ID: 967707883

View in Genome Browser
Species Human (GRCh38)
Location 3:192673535-192673557
Sequence CTGTCAGGGGGGCAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1247
Summary {0: 1, 1: 2, 2: 20, 3: 134, 4: 1090}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967707883 Original CRISPR CTGTCAGGGGGGCAGGAGGA GGG (reversed) Intronic
900037872 1:432701-432723 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900037892 1:432778-432800 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900037913 1:432855-432877 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900037934 1:432932-432954 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900037955 1:433009-433031 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900037976 1:433086-433108 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900037996 1:433163-433185 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900038017 1:433240-433262 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900038037 1:433317-433339 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900038057 1:433394-433416 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900038077 1:433471-433493 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900038097 1:433548-433570 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900038117 1:433625-433647 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900038137 1:433702-433724 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900038157 1:433779-433801 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900038177 1:433856-433878 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900038197 1:433933-433955 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900038217 1:434010-434032 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900038237 1:434087-434109 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900038257 1:434164-434186 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900038277 1:434241-434263 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900038313 1:434395-434417 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900038333 1:434472-434494 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900038353 1:434549-434571 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900038373 1:434626-434648 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900038393 1:434703-434725 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900038413 1:434780-434802 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900038434 1:434857-434879 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900038455 1:434934-434956 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900059546 1:668605-668627 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900059584 1:668759-668781 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900059808 1:669605-669627 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900059828 1:669682-669704 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
900336667 1:2167498-2167520 CTCTCGGGGGGACAGGTGGAAGG + Intronic
900501047 1:3004822-3004844 CAGTCTGGTGGGCAGGAGCAGGG - Intergenic
900643152 1:3696879-3696901 GTGGCAGGGGGGCCGGAGGCGGG - Intronic
900682779 1:3925982-3926004 CAGTCAGGGCTGCATGAGGATGG - Intergenic
900709787 1:4106496-4106518 CTGAAAGAGGGCCAGGAGGAGGG + Intergenic
900711679 1:4118651-4118673 CTGACAGGTTGGGAGGAGGATGG + Intergenic
900840438 1:5045046-5045068 CTGTCTGGCGGGCAGGAGTAGGG - Intergenic
900952862 1:5867750-5867772 GTGCCAGGGCGGCAGGCGGATGG + Exonic
901629829 1:10642666-10642688 GTGCCAGGGAGGCGGGAGGATGG + Intronic
901659229 1:10788372-10788394 GAGGCAGGGGGGCAGGAGGGAGG - Intronic
901742307 1:11350307-11350329 CTATCAGTGAGGCAGGAGGAGGG - Intergenic
901876509 1:12169825-12169847 CTGTCTGGGGAGGAGGATGAGGG + Intronic
902511187 1:16967807-16967829 GAGTCAGTGGGGCAGGAGAAGGG + Intronic
902642508 1:17775789-17775811 ATGTTAGGAGGGAAGGAGGATGG - Intronic
902786040 1:18733383-18733405 CTGCCTGGGAGGCAGGAGGCTGG - Intronic
903032338 1:20472857-20472879 ATATCAGGGGCGCAGAAGGAAGG - Intergenic
903548632 1:24142625-24142647 CTGACAGGGGAGGAGGAGGAAGG - Intronic
904043738 1:27598511-27598533 CTGTCAGCTGGGCTGGAGGGGGG + Intronic
904303718 1:29573501-29573523 CTGTCACTGGGTCAGCAGGAAGG + Intergenic
904366335 1:30013182-30013204 GCGTCAGCTGGGCAGGAGGAAGG + Intergenic
904892796 1:33792093-33792115 CTGTCAGGGTGGCAGAATCAAGG + Intronic
905175825 1:36134759-36134781 CTGTAGGGGTGGCTGGAGGAGGG + Intergenic
905310180 1:37043574-37043596 CTGTCACAGGGGGAGTAGGAGGG + Intergenic
905339350 1:37267595-37267617 CTTGCAGGGAGGCAGGAGGAGGG - Intergenic
905506864 1:38486646-38486668 CAGGCAGGCAGGCAGGAGGAAGG + Intergenic
905811630 1:40917375-40917397 CGTACAAGGGGGCAGGAGGAGGG - Intergenic
906020031 1:42619799-42619821 CTTTCATGGGAGCAGGTGGATGG - Intronic
906521935 1:46472361-46472383 TTGGCAGGGGGGCAGGCGGGCGG - Intergenic
906530318 1:46520145-46520167 TTGTCAGGGGGGCGGGTAGAAGG - Intergenic
907012768 1:50978376-50978398 CTGTCATGGGGGGAGGGGAAGGG - Intergenic
907107267 1:51895104-51895126 CTGTCAGGGGGTGGGGAGCAAGG + Intergenic
907235722 1:53045197-53045219 ATAGCAGGGGGGCAGGAGGGAGG - Intronic
907282911 1:53362611-53362633 CTGTGAGGGAGGCAGTGGGAGGG - Intergenic
907413479 1:54298343-54298365 CTGACGAGGGGGCAGCAGGAAGG + Intronic
907598157 1:55739467-55739489 CTATCAGGGGGACAGGGGAAGGG - Intergenic
907929647 1:58987553-58987575 CAGTCAGGGTGGCAGGAAGACGG + Intergenic
908512771 1:64862518-64862540 CTGTGGAGGGAGCAGGAGGAGGG - Intronic
908735972 1:67277424-67277446 CTGTCAGGGGGTCAGGGGCAAGG + Intergenic
908895924 1:68898944-68898966 CTGTCAGGGAGTCAGTAGGGAGG - Intergenic
908985377 1:70011446-70011468 CTGTCATGGGGTAAGGAGAAGGG - Intronic
909305504 1:74070749-74070771 CTGTTGAAGGGGCAGGAGGAAGG + Intronic
909498861 1:76310863-76310885 CTGTCAAGGAGTCAGGTGGAAGG - Intronic
909964884 1:81896347-81896369 CTGTGAGGGTGGGAGGGGGACGG + Intronic
910757564 1:90708426-90708448 ATGGCAGGGAGGGAGGAGGAGGG + Intergenic
910861132 1:91743296-91743318 GGGTCAAGGAGGCAGGAGGATGG - Intronic
911303769 1:96207917-96207939 AAGTCAAGGGGGCAGGAAGAAGG - Intergenic
911691495 1:100839773-100839795 CTGTCAGGGGGTAGGGAGCAAGG - Intergenic
912266146 1:108160100-108160122 CTGTCCGGGAGGGAGGTGGAGGG - Intronic
912679893 1:111722332-111722354 GTGGCCGGAGGGCAGGAGGAAGG + Exonic
912756955 1:112332628-112332650 CTGGCAGGGAGGCTGGAGCATGG + Intergenic
913365237 1:118030588-118030610 CTGTCAGGGGGTCAAGGGCAAGG - Intronic
913578152 1:120197507-120197529 CTGTGGTGGAGGCAGGAGGAGGG + Intergenic
914775190 1:150728987-150729009 CTGTCCGGGAGGCAGGTGGGGGG - Intergenic
915075667 1:153306565-153306587 CTGTGAGGTGGGGAGGAGCAAGG + Intronic
915088144 1:153402485-153402507 CTGACAGAGGGGCAGAAAGAAGG + Intergenic
915088728 1:153406511-153406533 GTGTCAGGGTGGCAGGGAGATGG - Intergenic
915095471 1:153459431-153459453 CAGTCATGGGGGCAGGACAATGG + Intronic
915096170 1:153464324-153464346 GTGTCAGGGTGGCAGGGAGATGG + Intergenic
915303821 1:154966551-154966573 ATGTGTGGTGGGCAGGAGGAGGG + Intronic
915347688 1:155206282-155206304 CTGCTTGGGGGGCAGGCGGAAGG + Exonic
915978457 1:160405762-160405784 CTGTAAGTGAGGAAGGAGGAAGG + Intronic
916363330 1:163995613-163995635 CTGTCAGGGGGTTAGGAGTGGGG + Intergenic
916717904 1:167460736-167460758 CTGTCGGGGGGTCAGGGGGCTGG - Intronic
917927858 1:179803948-179803970 CAGGCCAGGGGGCAGGAGGAGGG - Intronic
918177999 1:182061867-182061889 CTGAGAGGAGGGAAGGAGGAAGG - Intergenic
918211840 1:182358135-182358157 CCAGCAGGTGGGCAGGAGGAGGG + Intergenic
918345540 1:183604322-183604344 ATGTCAGAGAGGCAGGAGGAAGG + Intergenic
918355143 1:183700902-183700924 CTGTCAGGGGCTCAGGGGGAAGG - Intronic
918693361 1:187510743-187510765 CTATCAGGGTGGGAGGAGAATGG - Intergenic
919274946 1:195401724-195401746 TTGGCCTGGGGGCAGGAGGAGGG + Intergenic
919324888 1:196094551-196094573 CTGTCAGGGGGTGAGGGGAAAGG + Intergenic
919982738 1:202652472-202652494 CTGTCAAGGATGCAGGAGGTAGG - Intronic
920097460 1:203495942-203495964 CTGGCAAGTGGGCACGAGGAAGG - Intronic
920252001 1:204628073-204628095 CTGTCAGGAAGGAAGGAGGCAGG - Intronic
920677964 1:208051424-208051446 CTGACAGGGAGACAGCAGGAGGG + Intronic
920920206 1:210292373-210292395 CCGCCAAGGGGGCAGGAGGTCGG - Intergenic
920986145 1:210891384-210891406 CTGTCATGGGGTGAGGAGAAGGG + Intronic
921108444 1:212008584-212008606 CTGACGTCGGGGCAGGAGGACGG - Intronic
921219879 1:212965886-212965908 CTGTAAGGGGTGGAGGCGGAGGG + Intronic
922976615 1:229789845-229789867 CTGTTTGCAGGGCAGGAGGAGGG + Intergenic
923020280 1:230158187-230158209 GTAGCAGGGGGGCAGGATGAAGG + Intronic
923584913 1:235259939-235259961 CTTTTAGGTGGGAAGGAGGATGG - Intronic
924017236 1:239740616-239740638 CTGTCAGGGGGTGAGGGGCAAGG - Intronic
924044193 1:240011152-240011174 CAGTCTGGAGGGGAGGAGGAGGG - Intergenic
924416489 1:243861378-243861400 CTGTCCGGGGTGAAGGAGGCAGG - Intergenic
924812334 1:247414506-247414528 CTCTCAGGGAGGCAAGAGGCGGG - Intergenic
1062845149 10:697711-697733 CTGTTACGGGGGCTGCAGGAAGG - Intergenic
1063036828 10:2294350-2294372 CTGTCAGGGGGTGGGGGGGAAGG + Intergenic
1063507643 10:6615496-6615518 CTGTCAGGAGTGCAGAAGGTTGG - Intergenic
1063747858 10:8906028-8906050 CTGTCAGGGGGTCGGGGGTAGGG + Intergenic
1063748025 10:8908209-8908231 CTGTTGGGGGCGCAGGGGGAGGG + Intergenic
1063772954 10:9225240-9225262 CTGTCAGGTGGAAAGGAGGATGG - Intergenic
1063856234 10:10257324-10257346 CTGTCTGTGCAGCAGGAGGAGGG - Intergenic
1064512667 10:16112377-16112399 AAGTCAGGTGGGCAGGAGCAAGG + Intergenic
1064535224 10:16351235-16351257 CTGTCTCGGTGGCAGGTGGAGGG - Intergenic
1064585552 10:16836563-16836585 TTCCCAGAGGGGCAGGAGGAAGG + Intronic
1064828719 10:19436929-19436951 CTGTCAGTGGTCCAGGAGTATGG - Intronic
1065077458 10:22095297-22095319 CTGTCAGGGGGTCAGGGGGCTGG + Intergenic
1065510990 10:26478332-26478354 CAGTGAGTGGGGCGGGAGGATGG + Intronic
1066022807 10:31319711-31319733 CGCTGAGGGGGCCAGGAGGAGGG - Intronic
1066271383 10:33827540-33827562 CTGTTGGTGGGGCAGGGGGATGG + Intergenic
1066271695 10:33830296-33830318 CTGTCGGGGGGTCAGGGGAAAGG + Intergenic
1066425833 10:35306841-35306863 ATCTTAGGGGGCCAGGAGGATGG + Intronic
1066676314 10:37891334-37891356 CTGGCAGAGGGGCAAGAGCAGGG - Intergenic
1066707139 10:38192806-38192828 CTGTCAGGGGGTCAGAGGCAAGG + Intergenic
1066763208 10:38777924-38777946 CTGTCAGGGGGGTGGGAGGCAGG - Intergenic
1067160201 10:43819220-43819242 CTGTCTGGGGGTCAGGTAGATGG + Intergenic
1067317557 10:45182259-45182281 CTGTTGTGGGGGCAGGAGGAGGG + Intergenic
1067432297 10:46252449-46252471 CTTTCAGCGGGGCCAGAGGAGGG - Intergenic
1067448830 10:46368954-46368976 CAGTGAGGGCGGCAGCAGGAAGG - Intergenic
1067576792 10:47414157-47414179 CTGTGAGGAGGGCAGGATGCAGG + Intergenic
1067588542 10:47491811-47491833 CAGTGAGGGCGGCAGCAGGAAGG + Intergenic
1067635668 10:47999902-47999924 CAGTGAGGGCGGCAGCAGGAAGG + Intergenic
1067667266 10:48289056-48289078 CTGACAGGTGGGCAGGCGGAGGG - Intergenic
1067697785 10:48548183-48548205 CTGTCACGGGGCCAGGAGCTGGG - Intronic
1068116897 10:52745980-52746002 CTGTCAAGGGGGTGGGAAGAGGG - Intergenic
1068529411 10:58167652-58167674 CTGTCAGGGGGTTAGGGGAAAGG + Intergenic
1068577208 10:58697919-58697941 CTGTCATGGGGGTGGGAGGTGGG - Intronic
1068728631 10:60331110-60331132 CTGTCAGGGGGTCGGGGGCATGG + Intronic
1069424100 10:68274596-68274618 CTGTCAAGGTGTCAGCAGGATGG + Intergenic
1069577783 10:69543267-69543289 CTGACACTGGGGCAGGAGGAAGG - Intergenic
1070287444 10:75094276-75094298 CTGCCTTGGGTGCAGGAGGAAGG - Intergenic
1071333639 10:84584803-84584825 CTGGCTTGGGGGCAGGAAGATGG + Intergenic
1072116759 10:92375540-92375562 CTGTCCGGGAGGGAGGTGGAGGG + Intergenic
1072323471 10:94273394-94273416 CTGTGAAGGGGGCAGGAGCAGGG + Intronic
1072426423 10:95334456-95334478 GTGCCAGGAGGGCAGGAGGAAGG + Intronic
1072552987 10:96493463-96493485 CTGTCAGGGCAGGAGCAGGAGGG + Intronic
1072564976 10:96609939-96609961 CTGTGAGAGAGGCAGGTGGAGGG - Intronic
1072805932 10:98424072-98424094 CTGTCCTGGGTGCAGGAGCAGGG - Intronic
1073073594 10:100809760-100809782 CTCTCTGGGAAGCAGGAGGAAGG - Intronic
1073093864 10:100968481-100968503 CTGTCATGGATGGAGGAGGAAGG + Intergenic
1073176439 10:101560284-101560306 CAGGCAGAGGGGCGGGAGGAAGG - Intergenic
1074154537 10:110786831-110786853 GTGTCAGGTGGGCAGGGGGCAGG + Intronic
1074159085 10:110822312-110822334 CTGTGATGGGGGCAAGAGTAGGG + Intronic
1074261497 10:111858042-111858064 CTGTTCTGGGGGCAGGAGGAGGG - Intergenic
1074418245 10:113286200-113286222 GTGTCATGGGGGAAGGAGGAAGG - Intergenic
1074774724 10:116758979-116759001 CTGTCTGGGGTGCAGCAGAAGGG - Intergenic
1074869245 10:117564074-117564096 CTGAGAGAGGGGCAGGAGGAGGG - Intergenic
1075490564 10:122864722-122864744 CTGGCAGGGGGAAAGGAGAAGGG - Intronic
1075700589 10:124467191-124467213 CTGGCAGTAGGGCAGGAGGTGGG + Intronic
1075998915 10:126899919-126899941 CTGACAGGGGGCCAAGGGGAAGG + Intergenic
1076536151 10:131179022-131179044 CTGTCAGAGGGGCTGGAGGCTGG - Intronic
1076850170 10:133088670-133088692 CGGTCAGCGGGGCGGGCGGAGGG - Intronic
1076964602 11:70611-70633 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
1076964621 11:70688-70710 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
1076964641 11:70765-70787 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
1077215422 11:1393443-1393465 CTGTCTGGGGGGCGGGAGAAAGG + Intronic
1077219836 11:1410975-1410997 CGCTGAGGGGGGCAGGAGCAGGG + Intronic
1077378052 11:2214847-2214869 CTGCCAGCGGGGCAGGTGGCAGG - Intergenic
1077412168 11:2408693-2408715 CAGCCTGCGGGGCAGGAGGAGGG + Intronic
1077457688 11:2690769-2690791 CTGGCAGGGGGTCAGCAGGAGGG + Intronic
1077493163 11:2871416-2871438 ATGTCAGGGAGGCTAGAGGAAGG - Intergenic
1077791881 11:5449973-5449995 CTGTTATGGGGGCAGAAAGAAGG - Intronic
1077915897 11:6611474-6611496 CTGTCAGCAGAGCGGGAGGAGGG + Intronic
1078155741 11:8798488-8798510 CTATCAGGGACCCAGGAGGATGG + Intronic
1078524231 11:12088410-12088432 CTGGCAGGTTGGCTGGAGGATGG - Intergenic
1078851506 11:15168264-15168286 CTGTCAGTGGGGTAGTGGGAGGG - Intronic
1079162581 11:18008758-18008780 GTGGCATGGGTGCAGGAGGAGGG - Intronic
1079961355 11:26927965-26927987 ATGTCAGGGCTGCTGGAGGATGG + Intergenic
1080908089 11:36566911-36566933 CTGTCAAGGAGGCAGGTGCAAGG - Intronic
1081460999 11:43273006-43273028 CTCTCAGGGAGGCAAGAGGCTGG - Intergenic
1081790970 11:45784435-45784457 CTGTCAGGGGGTCGGGGGCAAGG + Intergenic
1082001439 11:47395456-47395478 CCGGCAGGGTGGGAGGAGGAGGG - Intergenic
1082001514 11:47395739-47395761 TGGCCAGGGAGGCAGGAGGAAGG - Intergenic
1082006150 11:47420248-47420270 ATGTCAGGTGAGCAGGAGCACGG - Exonic
1082122859 11:48398165-48398187 CTATCATGGGGGAAGGAGCAAGG + Intergenic
1082243222 11:49892177-49892199 CTGGCAGCGGGGCAGGTGGGAGG + Intergenic
1082556560 11:54569441-54569463 CTATCATGGGGGAAGGAGCAAGG + Intergenic
1082793189 11:57361440-57361462 CTGTTGGGGGTGCAGGGGGAAGG - Intronic
1083015120 11:59445157-59445179 CTGTCAGGAGGCAGGGAGGAGGG - Intergenic
1083300948 11:61739397-61739419 CTGGCTGGGGGGCAGGGGCAGGG - Intronic
1083315627 11:61813426-61813448 CCTTCTGGCGGGCAGGAGGATGG - Intronic
1083720703 11:64602209-64602231 CTGGCAGGGTGGGAGGAGGCAGG - Exonic
1084054810 11:66625394-66625416 CTGCCAGGGTGGCAGAAGGTTGG - Exonic
1084172365 11:67406701-67406723 CTGACATGGGGGCTGGAGGAAGG + Intronic
1084192403 11:67505017-67505039 CAGTCTGGGGCGCAGGTGGACGG - Intronic
1084358378 11:68653919-68653941 CTGGAAAGGGGCCAGGAGGAGGG + Intergenic
1084424405 11:69076782-69076804 ATGGCAGGAGGGCAGGTGGAGGG - Intronic
1084424457 11:69076956-69076978 ATGGCAGGAGGGCAGGTGGAGGG - Intronic
1084424465 11:69076981-69077003 GTGGCAGGAGGGCAGGTGGAGGG - Intronic
1084424534 11:69077205-69077227 ATGGCAGGAGGGCAGGTGGAGGG - Intronic
1084424542 11:69077230-69077252 GTGGCAGGAGGGCAGGTGGAGGG - Intronic
1084582945 11:70035684-70035706 CTGTCAGGGGGTGGGGAGCAAGG - Intergenic
1084615266 11:70231615-70231637 CTGTGAGGGGGTAAGGAGGCAGG + Intergenic
1084670911 11:70606096-70606118 ATGGCAGGGGGGCAGCTGGAAGG + Intronic
1084684386 11:70685266-70685288 TTTTCTGGGCGGCAGGAGGAGGG - Intronic
1084743166 11:71151923-71151945 CAGTCAGGGGGGCACGAAGGGGG + Intronic
1084746762 11:71175411-71175433 CTGTAAAGAGAGCAGGAGGAAGG + Intronic
1084751069 11:71204797-71204819 CTGGGAAGGGGGCAGGAGGCAGG + Intronic
1084792598 11:71484059-71484081 CTGTCAGAGCTGGAGGAGGAGGG + Intronic
1084793985 11:71491979-71492001 CTGTCCTGGGGTCAGGAGGGAGG - Intronic
1084891052 11:72237429-72237451 CAGGCTGGGGGGCAGGAAGATGG - Exonic
1084904870 11:72337902-72337924 CTGTCTGGGGGCCAGGGGAATGG + Intronic
1085082211 11:73644466-73644488 CTCTCAGGGAGGCAAGAGGCGGG + Intergenic
1085100149 11:73793950-73793972 CTCTCAGGGAGGCAAGAGGTGGG - Intronic
1085235063 11:75008327-75008349 CTGTCAAGTTGGCAGGTGGAGGG + Exonic
1085391694 11:76185463-76185485 CAGCCAGGGAGGCAGGAGGGAGG - Intergenic
1085423067 11:76380637-76380659 CTGAGAGGGGCGCAGGAGGCGGG - Intronic
1085647722 11:78238025-78238047 CTGTTAGGTGGGCAGAGGGAGGG + Intronic
1085956991 11:81410631-81410653 CTGTCAGGGGGTTGGGAGAAAGG - Intergenic
1086697650 11:89864000-89864022 CTGGCAGCGGGGCAGGTGGGAGG + Intergenic
1086708509 11:89980488-89980510 CTGGCAGCGGGGCAGGTGGGAGG - Intergenic
1087904796 11:103683135-103683157 CTCTCAGAGGAGTAGGAGGAGGG - Intergenic
1088466706 11:110147444-110147466 CTGTCAGGGGGTCGGAGGGAAGG + Intronic
1088536345 11:110866345-110866367 ATGTGAGTGAGGCAGGAGGAAGG - Intergenic
1088624274 11:111717912-111717934 CTGTTAGGGGGGCAATGGGAGGG + Intronic
1088690594 11:112323433-112323455 CTGTCAGGGGGGCTGGGGCCTGG - Intergenic
1088823390 11:113475018-113475040 GTGTCACGGGGAGAGGAGGAGGG - Intronic
1088871793 11:113896634-113896656 CTGTCATCGCGCCAGGAGGAAGG - Intergenic
1089190829 11:116651969-116651991 ATGTCAGGGAGGCAGGTGGCTGG + Intergenic
1089643629 11:119863990-119864012 CTGTGATGAGGGCAGGAGGAAGG - Intergenic
1089709057 11:120302022-120302044 CAGACAGGCGGGCAGGTGGAAGG + Intronic
1089748168 11:120631546-120631568 CTGTCCTGGGGGCAGAGGGAGGG - Intronic
1089985628 11:122810226-122810248 CTCTAAGGGGTGCAAGAGGAAGG + Exonic
1090010354 11:123040421-123040443 GTGTCAGGGTGCGAGGAGGAGGG - Intergenic
1090238805 11:125167273-125167295 CTGCCAGGGGTGCAGGGGGCTGG - Intronic
1090482112 11:127078020-127078042 CTGGGCTGGGGGCAGGAGGATGG - Intergenic
1090877254 11:130801723-130801745 CTGTCTGGGTGGGTGGAGGAAGG + Intergenic
1091089468 11:132756927-132756949 CTGTCAGGGGGTGGGGAGCAAGG - Intronic
1091550678 12:1532641-1532663 CTGCCAGGGGAGCAGGAGCCAGG + Intronic
1091642219 12:2246097-2246119 CCGTTAGGGTGGCAGGAGGAAGG + Intronic
1091960059 12:4686221-4686243 CTTTCAGGTGGGTAGGATGAGGG + Intronic
1092113544 12:5981937-5981959 CGGTGCGGGGGGCAGGAGGGTGG + Exonic
1092170530 12:6371320-6371342 TTGTCAGGCGTGCAGGAGGGAGG - Intronic
1092262908 12:6962063-6962085 CTGACATGGGGGAAGGAAGAGGG - Intergenic
1092468626 12:8758040-8758062 CTCTCAGGGAGGCAAGAGGCAGG - Intronic
1093181211 12:15968807-15968829 CCATCATCGGGGCAGGAGGAGGG - Intronic
1093208955 12:16284673-16284695 CAGTCAGAGGGGCAAGAGGTAGG - Intergenic
1093252690 12:16827113-16827135 CTGTCAGGGGGTGGGGAGGTGGG - Intergenic
1093286258 12:17267927-17267949 CTGTCAGAGGACCAGGAGGATGG + Intergenic
1093588767 12:20873757-20873779 CTGTCATGGGGGCAGAAGGAGGG - Intronic
1093970922 12:25375338-25375360 CTCTCAGGGAGGCAAGAGGCGGG - Intergenic
1094472493 12:30816799-30816821 CTGGGAGGGGAGCAGGAAGAGGG + Intergenic
1095249297 12:39959971-39959993 CTGTCTGGGGGCCAGGTGAAGGG - Intronic
1095341824 12:41098531-41098553 CTGTCAGGGGGCCGGAGGGAGGG + Intergenic
1095518483 12:43034066-43034088 CTTTCAGGGAGGCAAGAGGCAGG + Intergenic
1096051135 12:48609103-48609125 CTGTCAGGGGGTGAGGTGGGGGG - Intergenic
1096260218 12:50085545-50085567 CGGTGAGTGGGGCAGGAGGAGGG + Exonic
1096801437 12:54113077-54113099 CTGTGAGGGTGGCAGAGGGATGG - Intergenic
1096929358 12:55188553-55188575 CTGTTGGGAGGGCATGAGGAGGG + Intergenic
1097015864 12:55986896-55986918 CTGTAAAGGGGGGAGGGGGAAGG - Exonic
1097127965 12:56789461-56789483 CCGTCCGGGAGGGAGGAGGAGGG - Intergenic
1097245865 12:57607280-57607302 GGGGCAGGGGGGGAGGAGGAGGG - Exonic
1097964220 12:65561975-65561997 TTCTCATGGAGGCAGGAGGAGGG - Intergenic
1098056331 12:66509791-66509813 CTGTCACGGGGGCAGGGGAAGGG + Intronic
1098534185 12:71576082-71576104 CTATCAGGGTGGCAGGGGGAGGG + Intronic
1098620635 12:72593663-72593685 CTGTCAGCAGGGTGGGAGGAGGG - Intronic
1098835851 12:75423714-75423736 CTGTCAGGGGGTCAGGGCTAGGG - Intronic
1099011141 12:77292529-77292551 CTGTCAGGGGGTGGGGAGCAAGG + Intergenic
1099342049 12:81449786-81449808 CTGTCATGGGGTCGGGGGGAGGG - Intronic
1099760179 12:86911438-86911460 CTGTCAGGGTGGAAGGTGAAGGG - Intergenic
1099978358 12:89570199-89570221 CTGTCAGCGGGGCAGGGGGAGGG - Intergenic
1100169484 12:91957941-91957963 CTGTCAGGGGGTTAGGGGAAAGG + Intergenic
1100353346 12:93805828-93805850 CTGTCAGAGGGAAAGAAGGAGGG + Intronic
1100923479 12:99516583-99516605 CTGTCAGGGAGGCAGGGGGAGGG + Intronic
1101349344 12:103914001-103914023 GTGTCCTGGGGGTAGGAGGATGG - Intergenic
1101482965 12:105119983-105120005 CTCTCAGGGAGGCAAGAGGCGGG + Intronic
1101683730 12:106995803-106995825 CTGTTGGGGGGGCAGGGGCAGGG - Intronic
1101727091 12:107396796-107396818 CTGCCTGGAGGGAAGGAGGAAGG - Intronic
1101815176 12:108140708-108140730 CTGGCAGGGGGTCAGGGGGCAGG - Intronic
1101995897 12:109524638-109524660 CTGGCAAGAGGGGAGGAGGATGG - Intronic
1102150760 12:110688086-110688108 CTCTCAGAGGGGCAGGACGGAGG + Exonic
1103483767 12:121268793-121268815 CTGCCAGGGGGCCAGGAGCTTGG - Intronic
1103649825 12:122423371-122423393 ATCCCAGGGGGGAAGGAGGATGG - Intergenic
1103782439 12:123408079-123408101 ATGTCGGGGGTGCAGGGGGAAGG - Exonic
1103893167 12:124254939-124254961 TGGTCAGGGAGGGAGGAGGAGGG + Intronic
1104065273 12:125300366-125300388 CTGTCAGGGTGTCAGGTGGTCGG - Intronic
1104620476 12:130308148-130308170 AGGCCTGGGGGGCAGGAGGAAGG - Intergenic
1104766020 12:131330879-131330901 CTATAAGGTTGGCAGGAGGATGG - Intergenic
1104842090 12:131830208-131830230 CGGGCAGGGGGGCAGGTGGGTGG - Intronic
1104858450 12:131912758-131912780 CTGTCAGGGCAACAGGAAGACGG + Intronic
1104860440 12:131920786-131920808 CGGGAAGGGGGGCAGGAGGGAGG - Intronic
1104865285 12:131949987-131950009 GCGTCAGGAGGGCGGGAGGATGG - Intronic
1104982725 12:132581494-132581516 CTGTCAGGGGGCCAGTGGGCAGG - Exonic
1105252253 13:18709846-18709868 CTCTCAGGGAGGCAAGAGGCGGG - Intergenic
1105440867 13:20414857-20414879 CTGTCAGGAGGGCGGACGGAGGG + Intronic
1105510994 13:21051624-21051646 GTGTCAGTGGTGGAGGAGGAAGG + Intronic
1106006439 13:25774403-25774425 CTGTTGGGGAGGCAGGGGGAGGG + Intronic
1106627220 13:31433212-31433234 TTGGCAGGGTGGCAGGAGGGAGG - Intergenic
1106710119 13:32322152-32322174 CTGCCAGGGGCTCAGGAGGAGGG - Intronic
1106883392 13:34156607-34156629 CAGGCAAGGGGGCAGAAGGAAGG - Intergenic
1107434483 13:40370243-40370265 GTGTCAGGGGTGCAGCAGGGAGG - Intergenic
1107620804 13:42227100-42227122 CTGTTGTGGGGGCAGAAGGAGGG + Intronic
1107638697 13:42419219-42419241 CTGTAAGGGGGTCAGAAGGATGG - Intergenic
1107812467 13:44213533-44213555 ATGTTAGGGGGTCAGGTGGAAGG - Intergenic
1107860184 13:44653251-44653273 CTGTCAGTGAAGCAGGAGAAAGG + Intergenic
1107871414 13:44749697-44749719 CTGTCAAGGGTGGAGGAGGATGG + Intergenic
1109533311 13:63682897-63682919 CTGTCAGGGGGTGAAGAGCAAGG - Intergenic
1109629787 13:65031835-65031857 CTTACATGGTGGCAGGAGGAAGG + Intergenic
1110540818 13:76704987-76705009 CTGTGAGGGGGGTAGGGGGTAGG + Intergenic
1110803300 13:79725720-79725742 CAGGATGGGGGGCAGGAGGATGG - Intergenic
1111073180 13:83196892-83196914 CTGTCAGGGGGTGGGGAGCAAGG + Intergenic
1111819660 13:93196927-93196949 ATGACAAGGGGGCAGGAGCATGG + Intergenic
1111915463 13:94355928-94355950 CTGTTGTGGGGGCAGGGGGAGGG - Intronic
1111990633 13:95113187-95113209 CTTTTAGGGGGGAAGGAGGGAGG - Intronic
1111994441 13:95150490-95150512 CTGGCAGTGGGGAAGGGGGAGGG - Intronic
1112004342 13:95241517-95241539 CTGCAGGGGGGGCAGGAGGAAGG - Intronic
1112187348 13:97140028-97140050 CTGTAAGGGAGGCAAGAGGATGG - Intergenic
1112326361 13:98444945-98444967 CTGCCACTGGGGGAGGAGGATGG + Intronic
1112419862 13:99238487-99238509 CTGGCAGTGAGGCAGGAGGAGGG - Exonic
1112487288 13:99831397-99831419 CTCTCAGGGAGGCAGGTGGAGGG + Intronic
1112716685 13:102194425-102194447 CTGTCAGGGGGGCAGTGGGAGGG - Intronic
1113190419 13:107739153-107739175 CTGTCAGGCGGTCAGGGGTAAGG + Intronic
1113797100 13:113064870-113064892 CTTTCAGGGCAGCAGGAGGTGGG + Intronic
1116373829 14:44171870-44171892 CTGTCGGGGGGGTGGGGGGAGGG - Intergenic
1116429190 14:44826452-44826474 TTGTCAGGGGTACAGGGGGAGGG + Intergenic
1116671836 14:47851961-47851983 CTGTCGGGGGGGTTGGGGGAGGG + Intergenic
1117181104 14:53192591-53192613 CTGTCAGGGAGGAAGGAAGAAGG + Intergenic
1117472992 14:56065360-56065382 CTGTCAGCGGGGCAGGGGGAAGG + Intergenic
1117726304 14:58677933-58677955 CTGTCAGGAGTGCAGAAGGAGGG - Intergenic
1117890243 14:60413491-60413513 CTGTCATGGGGGCAGGGGAAGGG - Intronic
1118037791 14:61886983-61887005 CTCTCAGGGAGGCAAGAGGCGGG - Intergenic
1118317892 14:64736920-64736942 CAGTGAGCGGGGGAGGAGGAGGG + Intronic
1119182419 14:72613970-72613992 CTGAGAGTGGGGCAGGGGGAAGG - Intergenic
1119589298 14:75870351-75870373 CTCTCAGGGAGGCAAGAGGTGGG - Intronic
1120582370 14:86268375-86268397 CTGTCAGGGGGATGGGGGGAGGG + Intergenic
1120684698 14:87524660-87524682 CTGTCGAGGGGGCAGGAGGAGGG + Intergenic
1120827382 14:88968162-88968184 CTGTGAGCTGGGCAGGAGCAGGG + Intergenic
1120839750 14:89074882-89074904 CTGTCTGGGGGATAGGGGGAGGG + Intergenic
1121122280 14:91383472-91383494 ATGTCCGGGAGCCAGGAGGAAGG + Intronic
1121144616 14:91573637-91573659 CTGGCAGGGGAGGAGGAGGCTGG + Intergenic
1121843614 14:97154851-97154873 CTGCCCGGGTGGCAGGAGGTGGG + Intergenic
1122116903 14:99532252-99532274 CAGACAGGAGGCCAGGAGGATGG + Intronic
1122138377 14:99647436-99647458 CAGTGAGGTGGGCAGGTGGATGG + Intronic
1122538337 14:102481876-102481898 CTGGCAGGGTGGAAGTAGGAAGG - Intronic
1122969791 14:105147889-105147911 CTGTAAGGAGAGGAGGAGGAGGG + Intronic
1123043252 14:105499235-105499257 CCGACAGGGTGGCAGGGGGAGGG - Intronic
1125048998 15:35275545-35275567 CTGTCAGGGGGTGGGGAGCAAGG + Intronic
1125058002 15:35385608-35385630 CTGTCAGGGGGTCAGGGGCTAGG + Intronic
1125084551 15:35714819-35714841 CTGTCAGGGGGTGGGGAGCAAGG - Intergenic
1125118602 15:36125349-36125371 CTGTCAGGGGGTCGGGGGCAAGG - Intergenic
1125434465 15:39630443-39630465 CTGACAGGGAGGGAGGTGGACGG - Intronic
1125862926 15:43014957-43014979 CTGTCAGGGAGGGAGGTGGGGGG + Intronic
1126295554 15:47132952-47132974 CAGTCAGGGGGGGAGGTGGGGGG + Intergenic
1126784965 15:52170545-52170567 CTGTCAGGGGCATAGCAGGAGGG + Intronic
1127122494 15:55783809-55783831 CTGGGATGGGGGGAGGAGGAGGG + Intergenic
1127342126 15:58058189-58058211 ATTTCAGGTGGGAAGGAGGAGGG - Intronic
1127374292 15:58368898-58368920 CTGTCAGGGAGTCAGGGGCAAGG + Intronic
1127580582 15:60335653-60335675 CTGTCATGGGGTCAGGGGCAGGG + Intergenic
1127765046 15:62177414-62177436 CTGTCGGGGGGGTGGGGGGAGGG + Intergenic
1127873387 15:63091406-63091428 CTGTCATGGAGGGAGTAGGAAGG - Intergenic
1128128273 15:65208881-65208903 CTGTCAGGGTGGAAAGAGCAAGG + Intronic
1128641455 15:69341180-69341202 CTGGCAGGGGGGCCGGGGGCGGG - Intronic
1128685824 15:69684865-69684887 CTGTCAGGGGGTCGGGGGCAAGG - Intergenic
1129341665 15:74890338-74890360 CTGTCAGATGGGCAGCAGTAAGG - Intronic
1129675446 15:77630717-77630739 TTGTCAGGGGGTGAGGAGGGGGG + Intronic
1129772608 15:78212501-78212523 CTGGCTGCGGGGCAGGAGGCGGG + Intronic
1129879697 15:78998593-78998615 CTGGCAGTGGGGCAGCAGAAGGG - Intronic
1129880846 15:79005190-79005212 CTGAGGTGGGGGCAGGAGGAGGG + Intronic
1129910590 15:79222899-79222921 CAGTCCGTGGGGCAGGGGGAAGG - Intergenic
1130062447 15:80579615-80579637 GTCCCAGGGAGGCAGGAGGAGGG + Intronic
1130168592 15:81487886-81487908 CTGTCAGGGGGTTGGGGGGAGGG - Intergenic
1130904962 15:88233762-88233784 ATGTCAGGGGAGGAGGAGCAAGG - Intronic
1131673955 15:94651874-94651896 CTCTCAGGGAGGCAAGAGGCGGG + Intergenic
1131929221 15:97420238-97420260 CTGGCAGGTGGGATGGAGGATGG - Intergenic
1132073462 15:98799798-98799820 CTTGAAGGGGGGCAGGTGGAGGG - Intronic
1132239775 15:100248764-100248786 GTGCCAGGAGGGAAGGAGGAAGG + Intronic
1132372018 15:101306050-101306072 CTGTAGGGGAGGCCGGAGGACGG + Intronic
1132443482 15:101892760-101892782 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1132443502 15:101892837-101892859 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1132443544 15:101892991-101893013 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1132443604 15:101893221-101893243 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1132443624 15:101893298-101893320 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1132443644 15:101893375-101893397 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1132443686 15:101893529-101893551 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1132443707 15:101893606-101893628 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1132443768 15:101893837-101893859 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1132443788 15:101893914-101893936 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1132443809 15:101893991-101894013 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1132443829 15:101894068-101894090 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1132443848 15:101894145-101894167 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1132443869 15:101894222-101894244 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1132443909 15:101894375-101894397 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1132481787 16:169945-169967 CAGTCAGTGGGGAAGGAGGAAGG + Intergenic
1132482655 16:174202-174224 CAGTCAGTGGGGAAGGAGGAAGG + Intergenic
1132514077 16:358194-358216 GTGTGAGGGGGAGAGGAGGAAGG - Intergenic
1132671742 16:1104761-1104783 GACTCAAGGGGGCAGGAGGAGGG + Intergenic
1132787719 16:1667220-1667242 CTGTTAGGAGGCCAGGGGGATGG + Intronic
1132788135 16:1669647-1669669 CGGGCAGTGGGGGAGGAGGATGG - Intronic
1132868583 16:2105501-2105523 CTGTCAGCAGCGCAGGAGGCCGG + Intronic
1132910633 16:2308876-2308898 GTGTCAGGGAGGCAGCTGGATGG - Intronic
1132953241 16:2576837-2576859 CTCTCAGCGTGGCCGGAGGAGGG + Intronic
1133271471 16:4612802-4612824 CCGCCAGGGAGGCTGGAGGAAGG - Intronic
1133322574 16:4923420-4923442 CTCTCCTGGGGGCAGGAGGCCGG - Intronic
1133422329 16:5656926-5656948 CTGTCAGGGGGTGGGGAGCAAGG + Intergenic
1133716892 16:8458565-8458587 CTGCCAGAAGGGAAGGAGGATGG + Intergenic
1134001966 16:10789888-10789910 CTCAAAGAGGGGCAGGAGGAGGG + Intronic
1134300648 16:12987588-12987610 CTGTCAGGGAAGCTGGGGGAGGG + Intronic
1134523004 16:14927158-14927180 CTGTCAGCAGGGCAGGAGGCCGG - Intronic
1134549622 16:15132900-15132922 CTGTCAGCAGGGCAGGAGACCGG + Intronic
1134710671 16:16325809-16325831 CTGTCAGCAGGGCAGGAGGCCGG - Intergenic
1134718842 16:16370097-16370119 CTGTCAGCAGGGCAGGAGGCCGG - Intergenic
1134767067 16:16769150-16769172 CTGTCAGTGGGGCTAGGGGAGGG - Intergenic
1134948930 16:18342836-18342858 CTGTCAGCAGGGCAGGAGGCCGG + Intergenic
1134955914 16:18382062-18382084 CTGTCAGCAGGGCAGGAGGCCGG + Intergenic
1135517128 16:23145477-23145499 CTGTCACGGAGGCTGGAGGGTGG - Intronic
1135750817 16:25057531-25057553 CTGTAAGGGGAGTAAGAGGACGG + Intergenic
1136124278 16:28166186-28166208 CTGTAGGGGTGGCAGGAGGTGGG - Intronic
1136289837 16:29264884-29264906 CTGGGAAGGAGGCAGGAGGAAGG + Intergenic
1136401816 16:30023413-30023435 CTGTCTTGGGAGCAGCAGGAAGG + Intronic
1137617815 16:49857386-49857408 CTGCACCGGGGGCAGGAGGAGGG + Intronic
1137622799 16:49887402-49887424 CTTTCACGGGGGCAGAATGATGG - Intergenic
1137705969 16:50536038-50536060 CTGACAGGTGGGCAGGAGTCAGG + Intergenic
1137902118 16:52280038-52280060 TTGTCATGGGGGAAGGAGGGTGG - Intergenic
1138245429 16:55463579-55463601 CTGGCAGGGTAGTAGGAGGAAGG + Intronic
1138347550 16:56329325-56329347 ATGACAGGAGGGCAGGAGGACGG + Intronic
1138879317 16:60991522-60991544 CTGTCATGGGGGTTGGGGGAAGG - Intergenic
1139126783 16:64088227-64088249 CTGTCATGGGGGCAGGTGGTGGG - Intergenic
1139655346 16:68383977-68383999 CTGCCAGGTGGGCCAGAGGAGGG - Intronic
1139777295 16:69324444-69324466 CTGCCAGGGAGCCAGAAGGAAGG + Exonic
1139827109 16:69766116-69766138 CTGTCTGAGGGGCAGGTGTAGGG - Intronic
1139952714 16:70679930-70679952 CGGGCAGGGGGGCGGGGGGACGG - Intronic
1140030305 16:71331975-71331997 CTGTCAGGGGAGTCGGGGGAGGG - Intergenic
1140115128 16:72035270-72035292 CTCTCAGGGAGGCAAGAGGTGGG + Intergenic
1140276412 16:73512771-73512793 GTGTCAGAGGGTCAGGAGGTGGG + Intergenic
1140473099 16:75225913-75225935 CTGGCAGGGTGTGAGGAGGAAGG - Intergenic
1141031060 16:80588988-80589010 CTGTGATAGGGGCAAGAGGAAGG + Intergenic
1141204204 16:81920741-81920763 CTCTCAGCGGGGTAGGGGGAAGG + Intronic
1141311275 16:82915566-82915588 TTGTCAGGTCGACAGGAGGAGGG + Intronic
1141622196 16:85242271-85242293 CTGGCAGAGGGGAAGCAGGAGGG - Intergenic
1141913348 16:87075997-87076019 CCGCCAGTGGGGCTGGAGGAAGG - Intergenic
1142095721 16:88238360-88238382 CTGGGAAGGAGGCAGGAGGAAGG + Intergenic
1142178872 16:88657633-88657655 CGGGCAGGTGGGCAGGAGCAGGG - Intronic
1142223560 16:88866605-88866627 ATGGTAGAGGGGCAGGAGGAAGG + Exonic
1142399351 16:89851261-89851283 CTGGTGGGGAGGCAGGAGGAAGG - Intronic
1142476233 17:191795-191817 CTGTCACGGGGGCGGGGGAACGG - Intergenic
1142691999 17:1612294-1612316 ATGTCAGGGAGGCAGAAGGAAGG - Intronic
1142749695 17:1979812-1979834 CAGTCAAGGGGGGAGGAGGAGGG - Intronic
1142978106 17:3657072-3657094 CTGCCAGGGAGGAGGGAGGAGGG + Intronic
1143117996 17:4591396-4591418 CTGTGAGGAGGGCAGGACCAAGG + Intronic
1143778215 17:9213093-9213115 CGGTCAGGGGAGCAGGTGGGAGG + Intronic
1144207995 17:12992882-12992904 CTGGCAGGCGGCCTGGAGGATGG - Exonic
1144807196 17:17975930-17975952 TGGTCAGGGAGGCAAGAGGAGGG + Intronic
1145229922 17:21166117-21166139 CTGTGAGGGGGGGCGGAGAAAGG - Intronic
1145868518 17:28255874-28255896 GTGGGAGGGAGGCAGGAGGAAGG + Intergenic
1146296095 17:31651877-31651899 CTGTGGAGCGGGCAGGAGGATGG + Intergenic
1146364076 17:32205164-32205186 CTGTCAGGGGGTGAGGGGCAAGG - Intronic
1146671017 17:34737853-34737875 CTGCCTGGGGGGCAAGGGGAGGG - Intergenic
1146705124 17:34995750-34995772 CTGTCGGGGGAGGAGGAGGAGGG - Intronic
1146845266 17:36178429-36178451 CTATCAGGGGAGCAGCAGGGGGG + Intronic
1146873480 17:36390272-36390294 CTATCAGGGGAGCAGCAGGGGGG + Intronic
1146880841 17:36441360-36441382 CTATCAGGGGAGCAGCAGGGGGG + Intergenic
1147037378 17:37691865-37691887 CTGACAAGGGGGCAGGTGGGTGG - Intronic
1147065908 17:37922601-37922623 CTATCAGGGGAGCAGCAGGGGGG - Intergenic
1147386230 17:40083981-40084003 CTGTAAGGGGCCCAGGTGGAGGG + Exonic
1147444698 17:40467654-40467676 TTGTCAGGGGGTGTGGAGGAGGG - Intergenic
1147932927 17:43994377-43994399 CTGTGAGTGGGGCAGGGGAAGGG - Intronic
1148212017 17:45814329-45814351 CAGTTAAGGGGGCAGCAGGAAGG - Intronic
1148240056 17:45994372-45994394 AAGTCAGGGAGGCAGGAGGATGG + Intronic
1148795714 17:50195719-50195741 CTCTCGGGATGGCAGGAGGAAGG + Intronic
1149302729 17:55319540-55319562 CTGTCAGGGAGGCAGCAGTGGGG + Intronic
1150225041 17:63519892-63519914 GAGGCTGGGGGGCAGGAGGAGGG + Intronic
1150479189 17:65496600-65496622 GTGGGAGGGGCGCAGGAGGAGGG + Intergenic
1152026927 17:77815931-77815953 CATTCACAGGGGCAGGAGGAAGG - Intergenic
1152441430 17:80312458-80312480 CTGGCATGGAGGCAGGGGGAGGG + Intronic
1152441457 17:80312545-80312567 CTGGCATGGAGGCAGGGGGAGGG + Intronic
1152863440 17:82709167-82709189 CTGGCATGGGGGCAGGAGACAGG - Intergenic
1152878433 17:82801583-82801605 CGGTCAGCGTGGCAGGAGGGTGG + Intronic
1153054700 18:934486-934508 CTGTGAGGGAGGCTGGAAGAGGG + Intergenic
1153111056 18:1588196-1588218 CTGTCACGGGGGCTGGAGTGCGG + Intergenic
1153537486 18:6117521-6117543 TTGGTAGGAGGGCAGGAGGATGG + Intronic
1153641703 18:7163191-7163213 CTGTAATGGGGGCATGTGGAAGG - Intergenic
1155050533 18:22143549-22143571 CTGTCAGTGGGTCAGCAGGTCGG - Intergenic
1155266947 18:24103712-24103734 CTGGGACTGGGGCAGGAGGAGGG - Intronic
1155526203 18:26718421-26718443 CTCTCAGGGTGGCAGGATGCAGG + Intergenic
1156171897 18:34494652-34494674 CCGTGAGGGGCGCAGGGGGAGGG + Intronic
1156460299 18:37317998-37318020 TTGGCCAGGGGGCAGGAGGAAGG - Intronic
1156550907 18:38015654-38015676 CTGTCTGGGGGTAAGGTGGAGGG - Intergenic
1156797045 18:41058579-41058601 CAGTCAGGGGAAGAGGAGGAGGG - Intergenic
1157008198 18:43612458-43612480 CTGTCAGGGGGTGGGGAGCAAGG - Intergenic
1157491951 18:48129769-48129791 CTGTCAGGGGGTGGGGAGGTGGG - Intronic
1157534491 18:48448364-48448386 CAGTCATGGTGGAAGGAGGAGGG - Intergenic
1157813627 18:50715883-50715905 GTGGCAGGGAGGGAGGAGGAAGG - Intronic
1158020561 18:52836756-52836778 CTGTCATGGGGTCTGGAGGATGG + Intronic
1158528037 18:58232920-58232942 TTGGCAGGGTGGCATGAGGAGGG + Intronic
1158876993 18:61743286-61743308 CTGTAAGGGAGGAAGGAGGTGGG - Intergenic
1158941014 18:62405979-62406001 CAGCCAGGGAGGCAGGAAGAGGG - Intergenic
1158976925 18:62717196-62717218 CTGTGGAGGGTGCAGGAGGAAGG + Exonic
1159055548 18:63459657-63459679 CAGGCATGGGGGTAGGAGGATGG + Intergenic
1159067009 18:63581225-63581247 CTCTCAGGGAGGCAAGAGGCAGG + Intergenic
1159321407 18:66855555-66855577 CTGTCAGGGGGTCGGGGGCAAGG + Intergenic
1159760243 18:72416796-72416818 CTGTCATGAGGGTGGGAGGAGGG + Intergenic
1160507057 18:79433047-79433069 CTGACTGAGGGCCAGGAGGAGGG - Intronic
1160515645 18:79478063-79478085 CAGGCAGGGGGGCAGGGGGCAGG - Intronic
1160517549 18:79486838-79486860 CTGCCAGAGGTGCATGAGGACGG + Exonic
1160641405 19:140243-140265 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
1160641445 19:140397-140419 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
1160726347 19:619395-619417 CTAGCAGGGGGGCAGGGGAATGG + Intronic
1161023965 19:2026493-2026515 ATGATAGGAGGGCAGGAGGAAGG + Intronic
1161078601 19:2299217-2299239 CTGCCGGGGAGGCAGGAGGGGGG + Intronic
1161085478 19:2333081-2333103 CTGGGAGGGGAGCAGGAGGAGGG + Intronic
1161085516 19:2333202-2333224 CTGGGAGGGGAGCAGGAGGAGGG + Intronic
1161233772 19:3188184-3188206 CTGCCCGGGGGGCTGGAGGGAGG - Intronic
1161303744 19:3555978-3556000 CTGTTGGGAGGGCAGGAGGCTGG - Intronic
1161407268 19:4097653-4097675 CTCTCTGGAGGGCAGGGGGAGGG + Intronic
1161473785 19:4473628-4473650 CAGTCAGGGGGGAAGGTTGAGGG + Intronic
1162044738 19:7991076-7991098 CTCTCAGAGGGGCAGGAGCCTGG - Intronic
1162433706 19:10644227-10644249 ATGTCAGGGGGAGAGGTGGAGGG + Exonic
1162458145 19:10798233-10798255 GTGACCGGGGGGCAGGAGGCAGG - Intronic
1162515096 19:11142844-11142866 CTGCCTGGGGGGGACGAGGATGG + Intronic
1162567924 19:11454291-11454313 CTGGGGTGGGGGCAGGAGGATGG + Exonic
1162727934 19:12701077-12701099 CTGCCAGGAGGGCAAGTGGACGG + Exonic
1162760738 19:12886878-12886900 CTGGCAGGGGGTGAGGAGGGTGG - Intronic
1163118935 19:15204260-15204282 CTCTCAGGGAGGCAAGAGGCGGG + Intergenic
1163172572 19:15542699-15542721 CTATCAGGGTGGCAGGAGGAGGG - Intronic
1163179140 19:15586457-15586479 CTGTGGTGGGGGCAGGAGGAGGG - Intergenic
1163666578 19:18606505-18606527 CTGGCAGGGGGGAAGGAGTGGGG + Intronic
1163719583 19:18892678-18892700 GTTTCATGGGGACAGGAGGAGGG - Intronic
1163745348 19:19043437-19043459 TTGAGATGGGGGCAGGAGGAGGG - Intronic
1164177928 19:22793548-22793570 CTGTCAGAGGGGCAAGGGGAGGG - Intergenic
1164212779 19:23114888-23114910 CTGTGACTAGGGCAGGAGGATGG - Intronic
1164731028 19:30504514-30504536 GTCAGAGGGGGGCAGGAGGAGGG - Intronic
1164800087 19:31068957-31068979 CTGCCAGGGGAGGAGGAGGAAGG - Intergenic
1164953061 19:32355159-32355181 CTGTCAAGGAGGCAGCAGGCAGG - Intronic
1165348342 19:35262757-35262779 CTGTCCTGGGGGCAGGTGGATGG - Intronic
1165831926 19:38734781-38734803 CTGGGATAGGGGCAGGAGGAGGG - Intronic
1165985366 19:39764056-39764078 CTGTCAGGGGGGCAGGGGAAGGG + Intergenic
1166181731 19:41113542-41113564 TGCTCAGGAGGGCAGGAGGAGGG + Intergenic
1166382430 19:42362025-42362047 GTGTCTGGGAGGCAGAAGGAGGG + Intronic
1166391031 19:42409020-42409042 CTGTGAGGTGGGGAGTAGGATGG + Intronic
1166818897 19:45564292-45564314 CTGGAAGGGGGGCAGGTAGAGGG + Intronic
1167041364 19:47024403-47024425 CTCTCAGGGAGGCAAGAGGCGGG + Intronic
1167169480 19:47821751-47821773 ATGTCATGGGGGGAAGAGGAGGG + Intronic
1167333073 19:48868100-48868122 GTGACGGGGGGGCAAGAGGACGG + Exonic
1167556182 19:50197404-50197426 GTGTCAGGGGTCCAGGGGGATGG + Intronic
1167571736 19:50292894-50292916 TGGTGAGGGGGGCCGGAGGAGGG + Intronic
1168432717 19:56294057-56294079 CTGTCAGTGCAGCATGAGGACGG - Intronic
925994399 2:9280149-9280171 GTGACAGGGTGGGAGGAGGAGGG + Intronic
926212581 2:10882058-10882080 CTGTTGTGGGGGCAGGAGGAGGG - Intergenic
926238035 2:11063527-11063549 CTGTCATGGAGGCAGGAGGAGGG + Intergenic
926727311 2:16008663-16008685 CTGTCAGGGAGGGAGGGAGACGG + Intergenic
926934447 2:18073063-18073085 TGGTCAAGGAGGCAGGAGGAAGG + Intronic
927012918 2:18924620-18924642 GGGTCAGTGGGGCAGGAGGGAGG + Intergenic
927015609 2:18957071-18957093 CTGTCAGGGGTGCCAGGGGAGGG + Intergenic
927108201 2:19845406-19845428 CTGGCAGGGGGCCAGGAGGGAGG + Intergenic
927246288 2:20959448-20959470 CAGTGGGTGGGGCAGGAGGATGG + Intergenic
927471974 2:23384191-23384213 CAGACAGGGGTGGAGGAGGAGGG + Intergenic
927964726 2:27262074-27262096 CGCTCAGAGGGGCAGGTGGACGG + Intronic
928106106 2:28471566-28471588 CTGTGAGGGTGACAGGAAGAGGG + Intronic
928133747 2:28672488-28672510 CTGTCAGTGGGGCGAGGGGAGGG + Intergenic
928134678 2:28679466-28679488 CTGTGAGTGGGGCATGTGGATGG - Intergenic
928226171 2:29450073-29450095 CTGTCAAGGAGGGAGCAGGAAGG - Intronic
928544431 2:32315932-32315954 CTCTCAGGGAGGCAAGAGGCAGG + Exonic
929294268 2:40228810-40228832 GTGTCAGGGGTGGAGGAGGGTGG + Intronic
929452462 2:42046975-42046997 CAATCAGGGAGGGAGGAGGAGGG + Intergenic
929605681 2:43232679-43232701 GTGTCAGGGGAGTAGGAGGCAGG - Intronic
930106077 2:47640525-47640547 CTGCCAGGGGCGCCGGAGGATGG + Intergenic
930111858 2:47685535-47685557 CTGTCAGTGGTGCTGGAAGAAGG - Intergenic
930369622 2:50486656-50486678 GTGTGAGTGGGGCATGAGGAGGG + Intronic
930807591 2:55506796-55506818 GAGGCAGGAGGGCAGGAGGATGG - Intergenic
931873161 2:66483317-66483339 CTCTCAGGGAGGCAAGAGGCAGG - Intronic
932428473 2:71658915-71658937 CTGTCTTGGGGGCATGGGGATGG - Exonic
932481514 2:72042221-72042243 GTGTGAGGTGGGCAGGGGGATGG + Intergenic
933003045 2:76951778-76951800 CTGTCAGGGGGAGGGGAGCAAGG - Intronic
934296584 2:91747541-91747563 ATGTCAGGGGTGCAGGGGGAAGG + Intergenic
934464906 2:94253225-94253247 CTGTCAGGGGGGTGGGAGGCTGG - Intergenic
934751965 2:96799449-96799471 GGGACAGTGGGGCAGGAGGAAGG - Intronic
935584720 2:104790375-104790397 CTCTCCTGGGGGCAGGAGGAGGG - Intergenic
935961092 2:108426191-108426213 CTGTCAGTGGGGCAGGGGGAGGG + Intergenic
936268816 2:111032785-111032807 CAGTCAGGGAGGAAGGGGGATGG - Intronic
936626670 2:114156147-114156169 CTGTCAGTGGGGCGGCGGGAGGG + Intergenic
937067155 2:119026158-119026180 CTGGCAGTGCGGCAGGCGGAGGG - Intergenic
937234039 2:120419667-120419689 CTGCCAGGAGGGCAGGAGTCAGG - Intergenic
937340686 2:121088766-121088788 GGCTCAGGGAGGCAGGAGGAGGG - Intergenic
937712875 2:124997807-124997829 CTGTGAGGGTGGAAGCAGGATGG + Intergenic
937912424 2:127082012-127082034 CAGGCAGGCGGGCAGGGGGAAGG + Intronic
938669253 2:133571461-133571483 CTAGCAGGCGGGCAGGAGGCGGG - Intergenic
938952728 2:136270344-136270366 GTGGCTGGAGGGCAGGAGGAGGG + Intergenic
939118134 2:138085045-138085067 CTGTCAGTGGGGTTGCAGGAAGG - Intergenic
939244513 2:139606450-139606472 CTGTCATGGGGGGTGGAGGGAGG + Intergenic
939562318 2:143747074-143747096 CTGTCAGGGGGTGGGGAGAAAGG + Intronic
940023050 2:149176561-149176583 ATGTCATGGGGGCAGGCAGAGGG - Intronic
940426134 2:153533982-153534004 CTCTCAGGGAGGCAAGAGGTGGG - Intergenic
940696463 2:156985239-156985261 CTGTCAGGGGGACAGAGGGAGGG - Intergenic
940884319 2:158975591-158975613 GTGTCAGGGGTGTAGGAGGCGGG + Intronic
941182982 2:162283812-162283834 GTGTCTGGGGGGCTGGAAGAAGG + Intronic
941602908 2:167563415-167563437 CTGTCCGGGAGGGAGGTGGAGGG - Intergenic
943014348 2:182493428-182493450 CTGTCACGGGGTGAGGAGGCGGG - Intronic
943667744 2:190628034-190628056 CTGCCAGGGGAGCAGCTGGAGGG - Intergenic
944268442 2:197754130-197754152 CTGTCAGGGGGTCGGGGGCACGG + Intronic
944476831 2:200115063-200115085 CTCTCAGGGAGGCAAGAGGTGGG - Intergenic
945023793 2:205600651-205600673 CTGTCGGGGTGGCAGTGGGAGGG - Intronic
945054964 2:205860510-205860532 CTGCCAGGGGAGCACGAGGGAGG - Intergenic
945140082 2:206676422-206676444 CTGTCAGGGGGTCGGGGGCAAGG + Intronic
945388041 2:209227761-209227783 CTGTCAGTGGGGCAAGGAGAGGG - Intergenic
945520585 2:210822420-210822442 CTGTCAGAGGGGCATGGGGAGGG + Intergenic
947146997 2:227077488-227077510 CTGTCAGGGGGTCAGGGGTAAGG + Intronic
947341617 2:229146321-229146343 CTGTCAGGGGGTCAGGGGCAAGG + Intronic
947736060 2:232456179-232456201 ATGTCTTGGGGGCAGCAGGAGGG - Exonic
947808117 2:232982351-232982373 CCATCAAGGGGGCAGGAAGATGG + Intronic
948398717 2:237667175-237667197 CTGTCAGGAGGTCAGGGGGAAGG - Intronic
948444661 2:238022988-238023010 GTGTGAAGGGGACAGGAGGAAGG + Intronic
948487532 2:238290243-238290265 ATGTCAGAGGAACAGGAGGAGGG - Intergenic
948505138 2:238423231-238423253 CTGTGAGGGGGGCTGAAAGAGGG + Intergenic
948777006 2:240294419-240294441 CAGTTGGGGAGGCAGGAGGAGGG - Intergenic
948973704 2:241449212-241449234 CTCTCAGGGAGGCAAGAGGCGGG + Intronic
948995445 2:241576064-241576086 CTGGCAGGGGAGGAGGAGGAGGG - Intergenic
949017168 2:241720073-241720095 CTTCCAGAGGGACAGGAGGATGG + Intronic
949037145 2:241821116-241821138 GTGGCAGGAGGGCAGGAGGAAGG - Intergenic
949045089 2:241869017-241869039 CTGCCAGGAGGGCAGGGGGTGGG + Intergenic
1168895646 20:1321578-1321600 CTGTCTGGAGAGCAGCAGGACGG - Intronic
1169037479 20:2465493-2465515 CTCTCAGGGAGGCAAGAGGCGGG - Intronic
1169289707 20:4338670-4338692 CTGTCAGGGGGTGAGGGGCAAGG - Intergenic
1169400498 20:5275286-5275308 CTGTCAGGAGGCCAGGAGGCTGG - Intergenic
1169756461 20:9048296-9048318 CTGTCAAGGGGCCAGTGGGAGGG + Intergenic
1169857814 20:10123034-10123056 CTGTCAGGGGGCCGGGAGAAGGG + Intergenic
1169895263 20:10498442-10498464 CTGGCAGGGGCACAGGAGGCAGG - Intronic
1170075998 20:12419779-12419801 CTGTTGTGGGGGCAGGAAGAAGG - Intergenic
1170628706 20:18049800-18049822 AGGTCTGTGGGGCAGGAGGAGGG + Intronic
1170769120 20:19316985-19317007 TTGTCAGAGGGGTGGGAGGAGGG - Intronic
1170884246 20:20325389-20325411 TTGTGGGGGAGGCAGGAGGAAGG - Intronic
1171413266 20:24960476-24960498 CTGTTGGGGGTGCACGAGGAGGG + Intergenic
1171795256 20:29561389-29561411 CTGTGAGGGTGGCAGAGGGATGG + Intergenic
1171853200 20:30322876-30322898 CTGTGAGGGTGGCAGAGGGATGG - Intergenic
1172449101 20:35009219-35009241 CCGTCATGGGGGAAGGAAGACGG + Intronic
1172608296 20:36230605-36230627 CTACCAGGGGGGCAGGGAGAAGG - Exonic
1173758742 20:45541230-45541252 CTGTTGAGGGGGCAGGGGGAGGG + Exonic
1173766533 20:45615365-45615387 CAGTCAAGTGGGCAGGAGGCAGG + Intronic
1173868967 20:46330147-46330169 CTGCCAGGGGAGCTGGAGGCAGG + Intergenic
1174042981 20:47713034-47713056 CTGTCTGGGGGGCAGGGGTGGGG + Intronic
1174248313 20:49198961-49198983 TTGGCGGGGGGGCAGGGGGACGG - Intergenic
1175309619 20:58002690-58002712 CTGTCAGGGGGGTGGGGGGCTGG + Intergenic
1175366084 20:58457127-58457149 GTGTCAGGTGGGCAGGAGGAGGG + Intergenic
1175385425 20:58591900-58591922 ATGTGAGGGAGGCAGGAGGTCGG + Intergenic
1175432202 20:58913297-58913319 CTGGTAGGGAGGCAGGAGTATGG - Intergenic
1175640003 20:60620978-60621000 CTGTGAGGGGGAATGGAGGAAGG + Intergenic
1175777695 20:61663514-61663536 GGGTCAGAGGGGCCGGAGGAAGG + Intronic
1175865093 20:62171319-62171341 CTTTCATGGGGGCAGGAGAAAGG + Intronic
1176079187 20:63263133-63263155 CTGACTGGGGGCCAGCAGGAGGG - Intronic
1176120747 20:63453519-63453541 CTCTCAGCGGGGTAGGAGCAGGG + Intronic
1176126946 20:63479824-63479846 CTGAGAGGGCGTCAGGAGGAGGG + Intergenic
1176236153 20:64054458-64054480 CTGGCAGGGGAGAAGGAGGCTGG - Intronic
1176408997 21:6437591-6437613 CTGGCAGGGAGGCAGGTGGGAGG - Intergenic
1176837775 21:13809703-13809725 CTCTCAGGGAGGCAAGAGGCGGG - Intergenic
1177193874 21:17881930-17881952 CTGTTAGGGGGTCAGGAGCTAGG + Intergenic
1177659471 21:24064163-24064185 CTGTCAGGGGGGTTGGGGGCAGG + Intergenic
1177833942 21:26170203-26170225 CAGACAGGGGGGAAGGGGGAAGG - Intronic
1178744979 21:35240297-35240319 CTGTCAGGAGGTCAGGTGGGGGG + Intronic
1178794454 21:35731012-35731034 GGGTCAGTTGGGCAGGAGGATGG + Intronic
1179043010 21:37821538-37821560 CTGTTGGGGGGGCAGGGGAAAGG - Intronic
1179054963 21:37922865-37922887 CTGTCAGGGGGTGGGGAGCAAGG - Intergenic
1179136844 21:38687254-38687276 CAGCCAGGGTGGCAGGAGGAAGG - Intergenic
1179349716 21:40596664-40596686 TGGTCAGGGGTGCAGGAGGTAGG - Intronic
1179684490 21:43045913-43045935 CTGGCAGGGAGGCAGGTGGGAGG - Intergenic
1179841618 21:44079459-44079481 CTGGCATGGGGTCTGGAGGATGG + Intronic
1179905464 21:44420475-44420497 CTGGCAGGGTTGCAGGAGGCTGG + Intronic
1179983382 21:44907807-44907829 CAGGCAGGGGGGCAGGTGGGAGG + Intronic
1180117496 21:45720216-45720238 CTGTCAGGGGGTCGGGGGTAAGG - Intronic
1180206001 21:46261027-46261049 GTGTCAGGGGAGCTGGAGTAGGG - Intronic
1180206779 21:46265704-46265726 ATGTCAGGGAGCCAGGAGGAGGG + Intronic
1180278804 22:10673504-10673526 CTGTCAGGGGGGTGGGAGACTGG - Intergenic
1180586060 22:16892352-16892374 CTGTCAAGGGGGTGGGAGGCTGG - Intergenic
1181048325 22:20227048-20227070 ATGTGAGGGGGTCAGGAGGGAGG + Intergenic
1181173263 22:21022070-21022092 CTGTCAGGAGGGAAGGGGCAGGG + Intronic
1181286478 22:21756057-21756079 CTGTCTGGTCGGCAGCAGGAAGG - Exonic
1181536600 22:23549462-23549484 CAGTCAGGGGGCCGGGAAGAGGG - Intergenic
1181538841 22:23562317-23562339 CTGCCAGGGAGGAAGAAGGATGG + Intergenic
1181786180 22:25228818-25228840 ATGTCATAGGGACAGGAGGATGG + Intronic
1181818351 22:25456648-25456670 ATGTCATAGGGACAGGAGGATGG + Intergenic
1182276905 22:29195534-29195556 CTGTCAGGAGGGAAAGGGGACGG + Intergenic
1182344274 22:29649453-29649475 CTCTCAGGGAGGCAAGAGGTGGG + Intronic
1182443416 22:30376965-30376987 CTGTCGGGAGGGAAGCAGGAAGG - Intronic
1182702389 22:32250950-32250972 CTGTCAGGGGGTGAGGGGCAAGG + Intronic
1183277426 22:36907967-36907989 TATTCAGTGGGGCAGGAGGAGGG + Intergenic
1183329440 22:37211693-37211715 CTCCCAGGGAGGCAGGAGGGAGG - Intronic
1183383722 22:37503276-37503298 CTGGTGTGGGGGCAGGAGGAGGG - Intronic
1183569337 22:38640493-38640515 TTTTCAGGGGCGTAGGAGGATGG - Intronic
1183612928 22:38922794-38922816 CTGACAAGGGGGTAGGATGAAGG + Intergenic
1183629705 22:39025758-39025780 CAGGCAGGGGGGCAGGACGGAGG - Intronic
1183642240 22:39099764-39099786 CTGGCAGGAGGACAGGAGGAGGG - Intronic
1184042428 22:41952107-41952129 CTCTCAGGATGGCAGGAGGTGGG - Intergenic
1184120139 22:42444671-42444693 CTGTCAGGAAGGCTGGGGGAGGG - Intergenic
1184330216 22:43822310-43822332 CTGGCTGGCCGGCAGGAGGATGG + Intergenic
1184777084 22:46628635-46628657 GTGTCTGAGGGGCAGGTGGAGGG + Intronic
1184814872 22:46861776-46861798 CTGACAGTGGGGCAGGAGGTGGG + Intronic
1185255308 22:49828092-49828114 CCCTGAGGGGGTCAGGAGGATGG + Intergenic
1185295200 22:50049665-50049687 CAGGCAGGGGTGGAGGAGGAGGG + Intronic
949152888 3:791695-791717 CTGTCTGGGGCGGAGGAGGGTGG + Intergenic
949574253 3:5323339-5323361 CTGTCAGAGGGCCAGGAGACAGG + Intergenic
949612476 3:5716599-5716621 CTGTCAGTGGGGTAGGAGAAGGG - Intergenic
949896726 3:8772894-8772916 CTGTCACGGGGGCAGAGGGAGGG - Intronic
950107021 3:10394759-10394781 CTGGCAGGGGGAAGGGAGGAGGG + Intronic
950200119 3:11036690-11036712 GTGGCAGGGGTGCAGGAGGTGGG + Intronic
950471809 3:13190997-13191019 GTGTGTTGGGGGCAGGAGGAGGG - Intergenic
950493093 3:13318050-13318072 CTGTCCAGGGGGCATGAGGCAGG + Intronic
950587700 3:13907202-13907224 CTGTCGTGGGGACAGGGGGAAGG + Intergenic
950713386 3:14829807-14829829 CTGACAGGTGGGGAGGAGGAAGG - Intronic
950816292 3:15706237-15706259 CTGTCATGGGGTGGGGAGGAGGG - Intronic
952106524 3:30076457-30076479 CTGTAATGGGGGAAGGGGGAAGG - Intergenic
952731597 3:36642549-36642571 CTCTCAGGGAGGCAAGAGGTGGG - Intergenic
953388188 3:42519029-42519051 CTGACAGGGAGGCAGGAAGGAGG - Intronic
953533246 3:43756872-43756894 CTTTCATGGGGACAGGAGAAAGG - Intergenic
953863492 3:46564631-46564653 CTGGGAGGGGGACAGGAGCAAGG + Intronic
954149795 3:48651669-48651691 CTGACAGGGGTTCAGGAGGCAGG + Exonic
954297466 3:49682217-49682239 CTGTCAAGGGGTCAAGGGGAAGG - Intronic
954356013 3:50084462-50084484 CTGTCCGGGAGGGAGGTGGAGGG - Intronic
954430707 3:50469593-50469615 ATCTCAGGGGAGCAGGAGCAAGG - Intronic
954442668 3:50530377-50530399 CTATTAGAGGGGCAGGAGGGGGG - Intergenic
954770078 3:52959120-52959142 CTGTCAAGGGGGACGGGGGAGGG + Intronic
954879241 3:53822686-53822708 CTGGCACCTGGGCAGGAGGAAGG + Intronic
956059660 3:65336577-65336599 CAGTCAAGGGGGCAAGAAGAGGG + Intergenic
956231618 3:67022812-67022834 CTGTCAGTGGGGCAAGGGGAGGG + Intergenic
956244320 3:67164461-67164483 CTGTCATGGGGGCAGTGGGAGGG + Intergenic
956843522 3:73161376-73161398 TTGCCAGGAGGGCAGGAGGGAGG - Intergenic
957004501 3:74928458-74928480 CTGTCAGGGGGTCGGGGGAAAGG + Intergenic
957349205 3:79001115-79001137 CTGTCAGGGGGTCGGGGGAAAGG + Intronic
957914086 3:86663527-86663549 CTGTCAGTGGGGGTGGGGGAAGG + Intergenic
958782548 3:98560102-98560124 GTGTCATGGGAGCAGGGGGAGGG + Intronic
959466517 3:106694029-106694051 GTGTCAGGGGGTCAGGATCATGG + Intergenic
959739920 3:109706139-109706161 CTGTCAGGGGGACAGGGGGAGGG - Intergenic
959775146 3:110150576-110150598 CTATCAAGGGGGGAGGGGGAGGG - Intergenic
959832171 3:110876871-110876893 CTGTCAGGGGGTGAGGGGCAAGG - Intergenic
959838992 3:110952081-110952103 CTGTCATGAGGGCAGGATGAAGG - Intergenic
960550789 3:118973945-118973967 TTGTCAGAGGGGCCGGGGGAAGG + Intronic
960739595 3:120818545-120818567 CTGTCGCGGGGGCAGGGGCAAGG - Intergenic
960828426 3:121817252-121817274 CTGTCAGGGGGTAGGGAGCAAGG + Intronic
960963871 3:123091141-123091163 CAGCCAGGGTGACAGGAGGAGGG - Intronic
961061392 3:123831965-123831987 CTGGCAGGGGTGAGGGAGGAAGG + Intronic
961198893 3:125028184-125028206 CTAGCATGGGGGTAGGAGGATGG - Intronic
961524373 3:127487272-127487294 CAGTCAGGGTTGCAGCAGGAGGG - Intergenic
961651828 3:128420761-128420783 CAGCCAGGGTGGCAGGAGCAGGG - Intergenic
961816991 3:129556174-129556196 CTGGGGCGGGGGCAGGAGGAGGG - Exonic
961990370 3:131183432-131183454 CTGTCATGGGGCCAGGGGGAGGG - Intronic
962157346 3:132961877-132961899 CTGTCAGGGGGTTAGGGGCAAGG + Intergenic
962822097 3:139059258-139059280 CAGTCAGGGGGGCAGGGAGAGGG - Intronic
962969833 3:140389285-140389307 CTGTCAGGGGTGTGGGAGGAGGG - Intronic
962973499 3:140426274-140426296 CTGTCAGGTGGCAGGGAGGAGGG - Intronic
963019951 3:140863497-140863519 CTGGCAGGGGGGCAGTGGCAGGG + Intergenic
963589174 3:147234989-147235011 CTGTCAGTGGGGCAAGGGGAGGG - Intergenic
964099553 3:152972538-152972560 CTGTCAGGGGGTCAGGGGCTAGG + Intergenic
964555717 3:157936020-157936042 CTGCCAGAGGTGAAGGAGGAGGG + Intergenic
965654460 3:170969289-170969311 CTGTCAGGGGGTCAGGGGCTAGG - Intergenic
966093095 3:176163968-176163990 CTGTCAGGGGGTGGGGAGGTAGG + Intergenic
966673082 3:182551487-182551509 CTGTCAGGGGGTTTGGGGGAGGG - Intergenic
966789820 3:183656812-183656834 CTCTCAGGGAGGCAAGAGGCGGG + Intronic
966925018 3:184639102-184639124 ATATCAGGGGTGCAGGAGCAGGG + Intronic
966976679 3:185090782-185090804 CTGCCAGTGGGGCAGAATGAAGG - Intronic
967187136 3:186953978-186954000 CTGTCAGGGGGCCTGGGGGAGGG - Intronic
967707883 3:192673535-192673557 CTGTCAGGGGGGCAGGAGGAGGG - Intronic
967843437 3:194025820-194025842 GAGTGAGGGTGGCAGGAGGAAGG - Intergenic
967929613 3:194681311-194681333 CTTTCAGAGGGGCAGGTTGAAGG + Intergenic
968525056 4:1052499-1052521 CTGGCAGGGGGGCAGGACCACGG - Intergenic
968545085 4:1194280-1194302 CAGTCAGGGTGGCAGGAAAAAGG + Intronic
968690219 4:1986391-1986413 CTTTGAGTGGGGCTGGAGGACGG + Exonic
968728988 4:2261066-2261088 CTTTTAAGGGGGCGGGAGGAGGG - Intronic
969244674 4:5924665-5924687 CTCTCGGGGAGGAAGGAGGAGGG + Intronic
969321703 4:6416780-6416802 CTGGCAGGGCTGGAGGAGGAGGG + Intronic
969443649 4:7232252-7232274 CTGCCTGGTGGCCAGGAGGAAGG + Intronic
969497375 4:7533820-7533842 CTGTAAAGCGGGCAGGTGGAAGG + Intronic
969594285 4:8140096-8140118 CTGTCAGAGGGGTGGGGGGAGGG + Intronic
969623849 4:8292603-8292625 CTGTCAGGGGAGCTGGGGCAAGG + Intronic
970284280 4:14492794-14492816 CTGTCAGGGTGTCGGGGGGAAGG - Intergenic
970496876 4:16635135-16635157 CTGTCAGGGGGTGGGGAGCAAGG + Intronic
970590972 4:17560507-17560529 GTGTCAGCTAGGCAGGAGGAAGG - Intergenic
970594970 4:17591695-17591717 CTGTAAGGTGGGAAGGAGCAGGG + Intronic
970636977 4:18021181-18021203 CGGGCAGGGCGGCCGGAGGAAGG - Intronic
970637383 4:18023553-18023575 ATCTCTGGGTGGCAGGAGGAGGG + Intergenic
970888711 4:21017338-21017360 CTGTCAGGGGGTTGGGAGAAGGG - Intronic
971374962 4:26049313-26049335 CTATCAGGGGTGCAGGAGATGGG + Intergenic
971438354 4:26652484-26652506 CTCTCAGGGAGGCAAGAGGTGGG - Intronic
971438825 4:26657232-26657254 CTGTCAGGGGGTCAGAGGCAAGG - Intronic
972238942 4:37167831-37167853 CTGTTGGAGGGGCAGGGGGATGG + Intergenic
972904648 4:43729665-43729687 CTGTCATGGGGTCGGGAGGGAGG + Intergenic
973113826 4:46429458-46429480 CTGTAGGGTGTGCAGGAGGAAGG - Intronic
973284249 4:48397656-48397678 CTGTCAGGGGCGGCGGGGGAAGG - Intronic
973736035 4:53872516-53872538 CTAGCAGTGGTGCAGGAGGATGG - Intronic
974724908 4:65786040-65786062 CTGTCAGAGTGCCAGGAGAATGG + Intergenic
974856980 4:67473174-67473196 CTCTCAGGGAGGCAAGAGGCGGG - Intronic
975018338 4:69453466-69453488 CTGTCAGGGGGTGGGGAGGTAGG + Intergenic
976786469 4:88826986-88827008 CTGTAAGTGGGGAAGGAAGAGGG - Intronic
977001161 4:91505088-91505110 CTGTCAGTGGGGTAGGGGAAGGG - Intronic
977090818 4:92673817-92673839 CTGTCATGGGGTGGGGAGGAAGG + Intronic
977122498 4:93120589-93120611 CTGTCAGGGAGTGAGGAGCAAGG + Intronic
977463489 4:97355773-97355795 GTGTCAGGTGGGAAGGAAGAGGG - Intronic
977639935 4:99345966-99345988 CTGTTATGGTGGAAGGAGGAGGG + Intronic
977882995 4:102227341-102227363 CTGTCAGGGGGTTGGGGGGAAGG + Intergenic
977945082 4:102903906-102903928 CTATCAAGGGGGCAGGGGCAGGG + Intronic
978502263 4:109422109-109422131 CTGTCAGGGGGAGTGGGGGAAGG - Intergenic
978612578 4:110559940-110559962 CTGTCAGGGGGTGGGGAGAAAGG - Intronic
978923785 4:114217754-114217776 CTGACAGGTGGGAAGGAGGAGGG + Intergenic
978948032 4:114522718-114522740 CTGTCAGGGGGTCAGGAGCAAGG - Intergenic
979148572 4:117278411-117278433 CTGTGAGGGGATCAGGAGCAAGG - Intergenic
979609242 4:122671947-122671969 CAGGCAGAGGGGCAGGATGACGG - Intergenic
980123965 4:128755544-128755566 CTCTCAGGGAGGCAAGAGGCAGG + Intergenic
981742768 4:148020443-148020465 CTGTCAGCGGGGCAGGGGGAGGG - Intronic
982059610 4:151591600-151591622 CTGTCAGGGGGCCAGGGGCCAGG - Intronic
983283944 4:165715748-165715770 CTCACAGGGTGGAAGGAGGAAGG - Intergenic
984439233 4:179745782-179745804 CTGTCAGGGGGTTGGGGGGAAGG + Intergenic
985266881 4:188159189-188159211 CTGTCGGTGGGGCAGGGGGAGGG - Intergenic
985374756 4:189323135-189323157 CTGTCAGGTGGGCTAGAGAAAGG + Intergenic
985524259 5:394148-394170 CTGTCTGGGTGGCAGGAGGGAGG + Intronic
985573984 5:665297-665319 CTGCAAGAGGAGCAGGAGGAAGG + Intronic
985720206 5:1484929-1484951 GTGTCAGGGGAGGCGGAGGACGG + Intronic
985802157 5:2011704-2011726 CAGCCAGGGCTGCAGGAGGAGGG - Intergenic
986268054 5:6207292-6207314 CTGTCAGGGGGTGAGGGGGTGGG + Intergenic
986306252 5:6519155-6519177 CAGTCGGGGTGCCAGGAGGAGGG - Intergenic
986438677 5:7759518-7759540 CTTACAGAAGGGCAGGAGGAGGG - Intronic
986485870 5:8236353-8236375 CTGTTTTGGGGGAAGGAGGAGGG - Intergenic
986507763 5:8470549-8470571 CCATCAGGGGGTCTGGAGGATGG + Intergenic
986642212 5:9883219-9883241 CTGTCCGGGGTACAGGGGGAGGG + Intergenic
986994148 5:13586943-13586965 CTGTCAGGGGGTGGGGTGGAGGG - Intergenic
987275690 5:16359995-16360017 CTGTCAGGGGGTCGGGGGTAAGG + Intergenic
987430903 5:17831809-17831831 CTGTCAGGGGGTCTGGAGCAAGG - Intergenic
987753561 5:22070970-22070992 CTGTCAGGGGTGGATGGGGAGGG + Intronic
987768957 5:22275121-22275143 CTGTCAGGAGGTCAGGGGCAAGG + Intronic
988430716 5:31115428-31115450 CTGTCAGGGGAGCAGGAAGAGGG + Intergenic
988464715 5:31477548-31477570 CTGGCAGGGGGCCAGGAGGTGGG - Intronic
988490786 5:31703470-31703492 CTGTCGGGGGGTCGGGGGGAAGG + Intronic
989244169 5:39234884-39234906 CTGTCAGGGGGTCGGGGGCAAGG + Intronic
989364470 5:40640257-40640279 CTGTCAGGGGGTGAGGAGCCAGG + Intergenic
989603724 5:43224147-43224169 CTCTCAGGGAGGCAAGAGGGGGG - Intronic
991019579 5:61965870-61965892 CTGTCAGAGGAGTAGGATGAGGG + Intergenic
991327975 5:65459121-65459143 CTCTCAGGGAGGCAAGAGGCGGG - Intronic
991576446 5:68108568-68108590 CTGTCGGGGGGTCAGGGGGCTGG + Intergenic
992013306 5:72552329-72552351 TTGGCAGAGGGGCAGGAGAAAGG - Intergenic
992073532 5:73170576-73170598 CTGATTGGAGGGCAGGAGGAGGG + Intergenic
992168231 5:74076112-74076134 CTCTCAGAAGGGCAGGAAGAGGG - Intergenic
992335388 5:75762831-75762853 CTGTCAGTGGGGCAGGAGGAGGG - Intergenic
992482813 5:77168321-77168343 CTGGCACGGGGGCTGGAGGGAGG + Intergenic
992527889 5:77629903-77629925 CCGTCAGAAGGCCAGGAGGAGGG + Exonic
992814902 5:80427128-80427150 CTCTCAGGGAGGCAAGAGGCAGG - Intronic
992864694 5:80946029-80946051 CTGTCGGGGAGGCAGAGGGAGGG - Intergenic
992907774 5:81363142-81363164 GTGTCAGGGTGCCTGGAGGAGGG - Intronic
993744083 5:91574612-91574634 CTCTCAGGGAGGCAAGAGGCGGG + Intergenic
993775852 5:91994579-91994601 CTTACATGGTGGCAGGAGGAAGG + Intergenic
993858701 5:93107450-93107472 CTGGGGTGGGGGCAGGAGGATGG - Intergenic
994028914 5:95118014-95118036 CTGTCAAGGGGTGAGGTGGAGGG + Intronic
994594152 5:101809118-101809140 CTGTCAGGGGGTGAGGGGCAAGG + Intergenic
995618369 5:113993900-113993922 CTGTCAGGGGGTTGGGAGGAAGG - Intergenic
995831481 5:116360195-116360217 CTGAGATGGGGGCAGGAGCAGGG + Intronic
995964265 5:117885187-117885209 TTTTCAGGGGGGAGGGAGGAGGG - Intergenic
995970274 5:117961006-117961028 CTTTCAGGAGGGAAAGAGGAGGG - Intergenic
996055689 5:118979842-118979864 CTGTCAGGAGGGCAGGGGGTGGG + Intronic
996060197 5:119024472-119024494 CTGTCAGGGGGTGAGGGGAAAGG - Intergenic
996506062 5:124268812-124268834 CTGTTAGGGGTTCAGGGGGAGGG - Intergenic
996756905 5:126945257-126945279 CTCTCTGGGGGAAAGGAGGAGGG - Intronic
996767026 5:127044859-127044881 CTCTCAGGGAGGCAAGAGGTGGG - Exonic
996776033 5:127133961-127133983 CTCTCAGGGAGGCAAGAGGCGGG - Intergenic
996830260 5:127732841-127732863 GGGTGAGGGTGGCAGGAGGAAGG + Intergenic
997079138 5:130717353-130717375 CTCTCAGGAGGGGAGGAGGATGG + Intergenic
997744004 5:136283052-136283074 CATTCAGGGAGGGAGGAGGAAGG - Intronic
997883427 5:137610940-137610962 GTGTTAGGGAGGAAGGAGGAAGG - Intergenic
998161001 5:139813003-139813025 CTGGCAGCGGGGCAGGGGCAGGG + Intronic
998183429 5:139961363-139961385 CTGGCAGGAGGGGAGGAGGGGGG - Intronic
998405894 5:141874528-141874550 CCGTCAGGGGTGTAGGAGTAAGG + Intronic
998497553 5:142603711-142603733 CTCTGAGGGGGGCAGTAAGATGG + Intronic
998596051 5:143531620-143531642 CTGTCTTGGGGGCAGGGGGATGG - Intergenic
999246910 5:150159975-150159997 CTCTCAGTGGGGCAGGGGGAGGG + Intergenic
999318825 5:150601020-150601042 GTGTCAGGGGGGCGGGCGGGAGG - Intergenic
999529460 5:152446409-152446431 CTGTCAGGGGGTGAGGTGTAAGG - Intergenic
999624069 5:153501710-153501732 CTGGCAGATGGGCAGGAGGATGG + Intronic
1000159455 5:158583292-158583314 CTGTCCGGGAGGCAGGTGGGGGG + Intergenic
1000266235 5:159640896-159640918 CTGGCAGGGGGGCGGGCTGAGGG + Intergenic
1000593384 5:163185552-163185574 GTGTTAGCGGGTCAGGAGGAAGG + Intergenic
1001028585 5:168245149-168245171 CTGTGAGGGTGGGAGCAGGAGGG - Intronic
1001173231 5:169441475-169441497 CTGCCATTGGGGCAGGAGGGAGG - Intergenic
1001357370 5:171041890-171041912 CTGTCGGGGGTGCAGTGGGAGGG - Intronic
1002101656 5:176860893-176860915 CTGGCAGGTGGGCAGGAGGCAGG + Intronic
1002314984 5:178337627-178337649 CTGTAGAGGGGGCAGGAGGTTGG + Intronic
1002735392 5:181384009-181384031 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1002735413 5:181384086-181384108 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1002735435 5:181384163-181384185 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1002735476 5:181384317-181384339 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1002735496 5:181384394-181384416 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1002735535 5:181384548-181384570 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1002735554 5:181384625-181384647 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1002735574 5:181384702-181384724 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1002735594 5:181384779-181384801 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1002735614 5:181384856-181384878 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1002735655 5:181385010-181385032 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1002735692 5:181385164-181385186 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1002735711 5:181385241-181385263 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1002735730 5:181385318-181385340 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1002735750 5:181385395-181385417 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1002735771 5:181385472-181385494 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1002735811 5:181385626-181385648 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1002735888 5:181385934-181385956 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1002735908 5:181386011-181386033 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1002735929 5:181386088-181386110 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1002735949 5:181386165-181386187 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1002748733 6:88583-88605 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
1002748791 6:88811-88833 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
1002748811 6:88888-88910 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
1002748850 6:89041-89063 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
1002748870 6:89118-89140 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
1002749030 6:89733-89755 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
1002749070 6:89886-89908 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
1002749107 6:90039-90061 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
1002787715 6:417160-417182 CTACCAGTGTGGCAGGAGGAGGG - Intergenic
1002966432 6:1970798-1970820 CTGTCAGGGAGGTGGAAGGAGGG + Intronic
1004154933 6:13159145-13159167 GTGGCAGCGGGGCTGGAGGAAGG - Intronic
1004396190 6:15248351-15248373 CTTGCAGGCGGGCAGGAGGGCGG + Intronic
1005151800 6:22760170-22760192 CTGTCAGGGGGCATGGAGGGAGG - Intergenic
1005238582 6:23795650-23795672 CTGTCAGGGTGGTCGGGGGAGGG + Intergenic
1005267950 6:24132841-24132863 CTGTCAGGGGGTGGGGAGCAAGG - Intronic
1005641088 6:27797041-27797063 CTCTCAGGGAGGCAAGAGGCGGG + Intergenic
1005780322 6:29185228-29185250 CTGTCACGGGTTCAGGGGGAAGG - Intergenic
1006059857 6:31411776-31411798 CTTCCAGGCTGGCAGGAGGATGG - Intronic
1006196118 6:32243580-32243602 CTGTCCAGGGGGGTGGAGGAAGG + Intergenic
1006300429 6:33191110-33191132 CTGGCATGGAGGCAGGGGGATGG - Intronic
1006380500 6:33694548-33694570 CAGGCAGGCGGGCGGGAGGAAGG + Intronic
1006518096 6:34555734-34555756 CAGTCTGGGGAGCATGAGGAGGG + Intronic
1006594255 6:35181558-35181580 GTGGCAGGAGGGCAGGAGTATGG - Intergenic
1007229018 6:40335162-40335184 GTGGCAGATGGGCAGGAGGAGGG + Intergenic
1007315340 6:40983780-40983802 CTGGGATGGGGGCAGGTGGAAGG - Intergenic
1007519594 6:42441323-42441345 CTCAAAGGGGGGAAGGAGGAGGG + Intronic
1007704907 6:43784557-43784579 CGGTGAGCCGGGCAGGAGGAAGG + Exonic
1007812695 6:44497579-44497601 CTGTAGGGTGGGCAAGAGGAGGG - Intergenic
1008357440 6:50571051-50571073 CTGTCAGGGGGTGGGGAGTAAGG - Intergenic
1008624098 6:53300887-53300909 CTGGCAGGAGGGCTGCAGGAAGG - Intronic
1009706300 6:67256605-67256627 CTGTGAGAGGGGCAGTGGGAGGG - Intergenic
1010356414 6:74939043-74939065 CTGTCAGTCGGGGAGGAAGAGGG + Intergenic
1010538122 6:77055969-77055991 CTCTTAGGTAGGCAGGAGGAAGG + Intergenic
1010593723 6:77739565-77739587 CTGTCAGGGGGTGGGGAGCAAGG + Intronic
1010664652 6:78614404-78614426 CTGTCAGTGGGGCAGGGGGAGGG + Intergenic
1010768612 6:79803872-79803894 ATGTCAGGGACACAGGAGGAGGG + Intergenic
1011518257 6:88176067-88176089 CTCTCAGGGAGGCAAGAGGCAGG + Intergenic
1012020292 6:93909294-93909316 CTTTCAGGGGAGTAGGGGGAGGG + Intergenic
1012161054 6:95886510-95886532 TTGTCAGGGGTGCTGGGGGAGGG - Intergenic
1013687317 6:112600798-112600820 CTGTCAGGGGGGAATGGGAAAGG - Intergenic
1013752688 6:113425442-113425464 CTGTCAGGGGGTTGGGAGCAAGG + Intergenic
1014045261 6:116877257-116877279 GTGTCCGGCGGCCAGGAGGATGG + Exonic
1014142816 6:117963966-117963988 CTGTCAGGGGTACAGAGGGAAGG - Intronic
1015226616 6:130864442-130864464 CTGCGAGCGGGGCTGGAGGAGGG + Intronic
1016592527 6:145762400-145762422 CTGTCACGGGCGAAGGCGGAGGG + Intergenic
1016955503 6:149622756-149622778 CTGGCAGGGGGGCGGGGGGTGGG + Intronic
1017722416 6:157253194-157253216 CTGGCATAGGTGCAGGAGGATGG - Intergenic
1018335173 6:162779025-162779047 CTGTCAGTGGAGCAGAGGGAGGG - Intronic
1018460504 6:163994354-163994376 CTGTCAGAGGGGCAAGGGAAGGG + Intergenic
1019138998 6:169931365-169931387 CTGAGAGTGGGGCAGGAGCAAGG - Intergenic
1019226266 6:170512567-170512589 AGGTCAGGGGAGCTGGAGGACGG + Intergenic
1019239658 6:170656326-170656348 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019239697 6:170656480-170656502 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019239734 6:170656634-170656656 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019239754 6:170656711-170656733 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019239796 6:170656865-170656887 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019239817 6:170656942-170656964 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019239837 6:170657019-170657041 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019239858 6:170657096-170657118 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019239897 6:170657249-170657271 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019239917 6:170657325-170657347 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019239936 6:170657402-170657424 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019239956 6:170657479-170657501 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019239975 6:170657556-170657578 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019239996 6:170657633-170657655 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240053 6:170657847-170657869 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240073 6:170657924-170657946 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240094 6:170658001-170658023 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240115 6:170658078-170658100 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240135 6:170658155-170658177 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240174 6:170658309-170658331 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240195 6:170658386-170658408 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240216 6:170658463-170658485 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240253 6:170658617-170658639 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240291 6:170658771-170658793 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240311 6:170658848-170658870 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240331 6:170658925-170658947 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240350 6:170659002-170659024 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240389 6:170659156-170659178 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240409 6:170659233-170659255 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240429 6:170659310-170659332 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240449 6:170659387-170659409 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240469 6:170659464-170659486 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240545 6:170659772-170659794 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240584 6:170659925-170659947 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240622 6:170660079-170660101 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240661 6:170660233-170660255 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240681 6:170660310-170660332 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240717 6:170660464-170660486 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240757 6:170660617-170660639 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240777 6:170660694-170660716 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240797 6:170660771-170660793 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240838 6:170660924-170660946 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240898 6:170661154-170661176 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240919 6:170661231-170661253 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240939 6:170661308-170661330 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240978 6:170661461-170661483 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019240999 6:170661538-170661560 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019241019 6:170661615-170661637 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019241040 6:170661692-170661714 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019241060 6:170661769-170661791 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1019397533 7:830093-830115 CTGTTAAGGGGGAAGGAGGAAGG + Intronic
1019543288 7:1560927-1560949 CGGGCAGGGGGGAAGGTGGAGGG - Intergenic
1019605397 7:1907560-1907582 CCGCCACGGGGCCAGGAGGAAGG + Intronic
1019953186 7:4390234-4390256 CCGTCAGGGAGGGAGGTGGAGGG - Intergenic
1020033182 7:4947349-4947371 CTTACATGGGAGCAGGAGGAAGG + Intronic
1020635750 7:10693981-10694003 CTGTCATGGGGTTAGGGGGATGG + Intergenic
1022815010 7:33905291-33905313 CGGAGAGGGGGCCAGGAGGAAGG - Intronic
1022844642 7:34197611-34197633 CTGTCATGGGGAGGGGAGGAGGG + Intergenic
1023802746 7:43849178-43849200 CTGACAGCTGGGAAGGAGGAGGG + Intergenic
1024272862 7:47655597-47655619 CTGCCAGGCTGGAAGGAGGAGGG + Intronic
1024479057 7:49845123-49845145 CTGTCAGTGGGGGTGGGGGAAGG + Intronic
1025663920 7:63572336-63572358 CTGTCAGGCTGGCAGGAAGGCGG + Intergenic
1025818467 7:64942038-64942060 CTGTCACGCAGGCAGGAGTATGG - Intergenic
1026095538 7:67343548-67343570 CTGTCCTGGGTGCAGGATGAAGG + Intergenic
1026165031 7:67902000-67902022 CTGGAAGGGGGGCGTGAGGACGG - Intergenic
1026449976 7:70519828-70519850 CTGTCAGCTGGCCATGAGGAGGG + Intronic
1026505741 7:70981057-70981079 CTGTCTTGGGGGCAGGAGCAGGG - Intergenic
1026805930 7:73429637-73429659 CTGTCAGGGTGCCAGGAGGTGGG - Intergenic
1027513719 7:79115024-79115046 CTTTCAGGAGAGCAGGACGATGG - Intronic
1028165081 7:87529534-87529556 CTGTCAGAGGGGCCAAAGGAAGG - Intronic
1028271087 7:88790419-88790441 CTGTCAGGGGTGCAAGGGGAGGG - Intronic
1028297807 7:89156926-89156948 CAGTGAGGGAGGAAGGAGGAGGG + Intronic
1028805410 7:95020620-95020642 CTGTCTGGGGGACAGGATGGGGG - Intronic
1028887078 7:95946146-95946168 CTGTCAGGGGGGCAGGGGGAGGG + Intronic
1029010069 7:97250445-97250467 CTGTCAGAGGGGCAGGGGGAGGG - Intergenic
1029458019 7:100680701-100680723 CAGTGAAGGGGGCAGGAGGAGGG - Exonic
1029941554 7:104485767-104485789 CTGTCAGAGGGGTGGGAGGCTGG - Intronic
1030826850 7:114169181-114169203 CTGTTCTGGGGGCTGGAGGACGG - Intronic
1031019225 7:116608901-116608923 CTGTCAGGGGGTGAGGAGTTAGG + Intergenic
1032024952 7:128433913-128433935 CTTGCAGGTGGCCAGGAGGAGGG - Intergenic
1032077059 7:128840975-128840997 GTGGCTGGGGGGCAGGAGGAGGG + Intronic
1032089976 7:128906638-128906660 TTCTCAGGGAGGAAGGAGGAAGG + Intronic
1032326165 7:130930418-130930440 CTGTCAGTGCTGCTGGAGGAAGG - Intergenic
1033390687 7:140924736-140924758 CTGTCGGGCGGGGAGGGGGAAGG + Exonic
1033611829 7:142970620-142970642 CTGTCAGAGGTGCTGGTGGAGGG + Intergenic
1034549860 7:151813660-151813682 CTGTCTGGTGGAGAGGAGGAGGG - Intronic
1034762477 7:153686023-153686045 CTGTCAGGGGGTCAGGTTGCAGG + Intergenic
1035243319 7:157546425-157546447 CTGTCAGTGGGGAAGGGGGATGG - Intronic
1035507054 8:146326-146348 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
1035507074 8:146403-146425 CTCTCAGGGGGACAGGGGGAAGG + Intergenic
1035507095 8:146480-146502 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
1035507115 8:146557-146579 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
1035507136 8:146634-146656 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
1035507195 8:146865-146887 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
1035507253 8:147096-147118 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
1035507272 8:147173-147195 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
1035507293 8:147250-147272 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
1035507350 8:147481-147503 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
1035507370 8:147558-147580 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
1035507411 8:147711-147733 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
1035507470 8:147942-147964 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
1035507511 8:148095-148117 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
1035507532 8:148172-148194 CTCTCAGGGGGACAGGGGGTAGG + Intergenic
1035574780 8:697533-697555 TTGACAGGGAGGCAGGAGGAGGG - Intronic
1035646550 8:1226467-1226489 CTGTCAGGGGGCAAGGGGGAGGG + Intergenic
1035724062 8:1813798-1813820 CGGGGAGGGGGGCAGGAGGTTGG - Intergenic
1035766189 8:2107510-2107532 CTGTGGGCTGGGCAGGAGGATGG + Intronic
1035856016 8:2977257-2977279 CTGTCAGTAGGGTAGGGGGAGGG - Intronic
1035900879 8:3457206-3457228 CAGTGAGGAGGGCAGGATGAGGG - Intronic
1035994439 8:4530491-4530513 CTGTCAGGGGGTCGGGGGAAAGG - Intronic
1037537245 8:19835989-19836011 CTGTCAGGGGGTCGGGGGCAAGG + Intronic
1037615700 8:20517215-20517237 CTGTCATGGGAGCAGGGGGAGGG + Intergenic
1037637098 8:20710013-20710035 CTGTTGCGGGGGCAGGAGGAGGG - Intergenic
1037838248 8:22227219-22227241 GTGTCAGGGGGGTTCGAGGAGGG - Intronic
1037990625 8:23319271-23319293 CTGTGATGGGGGCGGGAGGGTGG + Intronic
1038147475 8:24912750-24912772 CTGTCAGGTTGGCAGGGGGCAGG - Intergenic
1038942000 8:32315232-32315254 CTGTCAGGGGGGTGGGCAGAGGG - Intronic
1038984598 8:32794729-32794751 CTGTCACGGGGTCGGGGGGAAGG - Intergenic
1040446055 8:47494747-47494769 CTTTCAAGAGGGGAGGAGGAAGG - Intronic
1040565713 8:48564903-48564925 TAGTCAGGGGAGCAGGAGCAGGG + Intergenic
1040588407 8:48765732-48765754 CTGACAGGGGCCCAGGAGCAAGG + Intergenic
1040611870 8:48993057-48993079 CTGTCAGGGGTTGAGGGGGAAGG - Intergenic
1040865828 8:52048135-52048157 CTGTCAGGGGGTGGGGAGCAAGG + Intergenic
1041480227 8:58311982-58312004 CTGTCAGGGGGTCAGGGGTAGGG - Intergenic
1041746916 8:61217356-61217378 CTTTAAGGGGAGAAGGAGGAGGG + Intronic
1041772934 8:61491946-61491968 CTATCATGGGGGCAGGAGGAGGG + Intronic
1041929330 8:63269688-63269710 TTTTCAGGGGGATAGGAGGAGGG + Intergenic
1043770814 8:84197681-84197703 CTCTCAGGGAGGCAAGAGGCGGG + Intronic
1043796395 8:84547113-84547135 CTGTTGGGAGGGCAAGAGGAGGG - Intronic
1043817548 8:84820700-84820722 CTGTCAGGGGGCAAGGGGAAAGG - Intronic
1044014194 8:87030918-87030940 GGGGAAGGGGGGCAGGAGGAGGG - Intronic
1044220608 8:89664736-89664758 TTGTTAGGGGGGTAGGAGGCAGG - Intergenic
1044313574 8:90724831-90724853 GTGTCTGGGGGACAGGAAGAAGG - Intronic
1044554656 8:93549791-93549813 CTGTCAGGGGGTCGGGGAGAGGG + Intergenic
1045455345 8:102373087-102373109 CTCTCAGGGAGGCAAGAGGTGGG - Intronic
1045704925 8:104911359-104911381 CTGTCAGGGGTGAGGGACGAGGG - Intronic
1046039439 8:108884507-108884529 TTGTCAGGGGGGAAGGATAATGG - Intergenic
1047201067 8:122768115-122768137 CTGTCAGGGGGTGGGGAGGTAGG + Intergenic
1047312933 8:123707689-123707711 CTGTCAGGGGGTCAGGGGCAAGG + Intronic
1047438028 8:124851478-124851500 CTGTCAGGGAGTCAAGAGTAGGG + Intergenic
1047561087 8:125988758-125988780 CTCTCAGGGAGGCAAGAGGCTGG - Intergenic
1048016998 8:130506597-130506619 CTGTCAGAGGCACAGAAGGAGGG + Intergenic
1048541090 8:135342779-135342801 CTGTCAGGGGGTGGGGAGCAAGG - Intergenic
1048559811 8:135522096-135522118 CTGTCATGGGGGCAGGGGGAGGG - Intronic
1048941601 8:139405000-139405022 CTGTCAAGAGGGCAGAAGGCCGG + Intergenic
1048976402 8:139675274-139675296 CAGGCAGTGGGGCAGGTGGAAGG - Intronic
1049231746 8:141488336-141488358 ATGTCAGGGAGGAAGGAGGGAGG - Intergenic
1049319286 8:141987403-141987425 CTGTCAGGAGGTCAGGAGGTAGG + Intergenic
1049349593 8:142157458-142157480 CTGGAAGGAGGGCAGGTGGAGGG - Intergenic
1049377753 8:142297054-142297076 CTGTGAAGTGGGCAGGTGGAAGG - Intronic
1049447785 8:142639335-142639357 CTGACAGGGGGACAGGTGGATGG + Intergenic
1049854947 8:144855659-144855681 CTTTCTGGGGGGCAGGTGCAGGG + Intergenic
1050472603 9:6008172-6008194 CTGGGAGGGGGCGAGGAGGAAGG + Intergenic
1050522799 9:6519198-6519220 CTGTCATGGGGTCGGGGGGAGGG - Intergenic
1050635654 9:7609681-7609703 CTCTCAGGGAGGCAAGAGGCGGG - Intergenic
1051237538 9:15017572-15017594 GTGTCAGGGGGAGAGGAGGGAGG - Intergenic
1052165366 9:25319786-25319808 CTGTCAGGGGGGTGGGGGGAGGG - Intergenic
1052749222 9:32472032-32472054 CTGTGAGGTGGTCAGGATGAGGG + Intronic
1053173719 9:35908016-35908038 CTGTGAGGGCTGCAGGAGGAGGG + Intergenic
1053214925 9:36262744-36262766 CTGTCAGGGGTGCTGTAGGAAGG - Intronic
1053641027 9:40080252-40080274 CTGGCAGGGGGGTTGGGGGATGG + Intergenic
1053765109 9:41385216-41385238 CTGGCAGGGGGGTTGGGGGATGG - Intergenic
1053790994 9:41686175-41686197 CTGTGAGGGTGGCAGAGGGATGG - Intergenic
1053941974 9:43260341-43260363 CTGTCAGGGGGGTGGAAGGCTGG - Intergenic
1054154156 9:61628597-61628619 CTGTGAGGGTGGCAGAGGGATGG + Intergenic
1054179340 9:61897869-61897891 CTGTGAGGGTGGCAGAGGGATGG - Intergenic
1054473944 9:65559717-65559739 CTGTGAGGGTGGCAGAGGGATGG + Intergenic
1054543725 9:66296378-66296400 CTGGCAGGGGGGTTGGGGGATGG - Intergenic
1054658198 9:67682952-67682974 CTGTGAGGGTGGCAGAGGGATGG + Intergenic
1054813561 9:69453995-69454017 CAGTGTGGTGGGCAGGAGGATGG - Intronic
1055235744 9:74120722-74120744 CTGTGAGGCAGGCAGGAGTAGGG + Intergenic
1055294458 9:74820157-74820179 CTGTCAGGGTGGAGGGGGGAGGG - Intronic
1055424542 9:76180675-76180697 CTGTCTGGGGGACTGGAGTATGG - Intronic
1056057568 9:82843230-82843252 CTGTCGAGGGGTCAGGGGGAGGG + Intergenic
1056481270 9:87008834-87008856 TAGTCAGGAGGCCAGGAGGAAGG - Intergenic
1056561984 9:87738550-87738572 CTGTCAGGGGGGTGGGAGGAGGG + Intergenic
1056726611 9:89124681-89124703 CTGTCAGGGGGTGAGGGGAAGGG + Intronic
1056948883 9:91026069-91026091 GTGTCAGGGAAGCAGGAGGAAGG - Intergenic
1057275315 9:93673203-93673225 GTGGCTGGGGTGCAGGAGGAAGG + Intronic
1058190783 9:101912295-101912317 CAGTCAGGGAGGGTGGAGGAAGG + Intergenic
1059337025 9:113575382-113575404 CTGTCAGAGGCTCAGGAGGGCGG - Intronic
1059571763 9:115445329-115445351 CTGTCAGGAGGGAGGAAGGATGG - Intergenic
1059925788 9:119208024-119208046 CTCTCAGGGGCACAGAAGGAAGG - Intronic
1060005019 9:119992192-119992214 CTGACTGGGAGGGAGGAGGAGGG - Intergenic
1060817172 9:126641107-126641129 CTGGCACGGGGGCATGTGGAAGG + Intronic
1060944520 9:127562037-127562059 CTGCCCGCGGGGAAGGAGGAGGG + Intronic
1061368228 9:130183427-130183449 CTGGCAGGGGAGCAGGGGGAGGG + Intronic
1061473512 9:130846513-130846535 GTGTGGGGGGGACAGGAGGATGG - Intronic
1061537279 9:131257972-131257994 GTATCTGGGGGGCAGGAGGATGG - Intergenic
1061577035 9:131513816-131513838 CAGTCAGGGAGGAAGGAGGAGGG - Intronic
1061725561 9:132580410-132580432 CTGTCGGGGAGGCGGGAGGGCGG - Intergenic
1062130463 9:134889897-134889919 CTGTCGGGAGGGCTGGAAGAAGG + Intergenic
1062196445 9:135276716-135276738 CTGCAATGGGAGCAGGAGGAGGG - Intergenic
1062675330 9:137739864-137739886 CGGGCAGGGAGGAAGGAGGACGG + Intronic
1062708807 9:137960394-137960416 CTGACTGGGGGGGAGGGGGAGGG + Intronic
1203600314 Un_KI270748v1:7389-7411 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203600335 Un_KI270748v1:7466-7488 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203600356 Un_KI270748v1:7543-7565 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203600395 Un_KI270748v1:7697-7719 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203600415 Un_KI270748v1:7774-7796 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203600436 Un_KI270748v1:7851-7873 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203600455 Un_KI270748v1:7928-7950 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203600493 Un_KI270748v1:8082-8104 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203600533 Un_KI270748v1:8236-8258 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203600553 Un_KI270748v1:8313-8335 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203600592 Un_KI270748v1:8467-8489 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203600611 Un_KI270748v1:8544-8566 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203600649 Un_KI270748v1:8698-8720 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203600670 Un_KI270748v1:8775-8797 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203600691 Un_KI270748v1:8852-8874 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203600711 Un_KI270748v1:8929-8951 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203600732 Un_KI270748v1:9006-9028 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203600753 Un_KI270748v1:9083-9105 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203600774 Un_KI270748v1:9160-9182 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203600793 Un_KI270748v1:9237-9259 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203600814 Un_KI270748v1:9314-9336 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203600852 Un_KI270748v1:9468-9490 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203600873 Un_KI270748v1:9545-9567 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203600894 Un_KI270748v1:9622-9644 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203600931 Un_KI270748v1:9776-9798 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203600969 Un_KI270748v1:9930-9952 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203600989 Un_KI270748v1:10007-10029 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203601009 Un_KI270748v1:10084-10106 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203601049 Un_KI270748v1:10237-10259 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203601070 Un_KI270748v1:10314-10336 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203601091 Un_KI270748v1:10391-10413 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203601112 Un_KI270748v1:10468-10490 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203601132 Un_KI270748v1:10545-10567 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203601153 Un_KI270748v1:10622-10644 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203601173 Un_KI270748v1:10699-10721 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203601212 Un_KI270748v1:10852-10874 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1203601233 Un_KI270748v1:10929-10951 CTCTCAGGGGGACAGGGGGTAGG - Intergenic
1185824376 X:3235835-3235857 CTATCAGGGGAGCAGGGGGAGGG - Intergenic
1186083265 X:5956695-5956717 AAGCCAGGGAGGCAGGAGGAGGG + Intronic
1187178247 X:16916624-16916646 CTGTTGGGGGGGGAGGGGGAGGG - Intergenic
1188147308 X:26630000-26630022 CTGACAGGATGGCAGGAGGCCGG + Intergenic
1188833274 X:34927551-34927573 AAGACAGGGGGGCAGGGGGAAGG + Intergenic
1189316802 X:40062455-40062477 TTGTCACGTGGGGAGGAGGAGGG - Intronic
1189390303 X:40570782-40570804 CAGTGAGTGGGGCAGGAGAAAGG + Intergenic
1189425083 X:40892539-40892561 CTGTCATGGGGGCGAGGGGAGGG + Intergenic
1190056906 X:47186410-47186432 CTGTGAGGGGTGCTGGGGGATGG - Intronic
1190149921 X:47936817-47936839 CTCTCCGGGGGGCGGGGGGAGGG + Intronic
1190252518 X:48737832-48737854 CTGGAACGTGGGCAGGAGGAAGG - Intergenic
1190862047 X:54354525-54354547 CTGTCAGGGAGGCGGAAGGAGGG + Intronic
1190920804 X:54850671-54850693 CTGTCAGGGGGTGGGGAGCAAGG + Intergenic
1190942265 X:55053364-55053386 CTGTCAAGGGGGCGAGGGGAGGG + Intergenic
1191024912 X:55903769-55903791 CTGTTAGGGAGGTAGGAGAATGG - Intergenic
1191054262 X:56226140-56226162 CTGCCATGGGCACAGGAGGAGGG + Intergenic
1191094130 X:56657115-56657137 CTGTCAGGGGGTGGGGAGTAAGG - Intergenic
1191224945 X:58032836-58032858 CTGTCAGGGATGCAGGGAGAGGG - Intergenic
1191875336 X:65789135-65789157 CTGTCAGGGAGGCAGGGTGGGGG + Intergenic
1192050213 X:67717798-67717820 CTGGCAGGAGCCCAGGAGGATGG + Intronic
1192358223 X:70423047-70423069 CTGGGAGGGGAACAGGAGGAGGG + Exonic
1192512245 X:71729056-71729078 CTCTCAGGGAGGCAAGAGGCGGG - Intergenic
1192514452 X:71752449-71752471 CTCTCAGGGAGGCAAGAGGCGGG + Intergenic
1192630230 X:72771733-72771755 CTCTCAGGGAGGCAAGAGGCGGG + Intergenic
1192651480 X:72949071-72949093 CTCTCAGGGAGGCAAGAGGCGGG - Intergenic
1192929765 X:75793594-75793616 CTGTCATGGGGGGAGGGGGGAGG - Intergenic
1192933151 X:75829909-75829931 TTGTCAGGGGGTCAGGGGCAAGG - Intergenic
1193159312 X:78209933-78209955 CTGTCAGGGGGTTGGGGGGAGGG + Intergenic
1193364507 X:80615550-80615572 CTGTCAGGGGGACAGAGGGAGGG - Intergenic
1193364640 X:80617322-80617344 CTGTCAGGGGGACAGAGGGAGGG - Intergenic
1193478318 X:81995254-81995276 CTGTATTGGGGGCAGAAGGAGGG - Intergenic
1194456216 X:94106907-94106929 CTGTCAGGGGGTGAGGGGCAAGG + Intergenic
1194492144 X:94565178-94565200 CTGTCAGGGGGTGAGGGGCAAGG - Intergenic
1194830735 X:98619837-98619859 CTGTCAGGGGGTCTGGAAGATGG + Intergenic
1194952987 X:100149015-100149037 CTGTCAGGGGGTAAGGGGCAAGG + Intergenic
1195199636 X:102535316-102535338 CTGTCAGGGGGTCGGGGGCAAGG + Intergenic
1195249995 X:103033718-103033740 CTGTCAGGGGTGCAGTGGGAAGG + Intergenic
1195470089 X:105220534-105220556 CGGTCAGGGGGTCATTAGGACGG - Intronic
1196214131 X:113030385-113030407 CTGTCAGTGGGGCAGATGGAGGG + Intergenic
1196676847 X:118429046-118429068 CTGTCAGGGGGATGGGAGGAGGG + Intronic
1196985960 X:121271125-121271147 ATGTCAGGGAGACAGGGGGAGGG + Intergenic
1198170887 X:134104110-134104132 CTGTCAGGGGGTCAGGGTAAAGG + Intergenic
1198762136 X:140043320-140043342 CTGTCAGGGGGTGAGGGGCAAGG - Intergenic
1198874667 X:141210758-141210780 CTGTCAGGAGGGTACGGGGAGGG - Intergenic
1199330797 X:146555917-146555939 CTGTCAGGGGGTGGGGAGCAAGG + Intergenic
1199411478 X:147528621-147528643 CTGATGGGGGGGGAGGAGGAGGG - Intergenic
1199990268 X:152983823-152983845 ATGGCAGGGTGCCAGGAGGAAGG - Intergenic
1200033358 X:153313297-153313319 ATGGCAGGGTGCCAGGAGGAAGG - Intergenic
1200212984 X:154355135-154355157 CTGTGTGGGCGGCAGGCGGACGG - Intronic
1200270712 X:154679973-154679995 CTCTCTGGGAGGCAGGATGAGGG + Intronic
1201722145 Y:17111301-17111323 CTCTCAGGGAGGCAAGAGGTGGG - Intergenic