGAAAGAGGAGGG + Intergenic
1080239857 11:30114497-30114519 GATGACTACCAGACACATGAAGG + Intergenic
1081043177 11:38237002-38237024 GGGGCCTATCAGAAAGTGGAGGG - Intergenic
1081188071 11:40069846-40069868 GGGGACTACTAGAGAGGGGAGGG + Intergenic
1081259846 11:40946089-40946111 GAGGACTACTAGAGGGAGGAGGG - Intronic
1081421370 11:42877056-42877078 GAGGATTACCATTAATAGGAAGG - Intergenic
1081906346 11:46672758-46672780 GTGGAGTCGCAGAAAGAGGAAGG + Intronic
1083336074 11:61922637-61922659 GAGGCTAACCAGAAAGAAGAGGG - Intergenic
1083513831 11:63237179-63237201 GTGGACTACTAGAGGGAGGAAGG + Intronic
1084960335 11:72713084-72713106 GAGGACTACCAGACAGAGAGTGG - Intronic
1086760536 11:90625048-90625070 GGGGCCTACCAGAGAGTGGAGGG + Intergenic
1087058144 11:93953264-93953286 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1087946908 11:104173290-104173312 GAAGACTACCAGAAAAGCGAGGG + Intergenic
1088342193 11:108781062-108781084 GCAGACTACTAGAAAGGGGAAGG - Intronic
1088358095 11:108964094-108964116 GAGGACCACTAGAAAAGGGAGGG + Intergenic
1088418105 11:109612151-109612173 GGGGAATCCCAGAAATAGGAAGG + Intergenic
1088534284 11:110843080-110843102 GAGGCCTATCAGAAGGTGGAGGG - Intergenic
1089166954 11:116484724-116484746 GGGGACTACCAGAAGAAGCAAGG + Intergenic
1089647473 11:119889687-119889709 AAGGACTCCCAGAGGGAGGATGG - Intergenic
1090131832 11:124150779-124150801 CAGGAAGACGAGAAAGAGGAAGG + Intergenic
1090684997 11:129106510-129106532 GGGGACTACTAGATAGGGGAGGG + Intronic
1091376091 12:25487-25509 GAGGACTTTCAGGAAGAGGTGGG + Intergenic
1091635631 12:2194390-2194412 GGGGACAATCAGGAAGAGGAGGG - Intronic
1091895784 12:4103129-4103151 GAGGATTACCACAAAGGGGCAGG - Intergenic
1092989455 12:13881116-13881138 GAGGAATAGAACAAAGAGGATGG - Intronic
1093854572 12:24085053-24085075 AAGGACTACCTGAAAAAAGAGGG + Intergenic
1093987306 12:25550501-25550523 GTGGACCCCCAGAAAGGGGATGG - Intronic
1094245426 12:28286368-28286390 GGGGCCTACCAGAAGGTGGAGGG - Intronic
1094428960 12:30345820-30345842 GAGGACTAGAAGAAAGAATATGG + Intergenic
1094524293 12:31221512-31221534 GAGGGCTTCCAGGAAGAGGTGGG + Intergenic
1094726400 12:33122061-33122083 GGGGCCTACCAGAAGGTGGAGGG + Intergenic
1094782193 12:33803557-33803579 GGGGTCTACCAGAAGGTGGAGGG - Intergenic
1095139382 12:38642901-38642923 GGGGACTACAAGAGAGAGAAAGG - Intergenic
1095681432 12:44981048-44981070 GAAGACTACCTGAGTGAGGAGGG + Intergenic
1095903697 12:47355383-47355405 GGGGACTACTAGAGGGAGGAAGG - Intergenic
1096702088 12:53391752-53391774 GGGGACTACTAGATAGGGGAGGG - Intronic
1097699016 12:62801722-62801744 GAGGGCTCCCAGAAAGCGCACGG - Intronic
1098225264 12:68315038-68315060 GAGGACGACAATGAAGAGGAAGG - Exonic
1098371361 12:69763761-69763783 GGGGACTACTAGACAGGGGAGGG - Intronic
1098603188 12:72358288-72358310 GAGGAGGAGAAGAAAGAGGAGGG - Intronic
1098829032 12:75336544-75336566 GAGAACTACCAGAAATAAAAGGG + Intronic
1099833929 12:87882577-87882599 GGGGCCTACCAGAGAGTGGAGGG + Intergenic
1100168122 12:91941202-91941224 GATGACTACCATAAAGAAGATGG + Intergenic
1101626265 12:106445110-106445132 GAAGACAAAGAGAAAGAGGAAGG - Intronic
1102061947 12:109939243-109939265 GATGCCTACAAGAAAGAAGAGGG + Exonic
1102572207 12:113833694-113833716 CAGGACCACCAGAGAGGGGAAGG - Intronic
1102637563 12:114337355-114337377 GTGGACTACTAGAGAGGGGAGGG - Intergenic
1102952135 12:117038088-117038110 CAGGACTGCCAGAAAGAGCCAGG + Intergenic
1102955282 12:117054801-117054823 GAGGATGGCCAGAAAGAGGAAGG - Intronic
1103163230 12:118748459-118748481 GAGGAGGAGAAGAAAGAGGAGGG + Intergenic
1104205843 12:126637572-126637594 GAGGAAGACCAGAAAACGGAGGG + Intergenic
1104365037 12:128168921-128168943 ACTGACTCCCAGAAAGAGGAGGG + Intergenic
1104371877 12:128230696-128230718 AAAGACAACCAGAGAGAGGAGGG + Intergenic
1104506747 12:129339315-129339337 GAGGAGGAAAAGAAAGAGGAGGG + Intronic
1105902975 13:24773538-24773560 GGGGACTGCTAGAGAGAGGAGGG + Intronic
1106243061 13:27925387-27925409 GAGGAGGAGGAGAAAGAGGAGGG - Exonic
1106358477 13:29007614-29007636 GAGGAGGAGGAGAAAGAGGAGGG - Intronic
1106462469 13:29983962-29983984 GGGGACTACTAGAAACGGGAGGG - Intergenic
1106932496 13:34682047-34682069 GAGGACTTCCAGAAAGTGTGTGG + Intergenic
1108038795 13:46320473-46320495 GAGGAAGACAAGAAAGAAGAGGG + Intergenic
1108216255 13:48187689-48187711 GAGGGGGACCACAAAGAGGAAGG + Intergenic
1108679922 13:52771209-52771231 GAGGACTACAAGAAGGAGGAGGG - Intergenic
1109311749 13:60703100-60703122 GGGGACTACCCGAGGGAGGAGGG - Intergenic
1109757119 13:66775529-66775551 GAGGAGGAGAAGAAAGAGGAGGG - Intronic
1109815695 13:67581187-67581209 GGGGACTACAAGAAAGGGGAAGG - Intergenic
1110743162 13:79020983-79021005 GAGGCCTACCTGAGAGTGGAGGG + Intergenic
1111157011 13:84340974-84340996 GGGGACTATCAGAGAGTGGAGGG - Intergenic
1111690538 13:91557924-91557946 AAGGACTACCAGAAAAACGTGGG + Intronic
1112591814 13:100770351-100770373 CAGGACTCCCAGAAGGAAGAGGG - Intergenic
1112662241 13:101523337-101523359 GCGGACTCTCACAAAGAGGATGG - Intronic
1113593537 13:111516782-111516804 GGGGACTACTAGACAGGGGAGGG - Intergenic
1114578569 14:23736124-23736146 GGGGACTACCAGAGGAAGGAGGG + Intergenic
1114618761 14:24082400-24082422 GAGGACTGCCCAAGAGAGGAAGG - Intronic
1114871791 14:26667155-26667177 TAGGAAGACCAGAAGGAGGAAGG - Intergenic
1115401558 14:32967141-32967163 GAGGAGGAAGAGAAAGAGGAGGG - Intronic
1115662140 14:35507108-35507130 CAGGTCTATCAGACAGAGGAGGG + Intergenic
1115815567 14:37160957-37160979 GAGGAGGAGGAGAAAGAGGAAGG + Intronic
1116023795 14:39491937-39491959 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116280002 14:42894505-42894527 GTGGACTACCAGAGGGTGGAGGG - Intergenic
1116510056 14:45733868-45733890 GGGGCCTACCAGAGAGTGGAGGG + Intergenic
1116601820 14:46935577-46935599 GGGGATTCCCAGAAAGAGGCAGG - Intronic
1117622473 14:57601464-57601486 GGGGACTACTAGAGGGAGGAGGG - Intronic
1118043006 14:61937758-61937780 GAGAACTAGAGGAAAGAGGAAGG + Intergenic
1118508037 14:66436956-66436978 GAGGACTACTAGAAGAGGGAGGG - Intergenic
1118922998 14:70167110-70167132 GTGGACTACAAAACAGAGGATGG - Exonic
1120190903 14:81438214-81438236 GAGGAACACCAGACAGAGCACGG + Intergenic
1120445073 14:84585269-84585291 GAAAACTACTAGAAGGAGGAGGG + Intergenic
1120544356 14:85792389-85792411 GTGGACTACAAGAAGGGGGAGGG + Intergenic
1120568262 14:86085888-86085910 GAGGGGCTCCAGAAAGAGGAGGG + Intergenic
1120673370 14:87389853-87389875 CTGGACTTCCAGAAAAAGGAAGG + Intergenic
1120856596 14:89217816-89217838 GAGGGCTCCCACAAACAGGAGGG - Intronic
1121488159 14:94336347-94336369 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1121618085 14:95327189-95327211 GAGGACTAGCTGAAACAGGTTGG - Intergenic
1122271704 14:100571183-100571205 CTGGACCACCAGAAAGAGGTAGG - Intronic
1122301214 14:100732143-100732165 AAGGACTGCCAGAAAAAGGACGG + Exonic
1124577150 15:30919808-30919830 GAGGACGAGGAGAGAGAGGAGGG + Intronic
1124713467 15:32034002-32034024 GAGAATTAACAGAAAGATGAGGG + Intronic
1124781300 15:32637745-32637767 GGAGACCATCAGAAAGAGGAAGG + Exonic
1125400004 15:39291930-39291952 GGGGCCTACCAGTAGGAGGAGGG - Intergenic
1125588741 15:40841169-40841191 GAGGACTACCAGAAGAGAGAAGG - Intergenic
1126438406 15:48660375-48660397 GGGGACTACTACAGAGAGGAGGG + Intergenic
1126518749 15:49564827-49564849 GGGGACTACTAGATAGAAGAGGG + Intronic
1127318042 15:57815989-57816011 GAGGCCCATAAGAAAGAGGATGG + Intergenic
1127742996 15:61931935-61931957 GAGGTTTACAAGAAAGAGTAAGG + Intronic
1128001547 15:64197355-64197377 GAGGTCTAGCAGGCAGAGGATGG - Intronic
1128552686 15:68608488-68608510 GAGCAATACCAGGAAGTGGATGG - Intronic
1128705296 15:69833894-69833916 GAGGACTTCCAGGGAGAGGTGGG - Intergenic
1130128714 15:81117841-81117863 AAGGACTAGGAGAATGAGGATGG - Intronic
1130179489 15:81610638-81610660 GGGGACTACCAGAGGGTGGAGGG + Intergenic
1130397698 15:83517903-83517925 GGGGACTACTAGAAGGGGGAGGG - Intronic
1131002258 15:88948504-88948526 GAGGAATACCAGAGAGAAAAAGG - Intergenic
1132166264 15:99594375-99594397 TAGCACAACCAGATAGAGGATGG - Intronic
1132450837 15:101967515-101967537 GAGGACTTTCAGGAAGAGGTGGG - Intergenic
1132804331 16:1768711-1768733 GAGGACGACGAGACGGAGGAGGG + Exonic
1133000532 16:2849160-2849182 CAGGACTAGAAGAAGGAGGAAGG + Intergenic
1133389860 16:5401479-5401501 GAGGACTAACGGCAGGAGGAGGG - Intergenic
1133464697 16:6018810-6018832 GGGGACTACCAGGACGAGGACGG + Intergenic
1133504395 16:6397093-6397115 TTGGAGTCCCAGAAAGAGGAAGG + Intronic
1133583350 16:7167486-7167508 CAGGACCACCAGAAACTGGAAGG + Intronic
1133722814 16:8510748-8510770 GGGGACTACCAGAGTGGGGAGGG - Intergenic
1133827904 16:9295218-9295240 GAGGATTAGCAGAAAGGAGAGGG + Intergenic
1134590530 16:15449358-15449380 GGGGACTACAAGAGGGAGGAAGG + Intronic
1134755439 16:16663318-16663340 GAGGATTAACAGAAAGAGGAAGG + Intergenic
1134990627 16:18695852-18695874 GAGGATTAACAGAAAGAGGAAGG - Intergenic
1136539791 16:30923050-30923072 GAGGACTACAAGCAAGATGGCGG - Intronic
1137498415 16:48990384-48990406 GAGGACTACTAGAAGGGGAAGGG + Intergenic
1139005814 16:62570600-62570622 GAGGACATCGAGAAAGATGAAGG + Intergenic
1139531341 16:67544139-67544161 GAGGATTTCCAGAAGGAGGAAGG - Intronic
1140452705 16:75083858-75083880 CAGGAGTACTAGAAAGAGAAAGG + Intronic
1140551182 16:75867586-75867608 GGGGCCTACCAGAGAGTGGAAGG - Intergenic
1141007136 16:80363136-80363158 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1141868357 16:86766719-86766741 CAGGACTGCTAGAGAGAGGAGGG - Intergenic
1142512691 17:407429-407451 GGGGACTACTAGAGGGAGGAGGG + Intergenic
1142934302 17:3314845-3314867 GTGAACTACTAAAAAGAGGAGGG - Intergenic
1143974399 17:10819551-10819573 GAGGAAGACCTGAAAGAGAAGGG - Intergenic
1145046226 17:19618957-19618979 GAGGACAACCACACAAAGGAAGG - Intergenic
1149894529 17:60419352-60419374 GGGGCCTACCAGAGAGTGGAGGG + Intronic
1151105412 17:71610633-71610655 GGGGACTACAAGAAGGGGGAGGG + Intergenic
1151105601 17:71612858-71612880 GGGGACTACAAGAAGGGGGAGGG + Intergenic
1152009763 17:77705172-77705194 AAAGACTACCAGGAGGAGGAAGG - Intergenic
1152522088 17:80862572-80862594 GAGGACCACCAGCAACACGAGGG - Intronic
1152646881 17:81473297-81473319 GAGGAGTTCGAGGAAGAGGAGGG + Intergenic
1153318640 18:3750126-3750148 GGGGACTACTAGAGAGGGGATGG - Intronic
1153469443 18:5427648-5427670 CAGGACAAACAGAAAGAGCATGG + Intronic
1153915212 18:9738788-9738810 GAGGCCTAGCACAAGGAGGAAGG - Intronic
1153919878 18:9779033-9779055 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
1153983755 18:10334773-10334795 GAGTACTCCCAGACAGGGGACGG - Intergenic
1154098994 18:11451055-11451077 GAGGACTACTAGAAGCAGGAAGG + Intergenic
1155215775 18:23641833-23641855 CAGGACTACCAGCTACAGGAAGG + Intronic
1155416182 18:25602178-25602200 CAGGAATATCAGACAGAGGAAGG - Intergenic
1155844307 18:30686355-30686377 GAGGAAAAGAAGAAAGAGGAGGG + Intergenic
1157857951 18:51118419-51118441 GAGGACTATCATTAATAGGAAGG + Intergenic
1158059581 18:53323221-53323243 GAGGAGTTCAAGAAAGAGGAAGG - Intronic
1158110113 18:53931416-53931438 GGGGACTACTTGAGAGAGGAGGG + Intergenic
1159254028 18:65922077-65922099 GTGAACTACCAGAAGGAGGAGGG - Intergenic
1159300048 18:66552045-66552067 CAGGACTACTAGAGAGGGGAAGG + Intronic
1160117554 18:76095588-76095610 GAGGACTACCAGAGAGGGGAGGG + Intergenic
1160547837 18:79672795-79672817 GAGGACTGGCAGGAAGGGGACGG - Intergenic
1160634425 19:65032-65054 GAGGACTTTCAGGAAGAGGTGGG + Intergenic
1163057383 19:14730811-14730833 GGGGACTACTAGATGGAGGAGGG - Intronic
1164485277 19:28650507-28650529 GAGGACTACTACAAGGAAGATGG - Intergenic
1165854360 19:38870833-38870855 GAGGACGACCCTGAAGAGGAAGG - Exonic
1166287943 19:41844015-41844037 GAGGACCAGCAGAGAGAGGGAGG + Exonic
930040070 2:47115349-47115371 GAGCAGATCCAGAAAGAGGAAGG - Intronic
931145659 2:59514340-59514362 GGGGACTACTAGATAGGGGAAGG + Intergenic
931317627 2:61147472-61147494 GAGGACATGCAGCAAGAGGAAGG - Intronic
931518870 2:63073431-63073453 GAGGACTACTAGAGGTAGGAGGG + Intergenic
931876926 2:66523974-66523996 GTTGACTACCAGAGATAGGAAGG + Intronic
932378284 2:71258001-71258023 GAATACTACAAGAAAGATGAAGG - Intergenic
932591071 2:73068083-73068105 GAGGACGGGCAGAAAGAGGGTGG - Intronic
932736339 2:74257176-74257198 GTGGCCTACCAGCACGAGGAGGG + Intronic
932921847 2:75924956-75924978 GAGGAAGAGGAGAAAGAGGAAGG + Intergenic
933058341 2:77702626-77702648 GAGGACTACTAGAAAGAGAAGGG + Intergenic
933587582 2:84196068-84196090 GCTGACTACCACAAAGAGGAGGG + Intergenic
934631173 2:95924730-95924752 GATGACTACCGGAATCAGGAAGG - Intronic
934833331 2:97556315-97556337 GATGACTACCGGAATCAGGAAGG - Intronic
935499843 2:103825361-103825383 GAGGACTTCCTGATAGGGGAGGG - Intergenic
935712210 2:105909304-105909326 GAGGACACAGAGAAAGAGGAAGG + Intergenic
936074877 2:109395393-109395415 GGGGTCTCCCAGGAAGAGGAGGG - Intronic
936459094 2:112698366-112698388 GGGGACTACTAGAGAGGGGAGGG - Intergenic
936893453 2:117399275-117399297 GTGGACTACTAGAAGGTGGAGGG + Intergenic
937617320 2:123941273-123941295 GAAGACAACCAGACAGTGGAAGG + Intergenic
938089991 2:128425165-128425187 GAGGCCTGCCAGAAACAGGCTGG - Intergenic
938685036 2:133729972-133729994 GTGGACTATCAGAAAGTGCATGG + Intergenic
939125305 2:138171142-138171164 GGGGACTACAAGAAGGAGGAAGG + Intergenic
939173622 2:138724093-138724115 GAGGCCTTTCAGAAAGTGGAGGG - Intronic
939919901 2:148097566-148097588 TAGGTCTCCAAGAAAGAGGAAGG + Intronic
940017975 2:149126570-149126592 GAGGAGGAAAAGAAAGAGGAGGG + Intronic
940018296 2:149130035-149130057 GGGGCCTACCAGAAAGAGGCGGG - Intronic
941836847 2:170031678-170031700 GAGGACTACTAGAAGAGGGAAGG - Intronic
942009323 2:171743290-171743312 GAGGAGGAAAAGAAAGAGGAAGG + Intronic
942135486 2:172920874-172920896 CAGGTCTGTCAGAAAGAGGAAGG - Intronic
943470047 2:188283717-188283739 GAGGACTACTAGGAAGGTGAGGG + Intergenic
943860355 2:192854195-192854217 GCAGACTACTAGAAGGAGGAGGG - Intergenic
943928472 2:193819486-193819508 CAGGACTACCAGTAGCAGGATGG - Intergenic
945076038 2:206040393-206040415 GAGGGCTACAACAAAAAGGAAGG - Intronic
945820331 2:214656769-214656791 GGGGTCTACCAGAAGGTGGAGGG - Intergenic
946588503 2:221217404-221217426 CATGACTACCAGAAAGACGAAGG + Intergenic
947059340 2:226145099-226145121 GAGGTGTACCAGAAAGAGAAAGG - Intergenic
1169276778 20:4238498-4238520 GAGGAGTAACTGAAAGAGTAAGG + Intronic
1169491801 20:6077338-6077360 GATGACCACCTGGAAGAGGAAGG + Exonic
1170902459 20:20478690-20478712 GGGAACTACCAGAAGGGGGAGGG + Intronic
1172299282 20:33837519-33837541 GAGGAATTTCAGAGAGAGGAGGG + Intronic
1173477015 20:43367021-43367043 GGGGACTACCAGAGGGAGGAAGG + Intergenic
1173648939 20:44651065-44651087 GAGCCCTGCCAGAAAGGGGAGGG - Intronic
1174056774 20:47803551-47803573 GAGGAATAAGAGAAAGAGAAGGG + Intergenic
1174271751 20:49374445-49374467 GTGGCCCACCAGAAAGAGGCTGG + Exonic
1174332620 20:49832012-49832034 GTGGCCTAACAGAAACAGGAAGG - Intronic
1174644281 20:52072218-52072240 GAGGACGAGGAGAAAGAGAAGGG + Intronic
1174725722 20:52859678-52859700 GAGGTCTTCCTGGAAGAGGAGGG - Intergenic
1175647619 20:60688151-60688173 GAAGCCTACAAGAAGGAGGAAGG + Intergenic
1175883456 20:62274031-62274053 GAGGGCCACCAGAGACAGGAGGG - Intronic
1176139267 20:63537971-63537993 GAGGACTTCCCGGAAGAGGAGGG + Intergenic
1176981824 21:15390927-15390949 GGGGACTACTAGAGAGAGGAAGG - Intergenic
1177029406 21:15963751-15963773 GAGGTCTACAAGAAAAGGGAAGG - Intergenic
1177509465 21:22065740-22065762 GGAGACTTCCTGAAAGAGGAAGG + Intergenic
1177542125 21:22507822-22507844 GAGGACTACTAGACAGTGGAGGG - Intergenic
1178323937 21:31628187-31628209 AAGGACTTTCAGAAAGAAGAGGG - Intergenic
1178765618 21:35448228-35448250 GATGACCTCCTGAAAGAGGAAGG - Intronic
1179351763 21:40617886-40617908 GAGCAATGCCAGACAGAGGACGG + Intronic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1181902391 22:26167618-26167640 GAGGCCTACCAGAGGGTGGAAGG + Intergenic
1182550934 22:31100426-31100448 GAGGGAAACCAGAAAGAGAAGGG - Intronic
1182851428 22:33477962-33477984 GAGGGCTTCCAGGAAAAGGAAGG - Intronic
1182871436 22:33651038-33651060 AAGGAGTACCAGGAAGTGGAGGG + Intronic
1182985872 22:34715760-34715782 GAGGAGGAAGAGAAAGAGGAGGG - Intergenic
1183733621 22:39631542-39631564 GAGGACTGCCTGGAGGAGGAGGG + Intronic
1184966795 22:47981163-47981185 GAGGCCTACCAGAGAGTGGAGGG - Intergenic
949146761 3:710126-710148 GGGGACTACCAGAGAGTGGAGGG - Intergenic
949720363 3:6982284-6982306 GAGGACTACAAGAGGGAGAAGGG + Intronic
950165997 3:10799423-10799445 GACGACTACCAGAATATGGATGG - Intergenic
951330612 3:21363971-21363993 GAGGAATACAAGAAGAAGGAAGG + Intergenic
951376421 3:21923823-21923845 GGGGACTACTAGAAGGGGGAGGG + Intronic
951758961 3:26124185-26124207 GTGGACTACTAGAAGGGGGAGGG + Intergenic
951840935 3:27033388-27033410 GATTACTTCAAGAAAGAGGATGG - Intergenic
952030449 3:29135840-29135862 GAGGACTACTAGAGGGAGGAGGG + Intergenic
952609539 3:35191407-35191429 GAGGACTAGTAGAGAGAGAAGGG - Intergenic
953145539 3:40271164-40271186 GAGACCAAGCAGAAAGAGGAAGG + Intergenic
953167837 3:40481483-40481505 GAGGAAGACCAGAAAGAAGCTGG + Intronic
953230356 3:41059098-41059120 GGGGACTACTAGAGGGAGGAGGG - Intergenic
953637721 3:44676865-44676887 GAGGACTAATAGACGGAGGAGGG + Intergenic
953721223 3:45356879-45356901 GAGGACTACTAGAGTGGGGAAGG - Intergenic
953847038 3:46435881-46435903 CAAGACTGCAAGAAAGAGGAGGG + Exonic
955442687 3:58974261-58974283 GAGGACTACTAGTAGGGGGAAGG - Intronic
955701332 3:61685011-61685033 GAGGAGTAACAGAGAGAGGGAGG - Intronic
956330328 3:68099986-68100008 GGGGACAACTAGAAAGGGGAGGG + Intronic
956342527 3:68241857-68241879 CAGGACTAACAGAAAGCGCAGGG + Intronic
956540146 3:70327610-70327632 GAAGACTACCAGAAAGGAAAAGG + Intergenic
956783777 3:72625314-72625336 GAGGACTACAAGAAAAAGCAGGG + Intergenic
956806556 3:72819608-72819630 GAGGAATAAGAGGAAGAGGAAGG + Intronic
957744265 3:84318197-84318219 GAGCACCATCAGAAAGTGGATGG - Intergenic
957805892 3:85148871-85148893 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
957840717 3:85665659-85665681 GTGGACTACCAGAAAGACAAAGG - Intronic
958075835 3:88677033-88677055 GAGGAGGAGCAGAAAAAGGAAGG - Intergenic
959241768 3:103806074-103806096 GAGGATTACAAGACTGAGGAGGG - Intergenic
959912494 3:111779401-111779423 GGGGACTACTAGAGGGAGGAGGG - Intronic
960367223 3:116787254-116787276 GAGGACTACAAGAAGGGGGAGGG - Intronic
960600607 3:119454369-119454391 GAGGAGTCCCAAAAATAGGAGGG - Intronic
960871596 3:122255117-122255139 GAGGACAACCAGGATGATGACGG - Intronic
961790420 3:129371961-129371983 GAGGACTACTAGAGGGAGGAGGG - Intergenic
962385646 3:134930199-134930221 GAGAACTACCAGATATAGGAAGG + Intronic
964177153 3:153837888-153837910 GAGGACTACCACAAAGATCCAGG + Intergenic
965063712 3:163816050-163816072 GAGGACTACTAAAAGGAAGAGGG + Intergenic
966370944 3:179250150-179250172 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
967470905 3:189861002-189861024 GAGGACTCCAAAAATGAGGAAGG - Intronic
967533710 3:190578046-190578068 GAGAACTACCAGAGGGAGGTGGG + Intronic
967702209 3:192606359-192606381 GAGGACTACCAGAAAGAGGAGGG + Intronic
967774397 3:193371615-193371637 GCTGACTACCAGCAAGAGAATGG - Intronic
969620505 4:8276536-8276558 GAGGGCTTCCTGTAAGAGGAGGG + Intronic
970148533 4:13065003-13065025 CAGGAGTACCTGAAAGAGAAGGG - Intergenic
971264836 4:25088360-25088382 GAGGACTGTCAGAAAGTGGGGGG + Intergenic
971868774 4:32208483-32208505 GAGGACTGAAAGAAAGAAGAAGG - Intergenic
971915066 4:32858988-32859010 GAGTACCACCAGACAGAGCAAGG - Intergenic
972189378 4:36571587-36571609 GTGGAATACCAGGAACAGGAGGG + Intergenic
972374792 4:38460211-38460233 GAAGAATACAAGAAAGAGGGTGG + Intergenic
972834105 4:42847908-42847930 GGGGACTAGCAGAGAGTGGAGGG - Intergenic
973047101 4:45548247-45548269 GGGGACTACTACCAAGAGGAGGG + Intergenic
973126274 4:46589404-46589426 GGGGACTATCAGAAGGTGGAGGG - Intergenic
973221933 4:47736636-47736658 GGGGTCTACCAGAAGGTGGAGGG - Intronic
973556954 4:52092979-52093001 GGGGACCACCAGAGAGTGGATGG + Intronic
973658860 4:53081401-53081423 GTGGACTAGTAGAAAGTGGAGGG - Intronic
974120068 4:57627442-57627464 GGGGACTACTAGAAGGTGGAGGG + Intergenic
974928828 4:68337128-68337150 GAGAGAGACCAGAAAGAGGAGGG - Exonic
975699745 4:77052120-77052142 GGGGACTACTAGAAGGGGGAGGG - Intronic
976197584 4:82548171-82548193 GAGGACTACCAGAGAGGGGAGGG + Intronic
976703530 4:87997264-87997286 AAGAACTACCAGAAAGAAGCAGG - Intergenic
976855880 4:89604890-89604912 CAGGAGTCCCAGAAAGAGGGAGG + Intergenic
976874520 4:89837160-89837182 GAGGACTAGGAGGAGGAGGACGG - Intronic
976909118 4:90278663-90278685 GAGGACCACTAGAAAAAGGGGGG + Intronic
977040512 4:92011449-92011471 GTGGACTACTAGAGAGTGGAGGG - Intergenic
977273579 4:94948360-94948382 GAGTAGTACCAGAGAGAGCAAGG + Intronic
977671320 4:99698894-99698916 GAGGACGACCAGAAGCAGGGTGG + Intergenic
978949461 4:114540201-114540223 GGGGACTACTAGAAGGAGGAGGG - Intergenic
979026588 4:115585084-115585106 GAGGACTACTAGAAGAAAGAGGG - Intergenic
979805814 4:124969638-124969660 GTGGACTACTAGAGAGAAGAGGG - Intergenic
980174233 4:129325319-129325341 GAGAACAACCTTAAAGAGGAAGG - Intergenic
980211497 4:129794185-129794207 GAGAAGGACGAGAAAGAGGAGGG - Intergenic
980555624 4:134400105-134400127 GTGGACTACTAGAGAGTGGAGGG - Intergenic
981325685 4:143444768-143444790 GGGTACTACCAGAGAGGGGAAGG - Intronic
981447511 4:144857096-144857118 GGGGACTACTAGAATGGGGAGGG + Intergenic
981529024 4:145734337-145734359 GAGGACACTCAGAAAGTGGAGGG + Intronic
981565839 4:146100469-146100491 GGGGACTACTAGAATGGGGAGGG - Intergenic
982499889 4:156140480-156140502 GAGGATTACTTGAAAGTGGAGGG + Intergenic
982618625 4:157675560-157675582 GAGGACTTTCAGAAAGAAGGTGG + Intergenic
982644181 4:158001991-158002013 GAGGAATAAAAGAAACAGGAAGG - Intergenic
982786508 4:159543227-159543249 GAGGACTGAGAGAAAGGGGATGG + Intergenic
983174743 4:164575212-164575234 GGGGACTACTAGAGAGGGGAGGG + Intergenic
983956332 4:173702879-173702901 GAGGACTCCAAAAAAGAAGAGGG + Intergenic
984551964 4:181171301-181171323 GAGGAGCACCAGGAAGAGGATGG - Intergenic
984596650 4:181676527-181676549 GGGGACTACCAGAGAGGAGAGGG - Intergenic
986054323 5:4120881-4120903 GAGGTCTACCAGAGGGTGGATGG + Intergenic
986113218 5:4741387-4741409 GAGGACTACCAGATGGAGGAGGG + Intergenic
986669767 5:10132515-10132537 GAGGACAGCTGGAAAGAGGATGG + Intergenic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987270592 5:16304484-16304506 CAGGAATACCAGAATGAGCAAGG + Intergenic
987665510 5:20933323-20933345 GAGGACGAGGATAAAGAGGAAGG + Intergenic
988624512 5:32858730-32858752 GAGGACTACTAGAAGGAGGAAGG - Intergenic
988757185 5:34268855-34268877 GAGGACGAGGATAAAGAGGAAGG - Intergenic
989568224 5:42922720-42922742 GAGGACTACAAGCAAGAAAATGG - Intergenic
990586227 5:57213887-57213909 GATGACTGCAAGAAAGAAGAGGG - Intronic
991013749 5:61910507-61910529 AAGCACTACCCGAAAGTGGACGG - Intergenic
991119099 5:62990372-62990394 GTGGACTACTAGAAGGGGGAGGG + Intergenic
991894952 5:71385513-71385535 GAGGAATTCCAGAACGAGGTGGG - Intergenic
992161333 5:74006542-74006564 GAGGACTACTGGAGGGAGGAGGG - Intergenic
992263758 5:74996769-74996791 GGGGACTACTAGAGCGAGGAGGG + Intergenic
993683754 5:90912539-90912561 GGGGACTACTAGAATGTGGAAGG - Intronic
994256759 5:97606111-97606133 GGGGACTACAAGAAGGAAGAGGG + Intergenic
994676908 5:102834748-102834770 GAGAACTACCAGGAAGGGAAGGG + Intronic
996288381 5:121822824-121822846 GTGGACTACCAGAGGGTGGAGGG - Intergenic
996576644 5:124983268-124983290 GAGGACTACTAGAAGGAGAAGGG - Intergenic
996672253 5:126132327-126132349 GAGTAAAACAAGAAAGAGGAGGG + Intergenic
996844722 5:127886483-127886505 GAGGAGGACGAGGAAGAGGAGGG - Intergenic
997352396 5:133240337-133240359 GAGGACTCTGAGAAAAAGGATGG - Intronic
997455597 5:134015198-134015220 GTGGACTACAAGAGAGGGGAGGG + Intergenic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
999336228 5:150719327-150719349 GAGGACTCCAAGGAAGAGAAGGG + Intronic
999539400 5:152555278-152555300 AAGGACTACTAGAGAGGGGAGGG + Intergenic
1001377595 5:171277335-171277357 TATGACTACCACAAAAAGGATGG + Intronic
1001387295 5:171350256-171350278 GAGGACTACTAGATGGGGGAGGG - Intergenic
1001459660 5:171899916-171899938 AAGGACTTTCAGAAAGAAGAGGG - Exonic
1002652065 5:180705785-180705807 GAGGACTACTAGAAGGGGGGAGG - Intergenic
1003389651 6:5702812-5702834 TAGGACTAAGAGAATGAGGAGGG + Intronic
1004641021 6:17515445-17515467 GAGGACTGCTAGAGATAGGATGG + Intronic
1004972473 6:20926580-20926602 GAACAGTACCAGAAAGAAGAAGG + Intronic
1006416339 6:33906325-33906347 GAAGACAACCTGAAAGAGCAAGG - Intergenic
1007188061 6:39989465-39989487 TAGGCCTATCAGAAAGGGGAGGG - Intergenic
1009198486 6:60715761-60715783 TGGGACTACTAGAAGGAGGAGGG + Intergenic
1009768507 6:68114291-68114313 GAGGCATGCCAGGAAGAGGAGGG - Intergenic
1010685709 6:78853224-78853246 GAGAAATGCCAGAAAGAGAAGGG - Intergenic
1011862489 6:91777121-91777143 GGGGACTACTAGAGAGGGGAGGG + Intergenic
1012490150 6:99774070-99774092 GGGGCCTACCAGAAGGTGGATGG - Intergenic
1013419603 6:109954820-109954842 GAAGACTACCAGAAGGAGAGGGG + Intergenic
1013479278 6:110539285-110539307 GTGGACTACTAGAGGGAGGAGGG - Intergenic
1014255752 6:119158879-119158901 TAGGGCAACCAGACAGAGGAAGG - Intergenic
1014274170 6:119368101-119368123 CAGGACTACTAGAAGCAGGAGGG + Intergenic
1014660283 6:124161782-124161804 GAGGACTACTGGAGAGGGGAAGG + Intronic
1014877973 6:126684726-126684748 GTGGACTACTAGAAGGGGGAGGG + Intergenic
1015268944 6:131319395-131319417 GAGGACTACTAGAAGGGAGAAGG + Intergenic
1015445577 6:133300211-133300233 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
1015582173 6:134737357-134737379 GGGGACTACCAGAAATAGTTGGG + Intergenic
1015841764 6:137484744-137484766 GGGGACTACCAGTGAGGGGAGGG + Intergenic
1015857104 6:137636511-137636533 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1015977648 6:138807069-138807091 GAGGAGGAAGAGAAAGAGGAAGG + Intronic
1016353802 6:143195725-143195747 GAGCACTTCCAGAAGGAGGCAGG + Intronic
1016617306 6:146066223-146066245 GGGGAATACAAGAGAGAGGAAGG - Intronic
1016784548 6:147995760-147995782 CAGGACTACCAGAGCAAGGAAGG + Intergenic
1017328341 6:153166279-153166301 GAGCAGGACAAGAAAGAGGAAGG + Intergenic
1018322905 6:162632486-162632508 GGGGACTATGAGAAGGAGGAGGG + Intronic
1018346167 6:162901142-162901164 GAGGACTGTCATAAAGAAGAGGG + Intronic
1018410573 6:163542241-163542263 GAGGATTAACGGAAGGAGGAAGG - Intronic
1020618903 7:10495461-10495483 GAGGACTACTAGAGTGGGGAGGG - Intergenic
1020682959 7:11259303-11259325 AAGGACAGCCAGAAATAGGAAGG - Intergenic
1020946157 7:14610365-14610387 GGGGACTACCAGAGTGGGGAAGG + Intronic
1021499830 7:21320244-21320266 GAGGACTAAGAAGAAGAGGACGG + Intergenic
1021952815 7:25791629-25791651 GGGAACTACAAGAAGGAGGAGGG - Intergenic
1022030738 7:26489915-26489937 GGGCACTGGCAGAAAGAGGAAGG - Intergenic
1022961904 7:35435218-35435240 GGGGACTACAAGAAGGGGGAGGG + Intergenic
1023047377 7:36222381-36222403 GAGGAGGACAAGGAAGAGGAGGG + Intronic
1023677435 7:42645016-42645038 AAGGACTACCAGAAGGAAGAGGG + Intergenic
1024355353 7:48408847-48408869 GAGGTCTACCAGATGGTGGAGGG - Intronic
1024657087 7:51459996-51460018 CAGGATTCCCAGAAAGAGCAAGG + Intergenic
1025236235 7:57236627-57236649 GAGGAATAAGAGAAAGAGGAGGG - Intergenic
1026033933 7:66817512-66817534 GAGTTCTCCCATAAAGAGGAGGG - Intergenic
1026328642 7:69333100-69333122 AAGGACTACCGTAATGAGGACGG + Intergenic
1026547512 7:71336497-71336519 GAGGCCTACTTGAAAGTGGAGGG - Intronic
1026842977 7:73681103-73681125 GAGGTCTACGAGAAGGATGAGGG - Exonic
1026985659 7:74553845-74553867 GAGTTCTCCCATAAAGAGGAGGG + Intronic
1027229600 7:76264555-76264577 CAGGACTTCCAGGAGGAGGAAGG + Intronic
1027430096 7:78103025-78103047 GAGGAATTCCAGATAGAAGAAGG - Intronic
1027444939 7:78262981-78263003 GGGGACTACTAGACAGAGGAGGG - Intronic
1027605815 7:80297191-80297213 CAGGAATAACAGAAAGAGGCAGG - Intergenic
1027903430 7:84148733-84148755 GAGGAGGATCAGGAAGAGGAGGG - Intronic
1027923707 7:84432540-84432562 GGAGACTACCAGAAAGAGGAGGG - Intronic
1027949390 7:84794911-84794933 GGGGACTACTAGAGTGAGGAGGG - Intergenic
1028921327 7:96313600-96313622 GGGGACTACTAGAGGGAGGAGGG + Intronic
1028922886 7:96326405-96326427 GAGGAATTCTAGAATGAGGAGGG - Intergenic
1030463301 7:109868053-109868075 AAGGACTACCAGAGGGAAGATGG + Intergenic
1030786410 7:113668795-113668817 CTGGACTACTAGAAAGGGGAGGG + Intergenic
1030924557 7:115435861-115435883 GGGGACTACTAGAGAGGGGAGGG + Intergenic
1031731312 7:125304394-125304416 GTGGACTACTAGAAAGTGGAGGG + Intergenic
1031943999 7:127819529-127819551 GAGGGCCACCATAAAGAGGCAGG + Intronic
1032453465 7:132054169-132054191 GAGGAATTCCAGTGAGAGGAGGG + Intergenic
1032523275 7:132561942-132561964 GAGGAGGAGGAGAAAGAGGAGGG - Intronic
1033284790 7:140031818-140031840 AATGACTTCCAGAAATAGGAGGG + Intronic
1035413382 7:158664206-158664228 GAGGACGAGGAGGAAGAGGACGG - Exonic
1035688991 8:1547523-1547545 GGGGCCTGCCAGAAGGAGGAAGG + Intronic
1035763721 8:2088424-2088446 GAGGCCTACCAGACAGAGCAAGG - Intronic
1036744064 8:11391512-11391534 AAGGAGTTCCAGAAGGAGGACGG - Intronic
1038679332 8:29652425-29652447 GAGGAAGAGAAGAAAGAGGAAGG + Intergenic
1039340112 8:36638741-36638763 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1040410397 8:47148484-47148506 GGGGACTACCAGACAGAGAACGG + Intergenic
1041312952 8:56535012-56535034 GAGGAGGAAGAGAAAGAGGAGGG + Intergenic
1041728405 8:61039996-61040018 GAGGACTACTAGAAGGAGTGAGG - Intergenic
1041731494 8:61067811-61067833 GGGGACTACTAGAAGGGGGAGGG + Intronic
1042360433 8:67876859-67876881 GGGGAATACAAGAAGGAGGAAGG + Intergenic
1042491910 8:69409354-69409376 AAGAACTAGCAGAAAGAGAAGGG + Intergenic
1043214168 8:77564571-77564593 GAGGCCTTCCAGAAGGTGGAAGG + Intergenic
1043835909 8:85045675-85045697 GTGGACTACCAGAGAGGGGAGGG - Intergenic
1044036634 8:87311933-87311955 GGGGACTACCAGAGTGGGGAGGG + Intronic
1045048059 8:98297685-98297707 GCGGACTACTAGAGAGGGGAGGG - Intergenic
1046421338 8:113987148-113987170 GTGGACTACTAGAGAGGGGAAGG + Intergenic
1047220878 8:122917214-122917236 GAGGACTCCCAGAAATAGTTAGG - Intronic
1047359621 8:124156172-124156194 GGGGACTACTAGAGGGAGGAGGG - Intergenic
1048034655 8:130666068-130666090 GAAGAGTACCAGAGAGAGGTTGG + Intergenic
1048041989 8:130739534-130739556 GGGGACTACAAGAGAGGGGAGGG + Intergenic
1048124708 8:131621017-131621039 GAGGACTACTAGAGAGGGGAGGG + Intergenic
1048220096 8:132533183-132533205 GAGGAGGATGAGAAAGAGGAAGG + Intergenic
1048311599 8:133326747-133326769 GAGGGCTGCCAGAAAGAAAAAGG + Intergenic
1048421505 8:134282814-134282836 CAGGACTACTAGAAAGTGGGAGG + Intergenic
1048668027 8:136686209-136686231 GGGGCCTACCTGAAAGTGGAAGG + Intergenic
1048681678 8:136849494-136849516 GAGGACTACAAGAGCGGGGAAGG + Intergenic
1048788061 8:138073039-138073061 GGGGACTACTAGAGAGGGGAGGG + Intergenic
1048966496 8:139618651-139618673 GAGGACGACCAGGTTGAGGAAGG + Exonic
1049885480 9:23537-23559 GAGGACTTTCAGGAAGAGGTGGG + Intergenic
1050569013 9:6918174-6918196 GGGGACTACCAGAATGAGAGAGG - Intronic
1051391955 9:16574786-16574808 GAGGATTACATGAAAGAGTAGGG - Intronic
1051462132 9:17332226-17332248 TAGGACAACCAGAAACAAGAGGG - Intronic
1051712275 9:19944099-19944121 GAGGACTACTAGGCAGGGGAGGG + Intergenic
1052116028 9:24649252-24649274 CAGGACTACCAGCTACAGGAAGG + Intergenic
1053160426 9:35810136-35810158 GAGGAGTGCCAGGATGAGGATGG + Intronic
1053298854 9:36934660-36934682 GAGGGCTTCCTGGAAGAGGAAGG - Intronic
1053344083 9:37365134-37365156 GAAGACTACCAGAAGAAGGGCGG - Intergenic
1055504427 9:76933196-76933218 GAGGGCTACGAAAAAGAGGCTGG + Intergenic
1056337226 9:85584377-85584399 AAGGAATACATGAAAGAGGAAGG - Intronic
1056485228 9:87049877-87049899 GGGGACTACCAGAAAGCAGAGGG - Intergenic
1056543219 9:87592236-87592258 GAGGAAACCCAGCAAGAGGAAGG + Intronic
1056778063 9:89528442-89528464 GAGGAATCCCAGAGAGAGCAAGG + Intergenic
1057261569 9:93587517-93587539 GAGGAGTCCCAGATAGTGGATGG + Intronic
1057379233 9:94553887-94553909 GGAGGCCACCAGAAAGAGGAAGG + Intergenic
1058483903 9:105424164-105424186 GAAGAGGACCAGAGAGAGGAGGG - Intronic
1059035680 9:110751392-110751414 GAGAAAGACCAGAATGAGGATGG + Intronic
1059631342 9:116126238-116126260 GGAGACTACTAGATAGAGGAGGG - Intergenic
1059708290 9:116843731-116843753 GGGGACTACCAGATGGGGGAAGG + Intronic
1059748396 9:117225207-117225229 GAGGACTGCCAGACAGATGTAGG - Intronic
1060080620 9:120640860-120640882 GGGGACTACTAGAAGGGGGAGGG - Intronic
1062000433 9:134213214-134213236 TAGGAAAACCAGAAAGTGGAAGG + Intergenic
1186431094 X:9504836-9504858 GTGGAGTACCAGAAGGAGGTGGG + Intronic
1187142865 X:16611025-16611047 GGGAACTACCAGAGGGAGGAAGG + Intronic
1187280200 X:17852660-17852682 AGGGACTACCAGAAAGAATATGG + Intronic
1187649559 X:21387390-21387412 GAGGATCACCAGAACCAGGAAGG + Intronic
1188043567 X:25399282-25399304 GAGGACTACTAGAAGGCAGAGGG + Intergenic
1188065325 X:25652119-25652141 GGGGACTACTAGACAGGGGAGGG - Intergenic
1188580587 X:31707457-31707479 GGGGACTACTAGAGGGAGGAGGG + Intronic
1188583424 X:31743677-31743699 GAGGACTACTAGAGTGGGGAGGG + Intronic
1188790368 X:34402162-34402184 GTGGACTACTAGAAGCAGGAGGG + Intergenic
1188889504 X:35592852-35592874 GTGGACTACCAGAGTGGGGAAGG - Intergenic
1189422735 X:40870984-40871006 GGGGACTACTAGAAGGGGGAGGG - Intergenic
1189424624 X:40886986-40887008 GAGGACTACTAGAGGGAGGAGGG - Intergenic
1190870077 X:54417491-54417513 GGGGACTACCAGAATGGGGAGGG + Intergenic
1191047027 X:56149420-56149442 GAAGACTACTAGAAAGTGGAGGG + Intergenic
1192204149 X:69085183-69085205 GAGGAGGAGAAGAAAGAGGAGGG - Intergenic
1192341877 X:70269633-70269655 GGAGAAAACCAGAAAGAGGATGG - Intronic
1192991332 X:76460777-76460799 GGGGACTACTAGAAGAAGGAGGG + Intergenic
1193070716 X:77303113-77303135 GGGGACTACTAGATGGAGGAGGG + Intergenic
1193495962 X:82213287-82213309 GGGGCCTACCAGAGGGAGGAGGG - Intergenic
1194023213 X:88720076-88720098 GAGGACTACCAGACAGGAGAGGG - Intergenic
1194112123 X:89847537-89847559 GAGGCCTACCTGAAGGTGGAGGG + Intergenic
1194320439 X:92440311-92440333 GAGGACTACCAGAGTGGGGAGGG - Intronic
1194377998 X:93159915-93159937 GAAGACTACCTGAAAGGGGAAGG + Intergenic
1194753695 X:97712515-97712537 GGGGACTACTAGAAATAGGAAGG + Intergenic
1195728615 X:107942385-107942407 GGGGACTACCTGAAGGAGAAGGG + Intergenic
1195930743 X:110072995-110073017 GGGGACTACAAGAGAGGGGAGGG - Intronic
1195931913 X:110086871-110086893 GAGGAATACCATAATGGGGATGG + Intronic
1196039741 X:111189076-111189098 GGGGACTACTAGAGTGAGGAAGG - Intronic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196964184 X:121037817-121037839 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1197538819 X:127728370-127728392 GAAGACTACTTGTAAGAGGAGGG + Intergenic
1197576450 X:128218075-128218097 GTGGACTACTAGAGGGAGGATGG + Intergenic
1198787962 X:140312061-140312083 GGGGACTACTAGAAGGGGGAGGG + Intergenic
1199236016 X:145493519-145493541 GAGGACTACCCGAAGCCGGAGGG + Intergenic
1199426378 X:147705666-147705688 GGGGACTACTAGATAGAGGAGGG + Intergenic
1199539145 X:148939105-148939127 GAGGAAGACAAGAAAGAGGAAGG + Intronic
1200464778 Y:3502317-3502339 GAGGCCTACCTGAAGGTGGAGGG + Intergenic
1200628553 Y:5553441-5553463 GAGGACTACCAGAGTGGGGAGGG - Intronic
1201312742 Y:12611861-12611883 GAGGACGAGCAGAAAGAGGGTGG + Intergenic
1201484167 Y:14474612-14474634 GGGGACTACTAGAGGGAGGAAGG - Intergenic
1201770651 Y:17614363-17614385 GAAAACTACCAGAAAGACCAGGG - Intergenic
1201830904 Y:18291623-18291645 GAAAACTACCAGAAAGACCAGGG + Intergenic