ID: 967717327

View in Genome Browser
Species Human (GRCh38)
Location 3:192777035-192777057
Sequence GACTTACACCCCTAGAGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967717324_967717327 7 Left 967717324 3:192777005-192777027 CCTACAATAGCCAAGACTGTCTT No data
Right 967717327 3:192777035-192777057 GACTTACACCCCTAGAGTTCAGG No data
967717326_967717327 -3 Left 967717326 3:192777015-192777037 CCAAGACTGTCTTGAGAAAGGAC No data
Right 967717327 3:192777035-192777057 GACTTACACCCCTAGAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967717327 Original CRISPR GACTTACACCCCTAGAGTTC AGG Intergenic
No off target data available for this crispr