ID: 967708133

View in Genome Browser
Species Human (GRCh38)
Location 3:192676266-192676288
Sequence TCACACTTCCTAGACAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967708129_967708133 30 Left 967708129 3:192676213-192676235 CCAGCTCACATCACTACAAGACA 0: 1
1: 0
2: 0
3: 11
4: 111
Right 967708133 3:192676266-192676288 TCACACTTCCTAGACAGAACAGG 0: 1
1: 0
2: 0
3: 10
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967708133 Original CRISPR TCACACTTCCTAGACAGAAC AGG Intronic
903024968 1:20421616-20421638 TCACATTTCCATGACAGAAGCGG - Intergenic
904590570 1:31613078-31613100 ACACACTTCCCAGGAAGAACAGG + Intergenic
905357741 1:37396521-37396543 TCACACTTCCATGACTGAAAGGG - Intergenic
911502817 1:98709776-98709798 ACACACTTTCTAGACAGAAGTGG - Intronic
916745962 1:167685029-167685051 TCATAATTTCTAGACAGTACAGG + Intronic
919468770 1:197953114-197953136 GCCCACTGCCTAGACAGAGCCGG - Intergenic
1063759931 10:9062344-9062366 TCACACTTTCTAGCCTGCACAGG - Intergenic
1068433700 10:56963941-56963963 TCACACCTCCTAGGCAGGAGTGG + Intergenic
1068545566 10:58341301-58341323 TCATTCTTTCTAGAAAGAACTGG - Intronic
1068917983 10:62453357-62453379 TCCCACTTATAAGACAGAACAGG + Intronic
1075920039 10:126203817-126203839 CCACACTCCCAACACAGAACTGG - Intronic
1077316784 11:1922873-1922895 TCACACTTCCTCGTCAGACATGG - Exonic
1077384487 11:2262614-2262636 TGTCACCTCCTAGGCAGAACAGG + Intergenic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1079866045 11:25735479-25735501 ACTCACTGCCTAGACAGAATTGG - Intergenic
1079941264 11:26683713-26683735 TCACAATTCCCAGTCAAAACTGG - Intronic
1080290962 11:30670819-30670841 TCATACTTCAGAGACAGAAGGGG - Intergenic
1080381774 11:31779342-31779364 TCACAGTTCCCAGACAGAAGGGG - Intronic
1080875896 11:36274075-36274097 TCAGACTTCCTACACTGAAGAGG + Exonic
1081192634 11:40122480-40122502 TCCCACTTATAAGACAGAACAGG + Intronic
1088747526 11:112816971-112816993 CCTCTCTTCCTAGAGAGAACTGG - Intergenic
1089455543 11:118623471-118623493 TCACACTTCCCGGGCAGGACTGG + Intronic
1091370311 11:135051904-135051926 GAACACTTCCTAGAGAGAAGGGG - Intergenic
1091555706 12:1571968-1571990 TAACACTTCATAGAAATAACAGG - Intronic
1097447919 12:59695869-59695891 TCACACTTCCTAATCAAATCGGG - Intronic
1098434230 12:70451626-70451648 TCACAGTTCATAGACTGTACTGG - Intergenic
1102028323 12:109726061-109726083 TCACACAGCCTACAGAGAACGGG - Intronic
1106049387 13:26176183-26176205 TCGCCCTTCCTAGTCAAAACTGG + Intronic
1118486013 14:66215157-66215179 TGTTACTTCCTAGACAGAATGGG + Intergenic
1120418904 14:84257013-84257035 AAACTCTTCCTAGAAAGAACAGG + Intergenic
1122256224 14:100479109-100479131 TCACAACCCCTAGACAGAAAAGG - Intronic
1131686485 15:94773437-94773459 TCACCCTTCCTACACAGACAAGG + Intergenic
1146797966 17:35795813-35795835 TCACCCTCCCTGGACAGATCCGG - Intronic
1149477263 17:56973594-56973616 GCCCACTGCCTAGACAGAACCGG + Intergenic
1156903287 18:42326181-42326203 GCCCACTGCCTAGACAGAGCTGG + Intergenic
1157410680 18:47460430-47460452 TCACACTCCTTTGACAGACCTGG - Intergenic
1158560375 18:58508306-58508328 TCACACATCTCTGACAGAACTGG - Intronic
1159907819 18:74113850-74113872 TTACACTTCAAAGACACAACTGG + Intronic
1161708256 19:5832404-5832426 TCCCGCTTCCCAGACAGCACAGG - Exonic
1165912394 19:39237285-39237307 CGACACTTCCTAGACAGCAAAGG + Intergenic
925812727 2:7716967-7716989 TCAAACCTCCCAGACAGAACTGG + Intergenic
925855714 2:8127224-8127246 TCAAACCTCCCAGACAGAACTGG + Intergenic
926366242 2:12135633-12135655 ACTCACTTCCTTCACAGAACTGG - Intergenic
926427744 2:12754786-12754808 TCACACTTCCTTCCCAGAAGAGG - Intergenic
927721664 2:25387210-25387232 TCTCACTTCCTTGCCAGCACCGG - Intronic
931022003 2:58056560-58056582 CCACACTACCTAAGCAGAACAGG - Intronic
931533834 2:63249557-63249579 TCAGACTTTCTTGACAAAACTGG - Intronic
937143265 2:119619693-119619715 TCACAATTCCTCGACAGCAAGGG + Intronic
937629862 2:124088981-124089003 GCCAACTTCCTAGAGAGAACAGG + Intronic
943667643 2:190626888-190626910 TAACACTTCCTGAAAAGAACTGG + Intergenic
947910346 2:233796405-233796427 TGCCACTTCCTAGACACTACTGG + Intronic
1175692465 20:61075485-61075507 TCACACTGCCCAGACTGGACAGG + Intergenic
1177641796 21:23853275-23853297 TCAGCCTTCCTAGACAGTTCTGG - Intergenic
1178917590 21:36717028-36717050 TTTCACTTCCTAGACAGCTCTGG + Intronic
955002947 3:54944079-54944101 TCAGACTTCCTAAACAACACAGG - Intronic
961707538 3:128799590-128799612 TCACACTTCTAGGACAGAGCTGG + Intronic
964585830 3:158300504-158300526 CCACAGATGCTAGACAGAACAGG - Intronic
964759773 3:160123789-160123811 GCCCACTACCTAGACAGAGCCGG + Intergenic
966051699 3:175624579-175624601 TCACACTTTTTAGTCAGATCAGG - Intronic
967338312 3:188369141-188369163 TCTCACTGCATAGACAGAAAAGG + Intronic
967708133 3:192676266-192676288 TCACACTTCCTAGACAGAACAGG + Intronic
967781057 3:193440028-193440050 TCTCCATTCCTAGACAGAATGGG - Intronic
968291025 3:197539955-197539977 GCTCACTGCCTAGACAGAACCGG - Intronic
968932643 4:3590040-3590062 TCACACATCCTTGCCAGCACTGG + Intronic
973612886 4:52653812-52653834 TCACACTAACTAGAAAGACCAGG + Intronic
974800481 4:66811691-66811713 TCAAGGTTCTTAGACAGAACAGG + Intergenic
982618078 4:157667110-157667132 TCACACTTCCTACACATGAAGGG + Intergenic
982904464 4:161050135-161050157 GCCCACTGCCTAGACAGAGCTGG - Intergenic
983832937 4:172352816-172352838 TCAAAGTTCCTGGACAGAAAAGG + Intronic
983837526 4:172410515-172410537 TCACATTTCCTATATAAAACTGG - Intronic
990301188 5:54450970-54450992 TCACAGGTCCTAGAGACAACTGG - Intergenic
990984990 5:61632915-61632937 TCACAGTTCCAAGAGGGAACAGG - Intergenic
992616269 5:78548705-78548727 TCACCTTTCCTAGGCAGCACTGG + Intronic
993023732 5:82623131-82623153 TCACTCTTCCTAGCCAGGATAGG - Intergenic
994046329 5:95314528-95314550 GAACACTTTCAAGACAGAACAGG + Intergenic
998405560 5:141872652-141872674 TCAAACCTCCTAGGCAGAACAGG + Intronic
1003969886 6:11289276-11289298 TCACACTTCCTAGATTTTACAGG - Intronic
1004113770 6:12747717-12747739 TCACATTTCTGAGAGAGAACAGG + Intronic
1005567271 6:27108969-27108991 GCACACTTCCTATACAAAATAGG + Intergenic
1006942143 6:37759513-37759535 TCACAGTCCATGGACAGAACTGG + Intergenic
1007940179 6:45773308-45773330 TCACACTTCCTACCCAGAGGTGG + Intergenic
1010720601 6:79279198-79279220 TCAGACTTTCCAGACAGAACAGG + Intergenic
1011736571 6:90316535-90316557 TTACACTTAATGGACAGAACAGG + Intergenic
1011977165 6:93317301-93317323 TCACATTTCCCATACATAACAGG + Intronic
1012621343 6:101348238-101348260 TCAAACTTTCTAGGCAGACCAGG + Intergenic
1013541835 6:111118365-111118387 TTACAGGTGCTAGACAGAACTGG - Intronic
1015255946 6:131179563-131179585 TCACACATTATAGACAGTACTGG - Intronic
1015320015 6:131862386-131862408 GCACACTTCCTAGACAGATTGGG + Intronic
1031226292 7:119041972-119041994 TACCACTTCCTGGACAGAATGGG - Intergenic
1034366550 7:150554561-150554583 ACACCCTCCCAAGACAGAACCGG + Intergenic
1036139009 8:6189216-6189238 TCCCACTTATGAGACAGAACAGG - Intergenic
1036180426 8:6579879-6579901 TCACACTGCCCACACAGAACTGG + Intronic
1038554482 8:28497688-28497710 TCACACTTTCTCTACAGAAAGGG - Intronic
1040320922 8:46300687-46300709 TCACAGTTCCTAGAAAAAAAGGG + Intergenic
1041082607 8:54227608-54227630 TCTCACCTCCTACACAGAGCTGG - Intergenic
1051222000 9:14858639-14858661 TCATAGTTTCTAGAGAGAACAGG + Intronic
1054457478 9:65441855-65441877 TCACACATCCTTGCCAGCACTGG - Intergenic
1060559798 9:124533589-124533611 TTACACTTTCTTCACAGAACTGG - Intronic
1062054567 9:134464136-134464158 TCAAACTTCCAGCACAGAACAGG - Intergenic
1189671134 X:43409956-43409978 TCCCACATCCTAGTCAGAATTGG + Intergenic
1191152527 X:57235058-57235080 TCACACATCCTATACAGCAAGGG - Intergenic
1198073617 X:133173850-133173872 TCACATTTCCTAGTGATAACAGG - Intergenic
1198384903 X:136119436-136119458 TGACACTTCCTAAACACAATAGG + Intergenic
1199340834 X:146675393-146675415 TCACAGAATCTAGACAGAACAGG - Intergenic
1200788307 Y:7277849-7277871 TAACACTACGTAGACAGAAGAGG + Intergenic