ID: 967705348

View in Genome Browser
Species Human (GRCh38)
Location 3:192643370-192643392
Sequence TTGGACAAAATCCCCTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967705348_967705351 30 Left 967705348 3:192643370-192643392 CCACCAAAGGGGATTTTGTCCAA 0: 1
1: 0
2: 2
3: 11
4: 107
Right 967705351 3:192643423-192643445 CAGTGAATGTATCTGCAATCTGG 0: 1
1: 0
2: 2
3: 16
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967705348 Original CRISPR TTGGACAAAATCCCCTTTGG TGG (reversed) Intronic
903275669 1:22219847-22219869 TTGGACCCCAACCCCTTTGGTGG + Intergenic
905317687 1:37093979-37094001 CTGGACACAATCCTCTTGGGTGG - Intergenic
913110595 1:115654087-115654109 TTGGACAAAATACCCTTAGCTGG - Intronic
913301484 1:117374527-117374549 TTGGAAAGAATGCCCTTTGAAGG - Intronic
915138742 1:153752861-153752883 TTGGGCAAAATCCACTTTGGAGG + Intronic
916654252 1:166859487-166859509 TCAGACTAAATTCCCTTTGGGGG + Intronic
922897687 1:229113203-229113225 TTGAACAATATCACCTTTGTGGG - Intergenic
923985948 1:239382527-239382549 TTTAAAAAAATCACCTTTGGGGG - Intergenic
1063128656 10:3158649-3158671 TTGGACAAATGTCCCCTTGGGGG + Intronic
1075762084 10:124864659-124864681 TTGGCCAAAAGCCACTTGGGAGG + Intergenic
1079014479 11:16856939-16856961 GTGGAGAAAATCTGCTTTGGAGG + Intronic
1084493418 11:69490231-69490253 TCGGACAAAAGCCCATTCGGCGG - Intergenic
1085056281 11:73405950-73405972 AAGGACAAAATCACCTTTTGAGG + Intronic
1085489182 11:76898602-76898624 TTGTTCAAAATCCTCGTTGGTGG + Intronic
1087555910 11:99720757-99720779 TTGGACAAAAGCTCCTTCAGTGG + Intronic
1094551103 12:31452387-31452409 TTGGATAAAATCCACTTTATTGG + Exonic
1098821248 12:75232545-75232567 ATGGACAAAATTGCCTTTGTGGG - Intergenic
1099199590 12:79659869-79659891 TTGGACAAAAACTACTTTTGGGG - Intronic
1100001334 12:89839876-89839898 ATGGACAAAATGTCCTATGGAGG + Intergenic
1100155602 12:91796545-91796567 TTGGCTAAAATTCCCATTGGAGG - Intergenic
1101653950 12:106703352-106703374 GTGGCCATAATCCCCTCTGGAGG - Intronic
1101672199 12:106885940-106885962 TGGGACAATAACGCCTTTGGAGG + Exonic
1103324292 12:120110151-120110173 TTGGAAAAAATGACCTGTGGGGG + Intronic
1109952975 13:69525899-69525921 TTGAACAAAATGTTCTTTGGTGG + Intergenic
1110348414 13:74476443-74476465 TTGTAAAAAATCGCCTTTGTGGG + Intergenic
1111079700 13:83287154-83287176 CTTGACAAAATTCCCTTTGATGG - Intergenic
1117147144 14:52846852-52846874 TTGTAAAAAATCCCTCTTGGAGG + Intergenic
1117602897 14:57392350-57392372 TTGAACAAAATACCCTTTTGTGG + Intronic
1118307060 14:64663557-64663579 AAGGACAAAATCGCCTTTTGGGG - Intergenic
1121527316 14:94628076-94628098 TGTGAAAAAATCCTCTTTGGGGG - Intergenic
1122136315 14:99635030-99635052 TTGAAGCAAATCCCCATTGGCGG + Intergenic
1123145507 14:106126091-106126113 TAGGACAAAATTCCCTCTGTTGG - Intergenic
1127370737 15:58337235-58337257 TTTGACAAATTCTCCATTGGGGG - Intronic
1128909235 15:71497060-71497082 TTTGGCAAAATACTCTTTGGTGG - Intronic
1129174543 15:73830506-73830528 TTGGTCCAGATCCCCTTTGCTGG + Intergenic
1132297971 15:100757724-100757746 TTGGACTTGATGCCCTTTGGGGG + Intergenic
1133186083 16:4099729-4099751 TTGAAAAAAATCACCTTTGGAGG + Intronic
1137813401 16:51374965-51374987 TTGCACAATGTTCCCTTTGGGGG - Intergenic
1144100552 17:11938485-11938507 ATGGAGAAATTTCCCTTTGGTGG - Intronic
1149261858 17:54888703-54888725 TTGGAGAAAATTCACATTGGTGG - Intergenic
1154245400 18:12692472-12692494 TAGAACAAAAGCCCCTATGGAGG - Intronic
1155440629 18:25858245-25858267 TTGGTCAAATTCTCCTTTGTAGG - Intergenic
1157835333 18:50896810-50896832 ATGGTCAAATTCCCCTTTGTAGG - Intronic
1159052389 18:63433509-63433531 TTGGCCAAATTCCACCTTGGAGG + Intergenic
1164191767 19:22924521-22924543 TATGTCACAATCCCCTTTGGGGG - Intergenic
1164274266 19:23702881-23702903 GTGGACAGATTTCCCTTTGGAGG - Intergenic
1165700287 19:37932364-37932386 TTTGCCAACATTCCCTTTGGGGG - Intronic
1166873196 19:45883036-45883058 TGGGAGACAAGCCCCTTTGGCGG - Intergenic
1168467638 19:56616985-56617007 TTGGACAAAAGCCCCATTTGGGG + Intronic
925343924 2:3156665-3156687 TTGGACAAATTTTGCTTTGGGGG + Intergenic
930301068 2:49616512-49616534 TAGGACAAAATTCCATTTGAAGG + Intergenic
933245901 2:79974700-79974722 ATGGACAAAATCCCCATTATTGG + Intronic
937909693 2:127069410-127069432 TTGGACGAGATCCCCTTGGTGGG - Intronic
940755635 2:157678879-157678901 TTTTACATAATTCCCTTTGGTGG - Intergenic
941141468 2:161788645-161788667 CTGGAGAAATGCCCCTTTGGTGG + Intronic
942346404 2:175006971-175006993 TTGGACCAAATTTCCTTTTGAGG + Intergenic
944037275 2:195309924-195309946 TAGAAAAAAATCCACTTTGGGGG + Intergenic
944238307 2:197460979-197461001 TTGTAGAAATTCCCCTATGGAGG - Intronic
944714244 2:202362780-202362802 ATGGAAAAAATCCCCCTAGGAGG + Intergenic
945838798 2:214864280-214864302 TTGGACAAAAGCCACTTTAGTGG - Intergenic
946683467 2:222242445-222242467 TTTAACAAAACCCTCTTTGGAGG + Intronic
947365988 2:229395344-229395366 TGGGATAAAACACCCTTTGGGGG + Intronic
1169322132 20:4641692-4641714 ATGGACAAATTCCCTTTTCGAGG + Intergenic
1170311890 20:15001250-15001272 TTGGACAAAATCACTTTGAGAGG - Intronic
1172880114 20:38194322-38194344 TTTGACACACTCCTCTTTGGGGG - Intergenic
1173042589 20:39478352-39478374 TTGGACAATTTCGCCTTTGTAGG + Intergenic
1175882159 20:62266317-62266339 TTTGAAACACTCCCCTTTGGAGG + Intronic
1181621417 22:24094065-24094087 TTGGAAGAACTCCACTTTGGGGG + Intronic
1182872480 22:33660659-33660681 TTGGACACAATCCCCTTTGTTGG + Intronic
1183602040 22:38845281-38845303 CTGGACAAAATCCCCGTGGCTGG - Intergenic
951213393 3:20000106-20000128 TTGGAAACAATCCCCTTAAGAGG + Intronic
952866145 3:37856465-37856487 GTGGACAAAATACCCTTAAGGGG - Intergenic
955641484 3:61090393-61090415 TTGGGGAAAATCCTCTTGGGAGG - Intronic
957554815 3:81753005-81753027 TTGGATAGAATCCACTTTGTAGG - Intronic
958698421 3:97556172-97556194 TTGGACAAAATCCTCTCTTGTGG - Intronic
967357037 3:188583158-188583180 TTGGACAAAATAACCTTTTTTGG + Intronic
967705348 3:192643370-192643392 TTGGACAAAATCCCCTTTGGTGG - Intronic
971197637 4:24484633-24484655 TTGCACAACATCACTTTTGGTGG + Intergenic
977413287 4:96695658-96695680 TTGAACTAAATCCCATTTGTTGG + Intergenic
982981491 4:162141977-162141999 CAGGACAAAATTACCTTTGGTGG - Intronic
984100751 4:175482807-175482829 TGCAACAAAATTCCCTTTGGTGG + Intergenic
990391861 5:55331349-55331371 TTGGAAAAAATATCCTTTTGAGG + Intronic
991565061 5:67996753-67996775 TGGGACAGAATCCCATTTTGTGG - Intergenic
991962140 5:72055598-72055620 TGAGACAAAATTCCCCTTGGAGG - Intergenic
993199647 5:84798058-84798080 TTGAACAAAACACCATTTGGTGG + Intergenic
994540251 5:101086080-101086102 GTGGACAGAATTCCCTCTGGAGG + Intergenic
998735508 5:145135121-145135143 TTGAACAAATTCCACTTGGGAGG + Intergenic
999569992 5:152909149-152909171 TGGGACAAAAACGTCTTTGGGGG - Intergenic
1000531727 5:162430374-162430396 TGGCACCAAATCCCCTTTGCTGG + Intergenic
1001010527 5:168093692-168093714 TTGGATAAAATCCCATTTCCTGG + Intronic
1004998331 6:21215809-21215831 TAGGACACGATCACCTTTGGGGG - Intronic
1006446554 6:34082977-34082999 TTTGAAAAAATTCCCTTTGCTGG - Intronic
1010606620 6:77897352-77897374 TTGTACAAACTCCTCTTTGTAGG + Intronic
1012497726 6:99853130-99853152 TTGGAATAAATACCCTTAGGAGG + Intergenic
1012932076 6:105327720-105327742 TGGGACAAAAAGCACTTTGGAGG + Intronic
1015364954 6:132386693-132386715 TGAGACAAATTCTCCTTTGGTGG - Intronic
1021679428 7:23115143-23115165 TTGGACAAATTCAGCTTTGGAGG - Intronic
1021954346 7:25809435-25809457 TTCTCCAAAATCCTCTTTGGTGG - Intergenic
1023618283 7:42043188-42043210 TTGGAAAAAATCTCCTATGGTGG + Intronic
1027401827 7:77817069-77817091 TTGGATAAAATTCCCAGTGGTGG + Intronic
1028536677 7:91895904-91895926 TAGAAAAAAATCCCATTTGGAGG - Intergenic
1028570245 7:92278784-92278806 TAGGAAAAAATCCCATTTTGGGG + Intronic
1029685572 7:102145389-102145411 TTGGCCAAAAGCCCCTTTGTGGG + Intronic
1029781103 7:102734199-102734221 TTGAAATAAATCCCATTTGGTGG + Intergenic
1030408596 7:109145989-109146011 TTGGACAAAATTCCCTTGGAGGG + Intergenic
1030661476 7:112223671-112223693 CTGGACAAAAGCGCCTTTGTGGG - Intronic
1032519868 7:132535713-132535735 TTGGCCAAGATCCCCTCTGCAGG + Intronic
1033497654 7:141915999-141916021 TTTGATAAAATTCCATTTGGTGG + Intronic
1037730528 8:21520010-21520032 TTGAACTAAATCTCATTTGGGGG - Intergenic
1042718746 8:71804423-71804445 CTGAGCAAAATCCCCTTTGCAGG - Intergenic
1043274706 8:78378596-78378618 TTGGGCACTATCCCATTTGGGGG - Intergenic
1058869250 9:109188395-109188417 TTGGACAACATTCTGTTTGGAGG - Intronic
1187955937 X:24518736-24518758 TTTTACAAAATACCCTTTTGTGG - Intronic
1188136298 X:26498682-26498704 TTGGAGCATATCACCTTTGGAGG + Intergenic
1190053720 X:47170222-47170244 CAGGGCAAAAACCCCTTTGGTGG + Intronic
1190143072 X:47865160-47865182 TGGGACAACTACCCCTTTGGGGG - Intronic
1190925341 X:54898703-54898725 TTGGACAACATCCACTTTGTTGG - Intergenic
1191783201 X:64890687-64890709 TTGGAGACAATCTGCTTTGGAGG + Intergenic
1198526659 X:137508269-137508291 TTGGACAAAATAACCTTTCAGGG - Intergenic
1199877933 X:151949674-151949696 TGGGAAAACATCCCCGTTGGGGG - Intergenic
1201910904 Y:19132671-19132693 TTAGGCAAAGTCCCATTTGGGGG + Intergenic