ID: 967714377

View in Genome Browser
Species Human (GRCh38)
Location 3:192745446-192745468
Sequence TTGTCTATACAGTTGAACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967714373_967714377 2 Left 967714373 3:192745421-192745443 CCACTTACTCCATATACTGTGCC 0: 1
1: 0
2: 1
3: 3
4: 137
Right 967714377 3:192745446-192745468 TTGTCTATACAGTTGAACCTTGG 0: 1
1: 0
2: 0
3: 11
4: 118
967714374_967714377 -7 Left 967714374 3:192745430-192745452 CCATATACTGTGCCCTTTGTCTA 0: 1
1: 0
2: 1
3: 36
4: 278
Right 967714377 3:192745446-192745468 TTGTCTATACAGTTGAACCTTGG 0: 1
1: 0
2: 0
3: 11
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967714377 Original CRISPR TTGTCTATACAGTTGAACCT TGG Intronic
905160228 1:36026521-36026543 TTGTCTAATCATTTGAACTTTGG + Intronic
906795393 1:48692660-48692682 TTGTCTATACAGGTGATCCAGGG + Intronic
914338318 1:146737258-146737280 TTTGCTATACGGTTGAAACTGGG + Intergenic
915013681 1:152713414-152713436 TTCACTATACATTTGAAGCTTGG - Intergenic
1063067969 10:2628633-2628655 TGGTTCATTCAGTTGAACCTGGG + Intergenic
1065231368 10:23601747-23601769 TTGTCTTAAAAGTTCAACCTAGG - Intergenic
1070049139 10:72869842-72869864 TTCTATATACAGTTGTCCCTAGG - Intronic
1072187875 10:93059965-93059987 TTGTCCCTACAGTGCAACCTGGG - Intergenic
1072539562 10:96388011-96388033 TTTTCAAAAAAGTTGAACCTAGG + Intronic
1075758533 10:124836921-124836943 TTGTGTATAAAATTGAATCTTGG + Intergenic
1078725636 11:13928335-13928357 TTGTGTATACATATGCACCTAGG + Intergenic
1078955311 11:16187578-16187600 TTGCCTTTACAGATGAACTTGGG - Intronic
1081088508 11:38831304-38831326 ATTTCTATACAGTTGACTCTAGG - Intergenic
1081446877 11:43139253-43139275 GTGTGAATACAGTTCAACCTGGG - Intergenic
1081765123 11:45604910-45604932 TTGCCTATACGGTTGAGACTTGG - Intergenic
1084922403 11:72481807-72481829 TGGTCTAGACAGTCTAACCTGGG - Intergenic
1085594785 11:77799459-77799481 TTGTCTATGCACTTCAGCCTGGG + Intronic
1087246513 11:95844550-95844572 GTGTTTATACAGTTGTCCCTTGG - Intronic
1092011364 12:5115452-5115474 TAGACTATACAGTTGCTCCTTGG + Intergenic
1097125838 12:56774214-56774236 TTATATATACAGTTGTTCCTTGG + Intronic
1099692526 12:85976964-85976986 TTTTCTTTACAGTTGACACTGGG - Exonic
1101649901 12:106667954-106667976 TTCTCTATAAAGTCGATCCTAGG + Intronic
1104533599 12:129596436-129596458 TTTTATATACAGTTGTCCCTTGG + Intronic
1107603547 13:42037897-42037919 AAGTATATACAGTAGAACCTTGG + Intergenic
1108781391 13:53840369-53840391 TTGTTTATACAGTTGAAGTTTGG - Intergenic
1112584912 13:100710113-100710135 TAGGCTATACCATTGAACCTAGG - Intergenic
1113088451 13:106592555-106592577 TTGGATATGCAGTTGATCCTTGG - Intergenic
1120257657 14:82140808-82140830 TTGTTTATACAGATGAGCTTAGG - Intergenic
1123402879 15:20004230-20004252 CTGTCTCTACAGCTGTACCTGGG + Intergenic
1123512218 15:21010884-21010906 CTGTCTCTACAGCTGTACCTGGG + Intergenic
1126375012 15:47988833-47988855 TTCACTAGACAGGTGAACCTCGG - Intergenic
1128305484 15:66595606-66595628 TAGGATATACAGTTGATCCTTGG + Intronic
1129575992 15:76746382-76746404 TTTCATATACAGTTGAGCCTTGG - Intronic
1130691689 15:86087008-86087030 TTATCTATAAAGCTGAACATAGG - Intergenic
1134909578 16:18012457-18012479 TTGTTTTTACTGTTGAATCTTGG + Intergenic
1135687556 16:24510297-24510319 ATTTATATACAGTTGACCCTTGG - Intergenic
1139995962 16:70980095-70980117 TTTGCTATACGGTTGAAACTGGG - Intronic
1149669682 17:58395328-58395350 TTGTATATACATTTAAAGCTAGG - Intronic
1156268808 18:35512686-35512708 TTGTTTCTCCAGCTGAACCTTGG - Intergenic
1157319985 18:46626775-46626797 TTGTCTATAAGGATGAAGCTAGG - Intronic
1163431262 19:17269065-17269087 TTCTCTGGACAGTTGACCCTTGG - Exonic
1167931477 19:52869318-52869340 TTGTGTATACTCTTGAAACTAGG - Intronic
929632370 2:43476966-43476988 TAGTCAATACATTTGAATCTAGG - Intronic
932174095 2:69583940-69583962 TTGTCTCTCCAGGTAAACCTGGG + Intronic
933061010 2:77736147-77736169 ATATATATACAGTTGACCCTTGG - Intergenic
938907226 2:135849146-135849168 TTCTCTATCCATTTGAACTTAGG + Intronic
939306319 2:140416092-140416114 TTGTGAATACAGATGAAGCTTGG - Intronic
943745539 2:191458301-191458323 TTATTGATACAGTTGAACTTAGG + Intergenic
946098577 2:217298424-217298446 TTACATATATAGTTGAACCTTGG - Intronic
946644059 2:221814971-221814993 TTGTTTATACAGATGAGCATAGG - Intergenic
1170690567 20:18611781-18611803 TTCTGTATACAGTGGAACCCTGG + Intronic
1171354101 20:24530547-24530569 TTCTCTATACACTTGGGCCTTGG + Intronic
1172680411 20:36709982-36710004 TAGTCTTTACAGTTTGACCTTGG + Intronic
1176947355 21:14998961-14998983 TTGTGAATACAGTTGACCCTTGG - Intronic
1179336294 21:40458384-40458406 TTGTATATGAAGTAGAACCTAGG + Intronic
1179726776 21:43345391-43345413 CTGTCTATTCAGTTGTTCCTTGG - Intergenic
1184964620 22:47962138-47962160 TTGAATATACAGATGAATCTGGG - Intergenic
950955466 3:17048256-17048278 TTGAAAATACAGTTGACCCTTGG + Intronic
952424641 3:33163185-33163207 TTATATATACAGTGTAACCTTGG + Intronic
956727625 3:72169400-72169422 ATGACAATACAGTTGAACCCAGG - Intergenic
960336380 3:116422529-116422551 TTCTATATACAGTTGTTCCTTGG - Intronic
962469626 3:135694474-135694496 TTGCCTAGACAGTTGGGCCTTGG + Intergenic
966323543 3:178728777-178728799 TAGTATATACACTTGAAACTTGG + Intronic
967714377 3:192745446-192745468 TTGTCTATACAGTTGAACCTTGG + Intronic
970976833 4:22051371-22051393 TTGTTTATAGAGTTGTCCCTTGG + Intergenic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
979118330 4:116858275-116858297 TTGTCCATACAATTAAATCTTGG - Intergenic
982308577 4:153959977-153959999 TTCCTTATACAGCTGAACCTTGG + Intergenic
982381422 4:154753418-154753440 AACTCTATACAGTTGACCCTTGG + Intergenic
983862275 4:172722229-172722251 ATTTCTATACAATTAAACCTGGG - Intronic
986461559 5:7977994-7978016 TCGTCTCTACAGTTGTTCCTGGG + Intergenic
990705689 5:58526808-58526830 TAGTCTATACATTTTAACCAGGG - Intergenic
990818220 5:59808837-59808859 TTGTCTTTACAGAAGAACTTGGG - Intronic
995121873 5:108544783-108544805 GAGACTATACAATTGAACCTAGG - Intergenic
995382048 5:111546373-111546395 TTGTCTTTACAGATGCACCTTGG + Intergenic
997103387 5:130993056-130993078 TTTTCTATAAATTTGAACATAGG - Intergenic
997785788 5:136712017-136712039 TTGTGTATACAGTTGTCCCTTGG - Intergenic
999600381 5:153256140-153256162 TTTTCCTTACAGTTGTACCTAGG - Intergenic
1003757312 6:9136308-9136330 TTCTCTATAAGGCTGAACCTTGG - Intergenic
1003889099 6:10548073-10548095 TTCTCTATTCAGTAGAACCAGGG - Intronic
1005116245 6:22340714-22340736 TTCTCTATACTGTTGAAAGTTGG + Intergenic
1007959382 6:45945105-45945127 TTGTCTGTACAATTGCACCTGGG + Intronic
1011083143 6:83511315-83511337 TTGTATATATAGTTGGCCCTTGG + Intergenic
1011675210 6:89726369-89726391 TTCACGATTCAGTTGAACCTGGG + Intronic
1012527316 6:100193677-100193699 TTGTGAAGACAGCTGAACCTAGG - Intergenic
1012743472 6:103052310-103052332 TTGCCTATACAGTAGCACCTAGG - Intergenic
1016293546 6:142549956-142549978 GTATCTCTACAGTTGACCCTGGG - Intergenic
1019176284 6:170160897-170160919 TTGTCTAGGCAGGTGGACCTGGG + Intergenic
1021819873 7:24486228-24486250 ATGTATATACAGTTGTCCCTAGG - Intergenic
1023160125 7:37288820-37288842 TTGTTTATAAACATGAACCTAGG + Intronic
1026781667 7:73272135-73272157 TTTGCTATACAGTTGAAACGTGG + Intergenic
1027022522 7:74825575-74825597 TTTGCTATACAGTTGAAACGTGG + Intronic
1027065495 7:75120347-75120369 TTTGCTATACAGTTGAAACGTGG - Intronic
1027591294 7:80122271-80122293 TTTTATATACAGTTGTACCTTGG + Intergenic
1028928805 7:96390102-96390124 TTGTTCATCCAGTTTAACCTGGG - Intergenic
1029024087 7:97396408-97396430 TTCTATATACAGTTGTCCCTTGG + Intergenic
1029268920 7:99364713-99364735 ATATCTATATAGTTAAACCTGGG - Intronic
1030976338 7:116128104-116128126 TAGTCAATAAAGTTGAAACTTGG + Intronic
1034047830 7:147948681-147948703 ATATATATACAGTTGACCCTTGG + Intronic
1037085483 8:14844066-14844088 ATATTTATACAGTTGACCCTTGG + Intronic
1039005797 8:33035623-33035645 ATGTCAGTACAGCTGAACCTTGG - Intergenic
1040990925 8:53348309-53348331 TTGACTAAATAGTTAAACCTAGG - Intergenic
1042285156 8:67101365-67101387 CTGACTGTACAGTTGACCCTTGG - Intronic
1043240758 8:77932083-77932105 TTGTCTGTCCAGTGAAACCTTGG - Intergenic
1043558387 8:81461110-81461132 CTGTCTATAAATTTGAAGCTGGG + Intronic
1044397747 8:91733757-91733779 TTTTCTTTACACTTGATCCTTGG + Intergenic
1045211045 8:100100053-100100075 TATTCTATACAGTTGTCCCTTGG + Intronic
1045816499 8:106282826-106282848 TTATTAATACAGTTGACCCTTGG - Intronic
1045870448 8:106921096-106921118 TTCTCTCTACACTTGACCCTTGG - Intergenic
1046735594 8:117773059-117773081 TAGTCTATACAGCAGAACCAGGG + Intergenic
1048613074 8:136045086-136045108 TTGGCTGTACATCTGAACCTTGG + Intergenic
1050620584 9:7448129-7448151 TTTTATATACAGTTGTCCCTCGG + Intergenic
1050653325 9:7796986-7797008 ATATATATACAGTTGACCCTTGG - Exonic
1056085056 9:83139715-83139737 TAGTTTATACAGTTGACCCTTGG - Intergenic
1056298021 9:85212698-85212720 TTTTCTATGCAGTTGATCTTAGG - Intergenic
1059373727 9:113864904-113864926 TTGGGTATACAGTTGTCCCTGGG + Intergenic
1059850364 9:118331431-118331453 TTGTCTCTACAGTTTATCTTGGG + Intergenic
1185949349 X:4413912-4413934 TAGTGTATACTTTTGAACCTTGG + Intergenic
1186083441 X:5958864-5958886 TTGACTTTACAGTTTGACCTAGG - Intronic
1187473103 X:19586802-19586824 TTGCCTCTACATTTGAGCCTGGG + Intronic
1187746900 X:22419120-22419142 TTGTGTATACAGTCGTCCCTCGG - Intergenic
1188877187 X:35444418-35444440 TTGTCTTAACATGTGAACCTTGG + Intergenic
1189404745 X:40711066-40711088 TTTAATATACAGTTGACCCTTGG - Intronic
1194726720 X:97407137-97407159 TTTTCTAAACAGTAGAAACTTGG + Intronic
1195339317 X:103890281-103890303 TAGTCGAGACAGTTGAGCCTTGG - Intergenic
1195587646 X:106584090-106584112 TTGTTGATACAGTTGGACCTTGG - Intergenic
1196772591 X:119309644-119309666 TTTTCTATACAATTGTACCACGG - Intergenic
1199379607 X:147154412-147154434 TTGTATATACAGTTTAAATTAGG - Intergenic
1199406914 X:147472876-147472898 TTGTATATAGAGATGAACCTAGG - Intergenic
1200023147 X:153228780-153228802 CTGTACATGCAGTTGAACCTGGG - Intergenic