ID: 967702640

View in Genome Browser
Species Human (GRCh38)
Location 3:192611338-192611360
Sequence CAGAAAAGGAGGCTGTTATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 266}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967702637_967702640 -6 Left 967702637 3:192611321-192611343 CCTACATACACAGTGGTCAGAAA 0: 1
1: 0
2: 5
3: 11
4: 201
Right 967702640 3:192611338-192611360 CAGAAAAGGAGGCTGTTATCAGG 0: 1
1: 0
2: 0
3: 18
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967702640 Original CRISPR CAGAAAAGGAGGCTGTTATC AGG Intronic
900736912 1:4304916-4304938 CAGACATGGAGGCTGTTGTTGGG + Intergenic
902432937 1:16377606-16377628 GAGAAAAGTAGGCCGTTAACTGG - Intronic
902669268 1:17961327-17961349 CAGATGAGGAGGCTGAGATCTGG - Intergenic
903018144 1:20375213-20375235 CAGAAAAAGTGGCTATTGTCTGG + Intergenic
903341942 1:22660208-22660230 CAGATGAGGAGGCTGTCCTCAGG + Intronic
904074282 1:27828408-27828430 CTGAAAAGGAGGATATTAACAGG + Intergenic
905252673 1:36659517-36659539 TAGAAAAAGAGGCTGTTAGTTGG + Intergenic
905632887 1:39528627-39528649 CAGGAAAGGAGGCTGTGAAAAGG + Intergenic
906120604 1:43387942-43387964 CTGGAAAGGAGGCTTTTACCCGG - Intronic
907250127 1:53132504-53132526 AGGAAAAGGAGGCAGTTTTCTGG + Intronic
909586165 1:77291112-77291134 CAGACAAAGAGGCTGTAATTTGG + Intronic
910112598 1:83698767-83698789 CAGAAAAGCAGATTGCTATCTGG + Intergenic
910216818 1:84851779-84851801 TAGAAAAGGAGGCTGGGAACAGG + Intronic
910261517 1:85297864-85297886 CAGGAAAGGTGGCTTTTATTTGG + Intergenic
913257224 1:116964437-116964459 CAGAAAAGGAGGCTGAGAAATGG - Intronic
914949723 1:152102068-152102090 CAGAAAAGGAGGCTTTCATAAGG + Intergenic
915546675 1:156602855-156602877 CAGAAAAGGATACTTTTCTCGGG - Intergenic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
920699126 1:208204444-208204466 CAGGAAAGGAGTTTGTTTTCTGG - Intronic
921000161 1:211036049-211036071 CAGGAAAGAAGGCTTTAATCGGG + Intronic
922882406 1:228990713-228990735 CCAGAAAGGAGGCTGTTTTCTGG + Intergenic
1064855297 10:19760595-19760617 CACAGAAGGTGGCTGTTTTCAGG + Intronic
1067988214 10:51177508-51177530 CAGAAAAAGAGGATGTGATGTGG - Intronic
1068245484 10:54360383-54360405 CAGAAAAGAAGGATTTAATCAGG - Intronic
1068611412 10:59064508-59064530 CAGAAAAGGGGACTTTAATCTGG - Intergenic
1068906110 10:62324731-62324753 CAGCAAAGGAAACTGTTAACAGG + Intergenic
1069924523 10:71839061-71839083 CAGAGAAGGAAGCTGGTATTTGG - Intronic
1071192483 10:83117937-83117959 CAGAAATGGAGAATGTTTTCAGG + Intergenic
1071981237 10:91005980-91006002 GAGAAATGAAGCCTGTTATCTGG - Intergenic
1072393050 10:95008755-95008777 CAGAAAAGAAGACAGTTATGTGG - Intergenic
1073447236 10:103589059-103589081 CAGAAAAGGTGGGTGATATCTGG + Intronic
1074591711 10:114820323-114820345 GAGAAAAGGTGGCTGTCATATGG - Intergenic
1074792788 10:116908117-116908139 CAGAAAAGTAACCTGTTGTCAGG + Intronic
1078800278 11:14636773-14636795 CAGAAAAGGAGACTGTGAAGAGG - Intronic
1078864034 11:15280240-15280262 CATTAATGGAGGTTGTTATCTGG - Intergenic
1078897708 11:15612193-15612215 CAGTAAAGGATGCTGCAATCTGG + Intergenic
1079976732 11:27100908-27100930 CAGGACAGGTGGCTGTTATTGGG + Intronic
1082031426 11:47607174-47607196 GAGAAAAAGTGGCTATTATCAGG + Intergenic
1082620206 11:55411310-55411332 CAGAAGAGGAGCCTGTTAGAAGG - Intergenic
1083772500 11:64876291-64876313 CAACAAAGGAGGCTTTTCTCTGG - Intronic
1084144723 11:67258922-67258944 CAGGTAAGGAGGCAGTTCTCTGG - Intergenic
1086916643 11:92537445-92537467 CAGGAAAGGAGGCTGCTAAGGGG - Intronic
1087265667 11:96058252-96058274 CAGAAAAGGAGGCAATGATGAGG + Intronic
1087636502 11:100707872-100707894 CACAAAAGAAGGCAGCTATCTGG - Intronic
1087709269 11:101530601-101530623 CAGAAAATGGGCCTGTTACCAGG - Intronic
1089323498 11:117642045-117642067 CAGAAAAGGGAGCTGTCACCAGG - Intronic
1092703012 12:11254128-11254150 CTTAAAATGAGGCTGTTATGGGG - Intergenic
1094365246 12:29672932-29672954 CAGAAAAGTCAGCTGTTCTCTGG - Intronic
1096761689 12:53846929-53846951 GAGAAAAGGAGGCAGTTGGCAGG - Intergenic
1096763542 12:53863697-53863719 CAGAAAATGAGTTGGTTATCTGG + Intergenic
1096982877 12:55738401-55738423 GAGAGAAGGAGGCTGTGTTCCGG - Intergenic
1099473299 12:83076792-83076814 CAGAAAAAGAGGGTGTTACAGGG - Intronic
1103900463 12:124301154-124301176 CAGAAAGGGAGGCTGTGAGGAGG + Intronic
1104174226 12:126313782-126313804 GACAAAAGGAGGCTGTGATCTGG + Intergenic
1104915761 12:132263647-132263669 CAGAAAAGGAGCTTGCTGTCAGG - Intronic
1106091123 13:26594960-26594982 CAGAAAAGGAAGTTGTTGTTGGG - Intronic
1106798592 13:33232952-33232974 CAGAGAAGAAGGCTTTAATCAGG - Intronic
1108040053 13:46331592-46331614 CAAAAAAGGAGGCTGTGCTGTGG + Intergenic
1111142381 13:84136535-84136557 CAGAAAATGAGGCTTTTACCTGG + Intergenic
1111430383 13:88142357-88142379 CAAGAAAGAAGGCTGTAATCAGG + Intergenic
1111865224 13:93759803-93759825 CAGAAAGGTAGGCTGTTCTTGGG + Intronic
1112043201 13:95569007-95569029 CATACTAGGAGGCTGTTGTCAGG + Intronic
1112141727 13:96651268-96651290 CAGAAAAAGAGGATGATATTAGG - Intronic
1112557932 13:100486113-100486135 CAGAGAATGAGGCAGTTTTCAGG - Intronic
1113189638 13:107729326-107729348 CAGAAAAGGAGACTTTTAATAGG - Intronic
1114084404 14:19229012-19229034 AAGAAAAGGAGCCTGTGAGCAGG - Intergenic
1114485579 14:23059515-23059537 CACAAATGGAGGCTGTGACCAGG - Intronic
1115957061 14:38793370-38793392 CAGAGAAGGAAGCTCTGATCAGG + Intergenic
1116682076 14:47984475-47984497 CAGACAGCAAGGCTGTTATCAGG - Intergenic
1116778067 14:49204083-49204105 CAGGAAAGGATGCTATTAACCGG + Intergenic
1202896009 14_GL000194v1_random:10856-10878 AAGAAAAGGAGCCTGTGAGCAGG - Intergenic
1123837859 15:24214185-24214207 GAGAAAAGGAGGTGTTTATCTGG + Intergenic
1123847394 15:24316484-24316506 GAGAAAAGGAGGTGTTTATCTGG + Intergenic
1123866444 15:24523862-24523884 GAGAAAAGGAGGTGTTTATCTGG + Intergenic
1124674383 15:31671039-31671061 CAGCAAAGGAAGCTGTTGTCAGG - Intronic
1125411239 15:39408570-39408592 AAGAAAATGATGTTGTTATCAGG + Intergenic
1125481897 15:40086950-40086972 CAGAAGAAGAGGCAGTTATTTGG + Intergenic
1125814542 15:42573685-42573707 CAGAAAATGAAGCTTTTATGTGG + Intergenic
1127056189 15:55134485-55134507 AAGATAAGGAGGCAGCTATCAGG - Intergenic
1127601717 15:60544142-60544164 CAGAAGAGGAGGCTGAGCTCTGG - Intronic
1127723687 15:61726872-61726894 CAGAAAAGGGGACTGTTCCCAGG - Intergenic
1128372020 15:67047392-67047414 CAGACCAGGAGGCTGTGATTTGG + Intergenic
1128612211 15:69083278-69083300 AAGAAAAGGAGACTGTCTTCAGG - Intergenic
1133776871 16:8903581-8903603 TAGAAAAGGAGGCTGTGGGCAGG + Intronic
1135097648 16:19577837-19577859 CCGGAAAGCAGGCTGTCATCAGG + Intronic
1136005432 16:27325832-27325854 TAGCAGAGGAGGCTGTTAGCAGG - Intronic
1136550282 16:30979278-30979300 CAGAGAAGGAGACAGTTTTCCGG - Exonic
1137483193 16:48869507-48869529 AAAAAAAGGAGACAGTTATCTGG - Intergenic
1137709977 16:50559845-50559867 CATAAAAGGACCCTGTTAGCAGG + Intronic
1140854813 16:78968650-78968672 CTGCCAAGGAGGCTGATATCGGG + Intronic
1141363244 16:83417279-83417301 CGGAAAGGGAGGCTGTTCTGGGG - Intronic
1142721466 17:1778861-1778883 GAGAAAAGGAGTCTCTTTTCAGG + Intergenic
1143604546 17:7974856-7974878 CAGAGAAGAAGGCTATAATCAGG + Intergenic
1144586585 17:16491452-16491474 CAGAGAAGGAGGCTGGTCTCCGG - Intronic
1150805602 17:68316401-68316423 CAGATAAGGAGGCTGCTGTAAGG - Intronic
1151010342 17:70486125-70486147 TAGAAAATGAGTCTATTATCTGG - Intergenic
1151124421 17:71829408-71829430 TAGTGAAGTAGGCTGTTATCTGG + Intergenic
1151880713 17:76892940-76892962 TAGAAAAGGACACTCTTATCAGG + Intronic
1152630521 17:81408806-81408828 CAGGAAAGGTGGCTGATATCAGG - Intronic
1154400991 18:14037071-14037093 CTGAAAAACAGCCTGTTATCTGG + Intergenic
1156526452 18:37772166-37772188 CAGATAAGCAGGATGTTGTCTGG + Intergenic
1157528531 18:48403614-48403636 CAGACAAGGTGCCTGTTCTCAGG + Intronic
1157837523 18:50919925-50919947 AAGAAAAGCAGGCTGTTATTAGG - Intronic
1157910761 18:51615506-51615528 CAGAAAGGGAGGCTGGCTTCTGG + Intergenic
1157967736 18:52227326-52227348 CAGCAAAGGAGTCTGCTAGCTGG - Intergenic
1158629350 18:59098884-59098906 CAGAGAAACAGGCTCTTATCAGG - Intergenic
1159516920 18:69470404-69470426 CAGAAAAGGAGACAGTTTCCTGG - Intronic
1160233436 18:77066836-77066858 CAGAAAACGAAGCTGATGTCCGG + Intronic
1161712853 19:5859566-5859588 AGGAAGAGGAGGCTGTTTTCAGG + Intergenic
1162589836 19:11584232-11584254 CAGGGAAGGGGGCTTTTATCTGG + Intronic
1164167091 19:22689937-22689959 AAGAAAAGGAGGCTTATATAGGG - Intergenic
1164607250 19:29608878-29608900 CAGAAAAGGAGGCTGGCACGTGG - Intronic
1165983227 19:39744214-39744236 CAGAAAAGGAAGATTTTATAGGG - Intergenic
1166561058 19:43732732-43732754 CAGAAAAGGAACCTGGGATCTGG + Intronic
1166597584 19:44063582-44063604 CAGAAAAGGAGGCTGGAAAGGGG + Intronic
1167973130 19:53201415-53201437 CAGAAAAGGAGGCTGATGAGGGG + Intergenic
925825398 2:7843532-7843554 CTAGAAAGGAGGCTGTTGTCTGG + Intergenic
926386905 2:12344352-12344374 CTCAAAAGGAAGCTGTTACCAGG + Intergenic
926797579 2:16631407-16631429 TGGAAAAAGAGGCTGTTGTCAGG + Intronic
927240025 2:20913236-20913258 CAGAAAAGCAGGCTTTGATTTGG + Intergenic
929337425 2:40766435-40766457 CAAAAAAGGAGGATGCTACCTGG + Intergenic
930311858 2:49752183-49752205 CAGAAAAGTGGGGTGGTATCTGG + Intergenic
930506088 2:52284274-52284296 CAGAGAAGAAGGCTTTAATCGGG - Intergenic
932221505 2:70003113-70003135 GAGAAAAAGAGGCAGTTGTCTGG - Intergenic
934713632 2:96530841-96530863 CGGCGAAGGAGGCTGTTCTCAGG + Intergenic
935845457 2:107161643-107161665 CAGAGAAGGAGGTTGTCCTCGGG - Intergenic
937190876 2:120096886-120096908 CTGAAAAGGAGGCTGGGATATGG + Intronic
937381246 2:121379168-121379190 CAGGAAAGGTGGGTTTTATCTGG - Intronic
937439518 2:121904276-121904298 CAGAAAATGGGGATGTTAACAGG + Intergenic
938492183 2:131767087-131767109 AAGAAAAGGAGCCTGTGAGCAGG + Exonic
938495384 2:131795256-131795278 AAGAAAAGGAGCCTGTGAGCAGG - Exonic
938550320 2:132374672-132374694 CAGGAAAGAAGGCTTTAATCGGG + Intergenic
939134921 2:138282348-138282370 AAGGAAAGGAGGCAGTCATCAGG - Intergenic
942507682 2:176660976-176660998 CTGAAAATGAGGCTGATATGTGG - Intergenic
943451889 2:188052862-188052884 CAGGAAAGAAGGCTTTAATCTGG + Intergenic
943569450 2:189556020-189556042 CAGAACAGGAGGGTGTGCTCTGG + Intergenic
943871987 2:193011656-193011678 CAGGAAGGGAAGCTGTGATCTGG + Intergenic
944591226 2:201219568-201219590 CAGAAACTGAAGCTGTTCTCAGG + Exonic
946060625 2:216937934-216937956 CAGAAAAGGACACTGGTAACTGG + Intergenic
946902008 2:224381756-224381778 CAGGAAAGGAGGCTCTTTTCGGG + Intronic
947315841 2:228857146-228857168 CAGATAAACAGGCTGTTATGAGG - Intronic
948103773 2:235396433-235396455 AAGAAAAGGTGTCTGTTATAAGG - Intergenic
1170286697 20:14717792-14717814 GAGATAGGGAGGATGTTATCAGG + Intronic
1171288192 20:23960790-23960812 CAGAGAAGAAGGCTTTAATCAGG + Intergenic
1172278587 20:33694656-33694678 GAGAATGGGAGGCTGTTTTCCGG - Intergenic
1172392191 20:34573454-34573476 CAGAGAAGAAAGCTGTTATCTGG + Intronic
1173257797 20:41407273-41407295 CAGACAAGGAGGCTGTGGGCTGG - Intronic
1174935378 20:54862064-54862086 CAGAAAGGGCCACTGTTATCTGG - Intergenic
1176615700 21:9026908-9026930 AAGAAAAGGAGCCTGTGAGCAGG - Intergenic
1176709472 21:10136895-10136917 AAGAAAAGGAGCCTGTGAGCAGG + Intergenic
1177603870 21:23354127-23354149 CAAAAAAGAAGGCTTTAATCAGG + Intergenic
1179919295 21:44498962-44498984 CAGCAGAGGATGCTGTTACCAGG + Exonic
1180293568 22:10864190-10864212 AAGAAAAGGAGCCTGTGAGCAGG + Intergenic
1180496373 22:15893605-15893627 AAGAAAAGGAGCCTGTGAGCAGG + Intergenic
1181871857 22:25905726-25905748 CAGATAAGGAGACTGATGTCTGG - Intronic
1184049230 22:41991885-41991907 GGGAAAAGGAGGCTTTTATGTGG - Intronic
1184250216 22:43255865-43255887 CAGAGAAGGAGGCTGAGGTCAGG + Intronic
951032432 3:17897005-17897027 AAGAATTGGAGGCTGATATCTGG + Intronic
952805904 3:37351774-37351796 CAGAAAACCATGCTGTTAACAGG + Intronic
953062000 3:39435030-39435052 CATCCAAGGAGGCTGCTATCTGG + Intergenic
953570891 3:44070805-44070827 CAGAAGAGGAGACTGCTACCTGG - Intergenic
955620005 3:60853089-60853111 CTAAAAAGGAGGCTCTTATATGG - Intronic
956068235 3:65419559-65419581 CAGAAATGTAGGCAGTTGTCTGG - Intronic
956073355 3:65478499-65478521 TTGAAAAGGATGCTGTTCTCAGG - Intronic
956236427 3:67077215-67077237 AAGAAAAGAAGGTTGTGATCTGG - Intergenic
957319160 3:78606886-78606908 CAGAAAAGGAAGCAGTTACAAGG - Exonic
957574668 3:81991559-81991581 CAGTAAAGCAGGGTTTTATCAGG - Intergenic
958718503 3:97817117-97817139 CAGAAAAAGTGGCTGTGAACTGG - Intergenic
959814619 3:110661213-110661235 CATAAAAGGAGTCTGCTATTAGG - Intergenic
962079845 3:132126633-132126655 CAGAAAGGGAGGCAGTTCTGTGG - Intronic
962398076 3:135034919-135034941 TGGACAAGGAGGCTGTCATCTGG + Intronic
962684565 3:137834726-137834748 CTGAGAAGGAGGCTGTTATGAGG - Intergenic
964804835 3:160597613-160597635 AAGAAAAGGATGCTGTTAGCAGG + Intergenic
967135862 3:186512122-186512144 GAGAGAGGGAGGCTGATATCTGG + Intergenic
967702640 3:192611338-192611360 CAGAAAAGGAGGCTGTTATCAGG + Intronic
967870866 3:194227857-194227879 CAGAAAAGGAGGAAGTTGGCAGG - Intergenic
970045351 4:11846553-11846575 TAGAAAAGGAAGATGTTATTTGG + Intergenic
970612965 4:17742718-17742740 CAGAAAGGGAGGCTGCCAACGGG - Intronic
971492911 4:27232969-27232991 AAGACTAGGAGGCTGTGATCTGG + Intergenic
971765906 4:30831309-30831331 CAGAAAAGGAGCCTGGGATATGG + Intronic
972395114 4:38652192-38652214 CAGAAATTAAGACTGTTATCTGG + Intergenic
972447787 4:39162565-39162587 CAGAAAATGAGGCAGTAATCAGG + Intergenic
972827621 4:42778971-42778993 CAGTCTAGGAGGCTGTTTTCAGG + Intergenic
973775742 4:54239709-54239731 GACAACAGGAGGCTGCTATCAGG - Intronic
974613544 4:64249814-64249836 CAGAAAAGAAGGCTTTATTCAGG - Intergenic
977027470 4:91837385-91837407 TAGAAAAGTGGGCTGGTATCTGG + Intergenic
977300321 4:95260260-95260282 AAGGAAAGGAGGCTGTTTTGTGG - Intronic
977786606 4:101042357-101042379 CACAAATGTAGGCTGTTTTCAGG - Intronic
978149800 4:105419931-105419953 AAGAAAAAGAAGCTGTTATTTGG - Intronic
979617452 4:122759835-122759857 CAAAAAAGGAGGGTGTAATGAGG - Intergenic
980678986 4:136130301-136130323 CAGAAAAGGAGGCTGTAGGCAGG + Intergenic
981827694 4:148962663-148962685 AAGGAAAGAAGGCTGTTATGGGG - Intergenic
982078566 4:151763548-151763570 CCGACAAGGTGGCTGTCATCTGG + Intergenic
983804569 4:171978410-171978432 CAGAAAAGGAGGGTGTTTAGGGG + Intronic
986809462 5:11340315-11340337 TAAAAAATGAGGCTGTTTTCAGG + Intronic
988310984 5:29556777-29556799 CAGAAGATGTGGCTGTTCTCTGG + Intergenic
988315635 5:29623204-29623226 CAGAAAAGAAGGTTTTAATCGGG + Intergenic
988584844 5:32499422-32499444 CAGAAAAGGAAGCTGTAACCTGG + Intergenic
989666724 5:43863066-43863088 CAGAAAGTGAGGCTGACATCAGG + Intergenic
990835513 5:60014924-60014946 CTGAAAAGGATCCTGTTCTCTGG - Intronic
990988404 5:61661924-61661946 CAGTAGAGGAGGCTGTGATGAGG + Intronic
991691750 5:69232140-69232162 CATAAAAGGATGCTGTTGACTGG - Intergenic
993952256 5:94191134-94191156 TAGAAAAGGAGCTTGTCATCAGG + Intronic
993954778 5:94218769-94218791 CAGATAAGTAGGATGTTAGCAGG - Intronic
994146485 5:96401361-96401383 CAGCAAACCAGGCTGTCATCTGG - Intronic
994710455 5:103258943-103258965 CAGAAAAGGTGGTGGTTATGGGG + Intronic
995136468 5:108685356-108685378 CAGAAGAGGAGCCTGTTAGAAGG - Intergenic
995256860 5:110056818-110056840 CAGAAAAGGGGGCTGATGTGGGG - Intergenic
995734384 5:115283782-115283804 GAGAAAAGGAGCCTATTATAAGG - Intronic
996613393 5:125411371-125411393 CAGGAATGGAGCCTGTTAGCTGG + Intergenic
996915801 5:128711051-128711073 CAGGAAAGGAGGCTTTAACCAGG - Intronic
997028338 5:130092719-130092741 CAGGAAAGAAGGCTTTAATCAGG + Intronic
997447672 5:133953316-133953338 CAGAAAAGAAGGCTGTCCTGAGG - Intergenic
999033684 5:148322439-148322461 CATAAAATGAGGCTGTTGACTGG - Intronic
999712864 5:154333754-154333776 GAGAAAAGGGGGCAGTGATCAGG - Intronic
1000056555 5:157612088-157612110 GAGAACAGCAGGCTGTTTTCAGG + Intergenic
1001425893 5:171622147-171622169 AAGGAAAGGAGGCTGACATCAGG + Intergenic
1001434055 5:171685788-171685810 CAAAAAATGAGGCTCTTTTCTGG - Intergenic
1005169829 6:22970078-22970100 AAAAAAATGAGGCCGTTATCAGG + Intergenic
1005578157 6:27209179-27209201 CAGAGAAGAGGGATGTTATCTGG + Intergenic
1005840804 6:29743591-29743613 TAGTAAAGGCGGCTGTGATCTGG - Intergenic
1006072565 6:31507926-31507948 TAGTAAAGGTGGCTGTGATCTGG + Intronic
1008368329 6:50707504-50707526 CAGAAAAGGGGAGTGTTCTCAGG + Intergenic
1008949265 6:57137595-57137617 GAGAAAAGCAGGGTGCTATCTGG - Intronic
1009183483 6:60546494-60546516 CAGAAAACTAGACTGTTAGCAGG + Intergenic
1012366261 6:98444282-98444304 CAGAAAGGGAGGCAGTTTACAGG - Intergenic
1013614381 6:111828080-111828102 CAGAAGAGGAGGAAGTTCTCAGG - Intronic
1016656667 6:146526000-146526022 CAGGAAAGAAGGCTTTAATCAGG - Intergenic
1016670764 6:146704263-146704285 CAGAAAAGGAAGCAATTATAAGG - Intronic
1018237028 6:161736557-161736579 AAGAAAAGGAGGCTGAGACCTGG + Intronic
1018342748 6:162868650-162868672 CCGGAAAGGAGGCTGTGCTCTGG - Intronic
1018585934 6:165359330-165359352 CAAAAAAGGAGGCTGAAATAAGG - Intronic
1018590640 6:165417787-165417809 CATAAAAGGAGACTGATGTCAGG - Intronic
1018939764 6:168301407-168301429 CAGAAAAGGAGTCGGCTTTCTGG - Intronic
1021132616 7:16929338-16929360 CAGAAAAGGAAGCAGTTCACTGG + Intergenic
1022583535 7:31582220-31582242 CAGGACAGTAGGCTGTTCTCAGG - Intronic
1022802624 7:33790801-33790823 CAGACAAGGATGATCTTATCAGG + Intergenic
1023282381 7:38584485-38584507 CAGAAAAGGACGGTGTTAGGTGG - Intronic
1023900155 7:44470332-44470354 CAGATTTGGAGCCTGTTATCTGG - Intronic
1026857970 7:73767594-73767616 TAGAAAAGAAGGCTGGAATCTGG - Intergenic
1029962819 7:104706719-104706741 TAAAAGAGGAGGCTGTTATAAGG - Intronic
1030569309 7:111202283-111202305 TGGAAAAGGAAGCTGTTAACTGG + Intronic
1031764024 7:125752572-125752594 CAGAAAAGGAGACTGCTTTGGGG - Intergenic
1034245684 7:149642689-149642711 CAGACAAGGTGACTGTTGTCAGG + Intergenic
1034689673 7:153004291-153004313 CAGGGAAGGAGGCTGTCAGCAGG - Intergenic
1036685155 8:10904624-10904646 CAGGAAGGGAGGCTGTGACCGGG + Intronic
1036968004 8:13321639-13321661 CAGAAAAGAATGCTGCTAACTGG - Intronic
1037124530 8:15330783-15330805 CAGAAAAGGCAGCTGTAATTAGG - Intergenic
1037909579 8:22735974-22735996 AAGAAAAGAAGGATGTTCTCAGG - Intronic
1039269723 8:35867791-35867813 CAGGAAAGAAGGCTTTAATCAGG + Intergenic
1039648700 8:39316447-39316469 CAGAAAGGGAAGCTGTCATAGGG - Intergenic
1039953204 8:42188041-42188063 CACAGAAGGAGGCTGTCATTAGG - Intronic
1041550300 8:59092749-59092771 CACAAAAAGAGGCTGTAACCTGG - Intronic
1042314784 8:67414116-67414138 CAGAAAAGGAGTTTATTATGTGG + Intergenic
1044858539 8:96499051-96499073 CAGAAAGGAAGGCTATTATGGGG - Intronic
1046439646 8:114241210-114241232 GAGAAAAGGTGGCTTTCATCAGG + Intergenic
1046876776 8:119263681-119263703 CAGATAAAGAGACTGATATCGGG - Intergenic
1047876921 8:129148758-129148780 CAGGAAAGAAGGCTTTCATCAGG - Intergenic
1048223748 8:132565932-132565954 CAGAAAAGGTGGCGGTAATGTGG + Intergenic
1048360108 8:133690387-133690409 CAGAAAATGCAGCTCTTATCTGG + Intergenic
1048463343 8:134641069-134641091 CAGAGCAGGAGGCTGGAATCTGG - Intronic
1048816101 8:138335186-138335208 CTGAAAAGGAGTCTGTTCTTGGG + Intronic
1049681837 8:143922399-143922421 CAGAAGAAGAGGGTGTGATCAGG + Intronic
1049878242 8:145041913-145041935 CAGAAAAGAAGGCTTTATTCAGG - Intergenic
1051108786 9:13611030-13611052 AAGAAATGGAGGTGGTTATCTGG - Intergenic
1051246969 9:15121929-15121951 TAGAAAAGGAAGCCATTATCAGG + Intergenic
1051904817 9:22082987-22083009 CAGAAAAGAAGGCTGGTAGCAGG + Intergenic
1052936025 9:34093837-34093859 CAGATAAAGAGGCTGATCTCTGG + Intronic
1053646444 9:40122431-40122453 AAGAAAAGGAGCCTGTGAGCAGG + Intergenic
1053759269 9:41341120-41341142 AAGAAAAGGAGCCTGTGAGCAGG - Intergenic
1054327456 9:63720333-63720355 AAGAAAAGGAGCCTGTGAGCAGG + Intergenic
1054538125 9:66253542-66253564 AAGAAAAGGAGCCTGTGAGCAGG - Intergenic
1055605398 9:77965041-77965063 CAGTAATGGAGGCTGTGATCTGG - Intronic
1058230601 9:102419681-102419703 CAGACAAAGAGGATATTATCAGG - Intergenic
1058843385 9:108932935-108932957 AAGAAAATGAAGCAGTTATCAGG - Intronic
1061468566 9:130803615-130803637 AAGGAAAGGAATCTGTTATCTGG + Intronic
1062206642 9:135341307-135341329 CAGAGGAGGAGGCTGTTCCCAGG + Intergenic
1202794231 9_KI270719v1_random:105862-105884 AAGAAAAGGAGCCTGTGAGCAGG + Intergenic
1186514209 X:10154066-10154088 CAGAACAGGAGGCTGATGTCAGG + Intergenic
1186636781 X:11414427-11414449 CACAAAAGCAGGCAGTTGTCTGG + Intronic
1193774189 X:85622605-85622627 CTGAAAAGGAGGCTGAAACCAGG + Intergenic
1193996815 X:88375489-88375511 CAGTAAATGAGTCTGTTACCAGG - Intergenic
1196299301 X:114036623-114036645 CAGAATGGGAGGCAGTCATCTGG + Intergenic
1198175059 X:134146785-134146807 CAGCAAAGGAGGCTGCGATGAGG - Intergenic
1201149086 Y:11085563-11085585 AAGAAAAGGAGCCTGTGAGCAGG - Intergenic