ID: 967723241

View in Genome Browser
Species Human (GRCh38)
Location 3:192837422-192837444
Sequence TGCTTGGTGGGAAGCCCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 324}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967723241_967723247 -5 Left 967723241 3:192837422-192837444 CCACCTGGGCTTCCCACCAAGCA 0: 1
1: 0
2: 1
3: 29
4: 324
Right 967723247 3:192837440-192837462 AAGCACAAGACGCAGCTCAAGGG 0: 1
1: 0
2: 0
3: 10
4: 110
967723241_967723248 -4 Left 967723241 3:192837422-192837444 CCACCTGGGCTTCCCACCAAGCA 0: 1
1: 0
2: 1
3: 29
4: 324
Right 967723248 3:192837441-192837463 AGCACAAGACGCAGCTCAAGGGG 0: 1
1: 0
2: 0
3: 11
4: 104
967723241_967723249 10 Left 967723241 3:192837422-192837444 CCACCTGGGCTTCCCACCAAGCA 0: 1
1: 0
2: 1
3: 29
4: 324
Right 967723249 3:192837455-192837477 CTCAAGGGGAGAACGAGCTGCGG 0: 1
1: 0
2: 6
3: 6
4: 149
967723241_967723246 -6 Left 967723241 3:192837422-192837444 CCACCTGGGCTTCCCACCAAGCA 0: 1
1: 0
2: 1
3: 29
4: 324
Right 967723246 3:192837439-192837461 CAAGCACAAGACGCAGCTCAAGG 0: 1
1: 0
2: 0
3: 5
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967723241 Original CRISPR TGCTTGGTGGGAAGCCCAGG TGG (reversed) Intronic
900250539 1:1666471-1666493 AGCTCTGTGGGAGGCCCAGGTGG - Intronic
900297454 1:1959058-1959080 TGCTGGCTGGGAACCCCAGTGGG - Intronic
900650900 1:3729694-3729716 TGCTGAGTGGAAAGGCCAGGAGG + Intronic
900651525 1:3732390-3732412 TGCTTGGTGTGGTGCCCAGAGGG + Intronic
900748784 1:4380255-4380277 TATTTGGTGGGAGGCCAAGGTGG + Intergenic
901006330 1:6173425-6173447 TGCTGGTTGGGGAGTCCAGGTGG - Intronic
901185555 1:7370825-7370847 TGTTTGGTGGGAAGGACAAGGGG - Intronic
901277295 1:8002133-8002155 TGCATTTTGGGAAGCCAAGGCGG - Intergenic
901643107 1:10703011-10703033 TGGGTGGTGGGAAGGCAAGGAGG + Intronic
902053867 1:13584336-13584358 TGCGAGGTGGGCAGCACAGGGGG + Intronic
902395046 1:16127988-16128010 TCCTTGGTGGGAGCCCCTGGAGG + Intronic
903011903 1:20337373-20337395 AGCTCTGTGGGAAGCCGAGGTGG - Intronic
903579017 1:24357338-24357360 AGCTGGGTGGGAAGTTCAGGAGG - Exonic
906428442 1:45734548-45734570 TACTTGGTGGGAGGCCGATGGGG - Intronic
907500684 1:54877663-54877685 TGCAGGGAGGGAAACCCAGGTGG + Intronic
908755606 1:67466511-67466533 GGGTTGGTGGGAAGAACAGGAGG + Intergenic
908806379 1:67937243-67937265 TGCTGAAAGGGAAGCCCAGGTGG - Intergenic
911055854 1:93707987-93708009 TGCAAGGTGGTAAGCCGAGGGGG + Intronic
913230753 1:116739048-116739070 TTGTGGGTGGGAAGCCCAAGAGG + Intergenic
915363389 1:155299751-155299773 AGCATGTTGGGAGGCCCAGGTGG - Intronic
915729842 1:158045377-158045399 TACTTGGTCAGAAGTCCAGGTGG - Intronic
915772673 1:158445277-158445299 TGTGAGGTGGGAAGCACAGGTGG + Intergenic
916241822 1:162647934-162647956 TGCTGGGTGGCATTCCCAGGAGG - Intronic
916732938 1:167582552-167582574 TGTTTGGTGGGAAGCCCTGGAGG - Intergenic
917135662 1:171786052-171786074 TGCTGGGTGGGCATCCCAGCTGG - Exonic
919731395 1:200915860-200915882 ACCTTGGCGGGCAGCCCAGGGGG - Intergenic
920554932 1:206897794-206897816 TGCTTGGGAGGAAGGCCAGGAGG + Exonic
921191693 1:212714835-212714857 TGCTACTTGGGAAGCCGAGGTGG - Intergenic
923266793 1:232322268-232322290 TGGTTGGTGGGAGGCCCTAGTGG + Intergenic
923513820 1:234676355-234676377 TTCTGGATGGGAAGCCCCGGAGG + Intergenic
923633953 1:235675832-235675854 TGCATGGTGGGACACCCAGTTGG + Intronic
923652298 1:235885037-235885059 TGCTAGTTGGGAGGCCAAGGCGG - Intergenic
923802100 1:237220205-237220227 TGCCTGGCTGGAAGCCCAGCTGG + Intronic
924846281 1:247775619-247775641 TGTTAGGTGGGAAGCGCACGTGG - Intergenic
1065122395 10:22542598-22542620 TGCTTCGTGGAAAGCACACGTGG - Intronic
1065904981 10:30242354-30242376 AGCATTTTGGGAAGCCCAGGTGG + Intergenic
1067088580 10:43255284-43255306 TGCTGAGTGGGCAGCCTAGGCGG - Intronic
1067142645 10:43669632-43669654 GGCTTGGTGAGCAGCCCAGAGGG + Intergenic
1068122976 10:52803714-52803736 TGCTTGCTGGGAATCTCAGCTGG - Intergenic
1068202791 10:53804854-53804876 TGCTTGTTTGGCAGGCCAGGAGG + Intronic
1068851820 10:61751062-61751084 AGCTGGGTGGAAAGTCCAGGTGG + Intronic
1069822387 10:71235759-71235781 TGCCTGGTCTGAAGCCCAGTTGG - Intronic
1069905898 10:71731881-71731903 TGCTGGGTGGGCCACCCAGGGGG + Intronic
1072231663 10:93419020-93419042 TCCTTGATGGGAAGACCATGGGG - Intronic
1073524631 10:104168536-104168558 TGCTGGCTGGGAAGCACACGGGG + Intronic
1073766653 10:106690169-106690191 TCCCTGGTGGGAAGCCCTTGCGG - Intronic
1073818652 10:107235206-107235228 TGCTCTGTGGGATGCCCAGGTGG - Intergenic
1075413277 10:122244606-122244628 TGCTTGGTAACATGCCCAGGAGG + Intronic
1077286428 11:1768004-1768026 TCCGTGGTGGGAAGCTCAGTGGG - Intergenic
1077526940 11:3072525-3072547 GGCGTGTTGGGAAGCCAAGGCGG - Intergenic
1079906002 11:26248090-26248112 AGCATGTTGGGAGGCCCAGGCGG + Intergenic
1080896150 11:36450148-36450170 TGCATGTTGGCAATCCCAGGGGG - Intronic
1081892442 11:46554957-46554979 GGCATGGTGGGAGGCCAAGGTGG + Intronic
1082176119 11:49061617-49061639 AGCATTGTGGGAGGCCCAGGAGG + Intergenic
1082652611 11:55812182-55812204 TGTGAGGTGGGAAGCACAGGTGG - Exonic
1082830727 11:57615017-57615039 GGCATGGTGGCAAGCCCATGTGG - Intergenic
1083780773 11:64916262-64916284 TGCCTGGAGGGAGGCCCTGGAGG - Intronic
1084428034 11:69096192-69096214 TTCATGGTGGGAGGCCCAGGGGG + Intergenic
1084483934 11:69437307-69437329 GGCTTGGAGGGAAGGGCAGGAGG - Intergenic
1085325162 11:75601055-75601077 AGCATGGTGGGAACCACAGGCGG + Intronic
1085403213 11:76246712-76246734 TGGGGGGTGGGAAGCCCAGGTGG + Intergenic
1085414735 11:76312494-76312516 GGCTGGGTGTAAAGCCCAGGGGG + Intergenic
1085464219 11:76713262-76713284 TGCTTGGTGCTAAGAGCAGGTGG - Intergenic
1085696003 11:78705248-78705270 TCCTTGATGGGAAGACTAGGGGG + Intronic
1086939564 11:92781328-92781350 GGCTCGGTGGGAGGCCAAGGCGG - Intronic
1088627158 11:111737629-111737651 TCCTGGCTGGGAAGCACAGGTGG - Intronic
1089144789 11:116318331-116318353 TGCAAGGAGGGAAACCCAGGAGG + Intergenic
1089200819 11:116723816-116723838 TGCTGGGTGGGAGGCCCTTGTGG - Intergenic
1091247550 11:134111387-134111409 TGAATGGTGGGAGGCCGAGGTGG - Intronic
1091446063 12:544798-544820 GGATTGGCGGGAAGACCAGGAGG - Intronic
1091458812 12:628608-628630 TGCTAGGTGGCATTCCCAGGAGG + Intronic
1095665419 12:44791418-44791440 AACTTGGGGGGAAGCCTAGGAGG + Intronic
1095938056 12:47706040-47706062 GGCTTGTGGGGAAGCGCAGGAGG - Exonic
1096184954 12:49572774-49572796 AGCATGGTGGGAGGCCGAGGCGG + Intronic
1096466980 12:51851989-51852011 TGGTTGGGGGGAAGCCCAGCTGG - Intergenic
1097337036 12:58394955-58394977 TACTTGTTGGGAACACCAGGGGG - Intergenic
1097794285 12:63845013-63845035 TGGCTTGTAGGAAGCCCAGGTGG - Intronic
1098590171 12:72201675-72201697 TGCTGGGAGGGAAACACAGGAGG + Intronic
1101492258 12:105220635-105220657 TGCTTGTTTGGAAGGCCTGGAGG - Intronic
1103355386 12:120316057-120316079 GGCTCGGTGGGAGGCCGAGGTGG + Intergenic
1103763525 12:123267143-123267165 GGCATGGTGGGAGGGCCAGGGGG - Intronic
1103990289 12:124794681-124794703 AGCATGCTGGGAGGCCCAGGTGG + Intronic
1104048414 12:125180413-125180435 TGCTGAAAGGGAAGCCCAGGTGG + Intergenic
1104688049 12:130802741-130802763 TGTTGGTTGGGAAGCCAAGGTGG - Intronic
1105446594 13:20462250-20462272 GGCCTGGTGGGAGGCCCTGGGGG + Intronic
1105970428 13:25424708-25424730 AGCATTTTGGGAAGCCCAGGTGG + Intronic
1108278788 13:48840090-48840112 TGCTTGGTCAGAAGCACAGGTGG + Intergenic
1108606818 13:52047591-52047613 TACTTTATGGGAGGCCCAGGTGG + Intronic
1111655689 13:91149658-91149680 GGCGTGGTGGGAGGCCAAGGTGG - Intergenic
1113066975 13:106382612-106382634 TGGTTTATGGGAAGCCCAGATGG + Intergenic
1113793276 13:113041838-113041860 TGCTTGGTGGGAACATTAGGAGG + Intronic
1113959427 13:114118252-114118274 TGCCTCCTGGGAACCCCAGGGGG + Intronic
1114180185 14:20360138-20360160 AGCTAGTTGGGAAGCCGAGGCGG - Intergenic
1116381971 14:44280730-44280752 AGCTTTTTGGGAAGCTCAGGTGG - Intergenic
1116734410 14:48671018-48671040 AGGTGGGTGGGAAGCCCTGGAGG - Intergenic
1116999477 14:51357517-51357539 TTCTCAGTGGGAAGCCCAGGAGG + Intergenic
1117343122 14:54808344-54808366 TGAGTGCTGGGAAGCCCAGCTGG + Intergenic
1119443022 14:74641416-74641438 TGCTTGGTGGGAGGCTGAGGTGG + Intergenic
1119644744 14:76340095-76340117 GGCAGGGTGGGGAGCCCAGGAGG + Intronic
1119832139 14:77712691-77712713 AGCATTTTGGGAAGCCCAGGCGG - Intronic
1121138712 14:91521996-91522018 TACAAGGTGGGAAGCCAAGGTGG - Intergenic
1122602729 14:102929558-102929580 TGCTTGCTGGGAAGGCCTGGAGG + Intronic
1202903726 14_GL000194v1_random:56949-56971 TCCTTGGTGAGGATCCCAGGAGG + Intergenic
1124270297 15:28274495-28274517 TGAGGGGTGGGAAGCCCAGCGGG - Intronic
1126316399 15:47374510-47374532 TGCTTCCAGGGAAGCCAAGGAGG - Intronic
1127115597 15:55723461-55723483 TGCATTATGGGAAGCCCAGAAGG + Intronic
1128229892 15:66027110-66027132 AGCTTGCTGGGAGGCCCAGAAGG - Intronic
1129836718 15:78712803-78712825 TGCTGGGAGAGAAGCCGAGGTGG + Intronic
1130650843 15:85761273-85761295 TGCTGGAAGGGAAACCCAGGCGG + Intronic
1130863904 15:87915519-87915541 TGATCTGTTGGAAGCCCAGGAGG - Intronic
1131642762 15:94310539-94310561 TGCTTTGTGGGAGGCCAAGGCGG + Intronic
1132100762 15:99021398-99021420 TGCTTGGTCAGATGCCCCGGGGG + Intergenic
1132481669 16:169372-169394 GGCCTGGTGGGAGGCCCAGCAGG - Intergenic
1132667616 16:1089350-1089372 TGCTTGGGGGGATCCCCAGGAGG - Intergenic
1133946260 16:10351323-10351345 AGCATGTTGGGAAGCCAAGGTGG - Intronic
1134219760 16:12344732-12344754 TGCTGGGCAGGCAGCCCAGGAGG - Intronic
1134771442 16:16812729-16812751 TCCCTGCTGGGAAGCTCAGGCGG + Intergenic
1137300706 16:47144681-47144703 TGCTAGGAGGGCAGCCCCGGGGG - Intergenic
1137534033 16:49303958-49303980 TGGTTGGTGGGAAATCCAGGTGG - Intergenic
1140074883 16:71689328-71689350 TGCTTGGTGGGAGGTTGAGGTGG - Intronic
1141361740 16:83401397-83401419 GGCGTGGTGGGAAGCTGAGGTGG + Intronic
1141702249 16:85647941-85647963 TGCTTGATGGGAGCCCCCGGAGG + Intronic
1141789760 16:86226568-86226590 TGGTAGGGGGGAAGGCCAGGAGG + Intergenic
1142499118 17:322536-322558 TGCTTGGTGGGACGTGCAGGTGG + Intronic
1144801743 17:17933549-17933571 AGCTTGGTGAAAAGCCCATGAGG - Intronic
1145881368 17:28355152-28355174 TGGATGGTGGGAAGCCGTGGAGG - Intronic
1146273298 17:31498388-31498410 AGCTTGCTGGGAAGACCATGGGG + Intronic
1147552262 17:41452083-41452105 TGCTTGGTTGGCTGTCCAGGTGG - Intergenic
1150289851 17:63974843-63974865 TGCGGTGTGGGAAGCTCAGGAGG - Intergenic
1150442370 17:65201969-65201991 TGCATGGTGAGAAGTCCACGTGG - Intronic
1151321337 17:73354438-73354460 ATGTTGGTGGGAAGGCCAGGAGG + Intronic
1151365276 17:73612669-73612691 AGCATTTTGGGAAGCCCAGGCGG + Intronic
1151561267 17:74871088-74871110 TCCTGGGCCGGAAGCCCAGGTGG - Intronic
1151743382 17:75999096-75999118 TGCATGTTGGGAGGCCGAGGCGG + Intronic
1153597475 18:6742415-6742437 TGCATGCTGGAAAGCCGAGGTGG - Intronic
1155421190 18:25658346-25658368 TGCTAGATGAGAAACCCAGGGGG - Intergenic
1157153677 18:45244134-45244156 AGATTGGTGGGCTGCCCAGGGGG - Intronic
1157687017 18:49650888-49650910 TGCTTGGCAGGAAGCTCAGCAGG - Intergenic
1158466187 18:57691928-57691950 TGCTTATTGGGAAGCACAGGTGG - Exonic
1158674002 18:59502044-59502066 CACTTGGTGGGAGGCCGAGGTGG - Intronic
1159638754 18:70838847-70838869 AGCATTGTGGGAAGCCAAGGTGG + Intergenic
1160856191 19:1219021-1219043 TGCTTGGGGGGGCGTCCAGGAGG + Intronic
1161051851 19:2168218-2168240 TGCACTTTGGGAAGCCCAGGCGG + Intronic
1161875301 19:6903886-6903908 TGCTTGGTGCAAAGCCAGGGTGG - Exonic
1161905293 19:7152037-7152059 AGCTAGTTGGGAAGCCGAGGTGG - Intronic
1162905599 19:13821657-13821679 TACTTGGTGGGAGGCTTAGGTGG - Intronic
1163040995 19:14602400-14602422 TACTTGGTGGGGAGCTGAGGTGG - Intronic
1163390888 19:17029027-17029049 TGCTTGGTGAGACAGCCAGGTGG - Intergenic
1163697837 19:18772907-18772929 TCCCAGGTGGGCAGCCCAGGTGG + Intronic
1165055604 19:33174421-33174443 TGCATGGTGGGAACCCCTGAGGG + Intronic
1165343325 19:35227629-35227651 GCCTTGATGGGAAGCCCCGGGGG + Intronic
1166109105 19:40611941-40611963 TGTTGGGTTGGAAGCCCATGGGG - Exonic
1166356602 19:42230779-42230801 TGCTTGGTGGGGCCCTCAGGAGG + Exonic
1166997394 19:46726207-46726229 TGCTGGGTGGTGAGCCCCGGAGG + Intronic
1167601112 19:50455406-50455428 TGATTGGTCAGAAGGCCAGGGGG - Intronic
1167634032 19:50643259-50643281 TGCTTGGGGGGAGGCTGAGGTGG + Intronic
925034541 2:675741-675763 TACTTGGTGAGTAGCCCAGGAGG - Intronic
925296551 2:2781008-2781030 TGCAGGGTGTGAAGCCCAGGAGG - Intergenic
926222647 2:10946421-10946443 GGCATGGTGGGCACCCCAGGGGG - Intergenic
926351448 2:11998935-11998957 TGGTTGGTGTGCAGGCCAGGGGG + Intergenic
926739232 2:16097328-16097350 AGCTTGCTGGGCAGCCCAGGTGG + Intergenic
927712751 2:25336029-25336051 TGCTTGGTGGGCAGTGGAGGTGG - Intronic
928164896 2:28963630-28963652 AGCATGTTGGGAAGCCAAGGCGG - Intronic
930248286 2:49007111-49007133 TGCATGGTGGAAAGGCCTGGTGG - Intronic
931041839 2:58309555-58309577 TGCTTGAATGGAAACCCAGGAGG - Intergenic
931781243 2:65580877-65580899 TGCTTTCTGGTAAACCCAGGCGG - Intergenic
931983113 2:67715177-67715199 TGTTTGGTGGGCTGACCAGGTGG - Intergenic
932465864 2:71923670-71923692 TGCTCTGTGGGAAGCTGAGGGGG + Intergenic
932468432 2:71938761-71938783 CACTAGGTGGGAAACCCAGGAGG - Intergenic
934875392 2:97914533-97914555 GGCTTGGGGGGAAGGGCAGGAGG - Intronic
935694766 2:105761441-105761463 GGCTTGGGTGGAAGGCCAGGTGG + Intronic
936815619 2:116456870-116456892 GGCTTTGTGGGAAGACAAGGAGG - Intergenic
937201404 2:120206557-120206579 AGCTTGGTGGGAAACCCTTGGGG + Intergenic
941003037 2:160221360-160221382 TGCAGGGTGGAAGGCCCAGGGGG + Intronic
941170835 2:162133888-162133910 AGCATGTTGGGAGGCCCAGGCGG + Intergenic
941994414 2:171587887-171587909 AGCTCTTTGGGAAGCCCAGGAGG + Intergenic
944686275 2:202120664-202120686 TGCTTGGTAAGAGACCCAGGTGG - Intronic
947313050 2:228825170-228825192 TGCTTTGTGTGAAGGTCAGGCGG - Intergenic
947658716 2:231850420-231850442 TGCTGGGTGGGAGGCTCAGGTGG + Intergenic
947658765 2:231850815-231850837 TTCTTGGTGGAAATCCCAGCTGG - Intergenic
947715784 2:232338251-232338273 TGCTTCGTGGGAGGCCCTGGGGG - Intronic
947734808 2:232448997-232449019 TGCTTCGTGGGAGGCCCTGGGGG - Intergenic
948163616 2:235844577-235844599 AGCTTCGTGGGAAGGTCAGGGGG - Intronic
948705529 2:239789966-239789988 AGCGTCGTGGGAAGTCCAGGAGG + Intronic
1169012724 20:2263980-2264002 AGCTTTGTGGGAGGCCAAGGTGG + Intergenic
1169286422 20:4311156-4311178 TGCTTGGTGGTAGGACCAAGGGG - Intergenic
1169706187 20:8507691-8507713 TTCATGGTGGTAGGCCCAGGGGG + Intronic
1169798836 20:9494911-9494933 TGCTTGGTTGGGAACCCAGCTGG + Intergenic
1169982002 20:11395124-11395146 AGTTTGGTGGGAAGCCAAAGTGG + Intergenic
1172028430 20:31965562-31965584 GGCTGGGTGGGAAAGCCAGGAGG + Intergenic
1172374944 20:34431165-34431187 TGCTTTTTGGGAGGCCCAAGGGG + Intronic
1172516057 20:35534369-35534391 TGCCTGGTGGGCAGGCCAGTGGG - Intergenic
1172895885 20:38299835-38299857 AGCATGGTGGGAGGCCGAGGTGG - Intronic
1173647270 20:44641250-44641272 TCCTTGGTGGCAGGCCCAGGTGG + Intronic
1174381649 20:50159643-50159665 TGCTGGGTAGGAAGCCCTGCTGG - Intergenic
1175006316 20:55687260-55687282 TTCTTGGGTGGAAGCCCAAGTGG - Intergenic
1176623091 21:9071717-9071739 TCCTTGGTGAGGATCCCAGGAGG + Intergenic
1178407937 21:32339836-32339858 TGCTTAGTGGAAACGCCAGGAGG + Intronic
1178691811 21:34755970-34755992 TGCATGGTGGGAAGCAGAGATGG + Intergenic
1178996763 21:37409010-37409032 TGTGTGGTGGGAAGCTCTGGGGG + Intronic
1180799462 22:18624996-18625018 TGCAGGTTGGGAGGCCCAGGAGG - Intergenic
1181003078 22:19997101-19997123 TGCTGGATGGGAGGTCCAGGGGG + Intronic
1181222256 22:21370270-21370292 TGCAGGTTGGGAGGCCCAGGAGG + Intergenic
1181281037 22:21720735-21720757 TGGTGGGTGGGAGGCCAAGGCGG - Intronic
1181638015 22:24183263-24183285 TGCAGGTTGGGAGGCCCAGGAGG + Exonic
1182548050 22:31086894-31086916 TGCTTAGCGGGAAGGCCAGGTGG - Intronic
1184054971 22:42040158-42040180 GGCATGGTGGGAGGCCAAGGCGG - Intronic
1184712379 22:46259942-46259964 TTCTTGGTGAGAAGACCAGCTGG - Exonic
1184860785 22:47172148-47172170 TGCTGGGTGGGAACACCGGGCGG - Intronic
1185046736 22:48532231-48532253 TGCTGGCTGGGCAGCCCTGGAGG - Intronic
1185094809 22:48800433-48800455 TGCCTGTGGGGAAGCACAGGAGG - Intronic
1185322987 22:50210404-50210426 TGCTTGAGGGGGAGCCGAGGGGG + Intronic
1185333545 22:50261855-50261877 AGCCTGGGGGGAAGCGCAGGGGG + Intergenic
949860386 3:8499890-8499912 AGCTTCTTGGGAAGCCGAGGTGG + Intergenic
950013986 3:9743466-9743488 TTCCTGGTGAGAAGCCCAGGGGG + Intronic
953079981 3:39608111-39608133 TGCTGGGTTGGAAGCTCAAGTGG + Intergenic
953882410 3:46697458-46697480 GGCTGGGTGGCATGCCCAGGAGG + Intergenic
954069249 3:48130836-48130858 TGCTTGGACAGAAGCCCAGAAGG - Intergenic
955097073 3:55809712-55809734 AGCTTGTAGGGAAGCCCAGTGGG - Intronic
956796784 3:72724974-72724996 AGCATGGTGGGAGGCCAAGGTGG + Intergenic
958692772 3:97489436-97489458 AGCATGTTGGGAGGCCCAGGCGG + Intronic
958736203 3:98012005-98012027 TGCTTGGTGGGGTGCCAGGGTGG + Intronic
959541356 3:107542813-107542835 TGCCACGTGGGAAGCCTAGGAGG - Intronic
959687179 3:109160257-109160279 TGCTTGGAGGGAGGCCAAGTGGG + Intergenic
960133646 3:114084468-114084490 GGCGTGGTGGGAAGCTGAGGTGG + Intronic
961019318 3:123490940-123490962 GGCGTGGTGGGAGGCCAAGGCGG + Intronic
962909109 3:139831666-139831688 TGCTTGGTAGGCAGGTCAGGGGG + Intergenic
963203614 3:142610114-142610136 AGCTTTGTGGGAGGCCGAGGCGG - Intronic
964454033 3:156841137-156841159 TGCATGGTGGGATGGCCAGAGGG + Intronic
964634468 3:158844468-158844490 CTCTTGGAGGGAAGCCGAGGCGG + Intergenic
965688559 3:171331115-171331137 TGCTGGGTGGGAAGCACTGGGGG + Intronic
965957126 3:174384411-174384433 TACCTGTTGGTAAGCCCAGGAGG - Intergenic
966180163 3:177180978-177181000 TACTTGGTGGTAGGCCGAGGTGG - Intronic
966570193 3:181433066-181433088 TAAGTGGTGGCAAGCCCAGGTGG - Intergenic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
967723241 3:192837422-192837444 TGCTTGGTGGGAAGCCCAGGTGG - Intronic
968120601 3:196123176-196123198 GGCTCGCAGGGAAGCCCAGGGGG - Intergenic
968482687 4:843379-843401 TGCTTGCTGGGAAGCCTTGATGG - Intergenic
969398512 4:6938523-6938545 TGCCTGGTGGGAAGGCCAAGGGG - Intronic
969786297 4:9459997-9460019 TGCTAGGTGAGAGGCACAGGTGG - Intergenic
969794213 4:9513646-9513668 TGCTAGGTGAGAGGCACAGGTGG - Intergenic
970035004 4:11723386-11723408 TTCTTTGTGGTAAGCCAAGGGGG + Intergenic
973728400 4:53799455-53799477 AGCCTGGTGGGCAGCCAAGGTGG - Intronic
973876931 4:55229531-55229553 TGCTTGCTGGGAATCTCAGCTGG + Intergenic
977494417 4:97757050-97757072 TGCTTGAAGGGAAGTTCAGGGGG - Intronic
978439898 4:108722366-108722388 TACTTGATAGAAAGCCCAGGAGG - Intergenic
982057083 4:151562299-151562321 TACTTGATGGGAAGCACAGCTGG - Intronic
984812549 4:183807652-183807674 TGCTTGTTTGGCAGCCCTGGTGG + Intergenic
986898590 5:12402890-12402912 TGCATAGTGGGAACACCAGGAGG - Intergenic
987147133 5:15002918-15002940 TGCTTCCTGGGAACCACAGGTGG - Intergenic
988198861 5:28045765-28045787 TTCTTGGTGGGAGGCACACGTGG + Intergenic
988280585 5:29140967-29140989 AGCATGTTGGGAGGCCCAGGTGG - Intergenic
991593130 5:68275223-68275245 TGCTCTGTGGGAAGTGCAGGAGG - Intronic
991902135 5:71471387-71471409 CACTTGGTGGGAGGCCAAGGTGG - Intronic
992100340 5:73401588-73401610 GGACTAGTGGGAAGCCCAGGTGG - Intergenic
992434233 5:76740013-76740035 AGCTTTTTGGGAAGCCAAGGCGG + Intergenic
992864598 5:80944942-80944964 GGCGTGGTGGGAGGCCGAGGTGG + Intergenic
994590204 5:101761925-101761947 TGCTTGGTCTGATACCCAGGAGG - Intergenic
994984128 5:106913535-106913557 TATTTGGTGGGAGGCCGAGGAGG - Intergenic
995503628 5:112835683-112835705 AGCTTGTTGGGAAGCTGAGGTGG - Intronic
996081403 5:119261984-119262006 AGGGTGGTGGGAAGCCCAGAGGG - Intergenic
998771505 5:145551153-145551175 TGCTTATTGGGAGGCCGAGGGGG + Intronic
999286116 5:150395257-150395279 TGCCTGGAGGAAGGCCCAGGTGG - Intronic
1000580183 5:163026639-163026661 TGCTGAAAGGGAAGCCCAGGTGG - Intergenic
1001144242 5:169170029-169170051 TTCCTGGAGGGAAGCCAAGGAGG + Intronic
1001379519 5:171294446-171294468 GGCTTGGGAGGTAGCCCAGGTGG - Intronic
1002103330 5:176868123-176868145 TCCATGGTGGGCAGCCCTGGGGG - Exonic
1002138207 5:177121591-177121613 GGCGTGGTGGGAGGCCAAGGTGG + Intergenic
1003178680 6:3773095-3773117 AGCATGGTGGGAGGCCAAGGTGG + Intergenic
1005533585 6:26733116-26733138 GGCTCGGTGGGAGGCCGAGGCGG + Intergenic
1005535065 6:26746560-26746582 GGCTCGGTGGGAGGCCGAGGCGG - Intergenic
1005537210 6:26768538-26768560 GGCTCGGTGGGAGGCCGAGGCGG - Intergenic
1005584816 6:27266169-27266191 AGCATTGTGGGAGGCCCAGGTGG + Intergenic
1005599483 6:27411903-27411925 CCCTTGGTGGGAATCCCAGTAGG + Intergenic
1005648211 6:27862567-27862589 AGCCTGTTGGGAAGCCAAGGTGG - Intronic
1006368621 6:33631047-33631069 TGGTGGGTGGGAAGCCTGGGGGG - Intronic
1006415660 6:33902390-33902412 GGAGTGGTGGGAAGCCAAGGCGG + Intergenic
1007716305 6:43858130-43858152 AGTTTTGTGGGAAGCCCAGGAGG - Intergenic
1007994267 6:46289365-46289387 TACTGGTTGGGAAGCCCAAGAGG + Intronic
1010378509 6:75202209-75202231 TGCTTTGTGGGGAGCTCAGTCGG - Intronic
1012584422 6:100904958-100904980 TGCTTGGTGGTAGAGCCAGGAGG - Intergenic
1012829457 6:104186971-104186993 TGCTTCATGGGCAGACCAGGAGG + Intergenic
1012868571 6:104646319-104646341 TGTTTGGTGTGTTGCCCAGGTGG - Intergenic
1013276157 6:108586737-108586759 TGGTTGAGGGGAAGACCAGGGGG + Intronic
1014532588 6:122576602-122576624 TGCTTGCAGTGAAGCCCAGATGG + Intronic
1016894582 6:149039648-149039670 AGCGTGGTGGGAAGCCCACAGGG - Intronic
1016946502 6:149539488-149539510 TGCTTCTTGGGAAGCTGAGGTGG - Intronic
1017156410 6:151325968-151325990 CGTTTGGTGGGGAGCCCGGGAGG + Intronic
1017548737 6:155481228-155481250 TCCTTGGTGAGATGGCCAGGAGG + Intergenic
1017702803 6:157092017-157092039 TGCTTATTGGCAAGCCGAGGAGG + Intronic
1019487431 7:1295868-1295890 GGCTGGGTGGGTGGCCCAGGGGG - Intergenic
1019607443 7:1917262-1917284 TGCTAGGTGGGCAGCCGAGCGGG - Intronic
1019991376 7:4694132-4694154 AGCATTTTGGGAAGCCCAGGTGG - Intronic
1021985639 7:26095770-26095792 AGCATTTTGGGAAGCCCAGGCGG + Intergenic
1022023124 7:26420661-26420683 TGCTTGTGGGGTAGCACAGGAGG + Intergenic
1022196614 7:28073697-28073719 TGCTGGCTGGCAACCCCAGGAGG + Intronic
1022326460 7:29336496-29336518 AGCTTCTTGGGAAGCCAAGGTGG + Intronic
1022391283 7:29946765-29946787 GGCATGGTAGGAAGACCAGGTGG - Intronic
1023677528 7:42646183-42646205 TGCTGGGTGGACAGCCCAGCAGG + Intergenic
1024708474 7:51987418-51987440 TGCTCTGTGGGAGGCACAGGTGG + Intergenic
1027135200 7:75618941-75618963 TGTTGGGTGGGAGGCCAAGGTGG - Intronic
1029491677 7:100874151-100874173 GGCTTGGTGGGATGCCCCTGTGG - Intergenic
1032545478 7:132738194-132738216 GGCTTGTTGGGAATGCCAGGCGG + Intergenic
1032997825 7:137467731-137467753 TGCATTTTGGGAAGCTCAGGTGG + Intronic
1033331945 7:140424100-140424122 TGCACTGTGGGAAGCCGAGGCGG - Intronic
1033979387 7:147145426-147145448 TGTTTGGTGGGAGGTGCAGGTGG - Intronic
1034033835 7:147799236-147799258 TTCTTGGTGGAAACTCCAGGAGG + Intronic
1034265300 7:149777792-149777814 TGTTAGGTGGACAGCCCAGGTGG - Intergenic
1035252077 7:157604143-157604165 TGCTGGGTGGGGGGCCCTGGAGG - Intronic
1035354968 7:158271035-158271057 AGGTTGGGGGGAGGCCCAGGTGG - Intronic
1035438602 7:158878214-158878236 TGCTGTGTGGGGAGGCCAGGAGG + Intronic
1035465137 7:159070051-159070073 TGCTGAGTGGGCAGCCCTGGAGG - Intronic
1035662084 8:1355944-1355966 TGCGTGTTGGGAAGCACCGGTGG + Intergenic
1041706265 8:60849537-60849559 TGCTTGGAACAAAGCCCAGGAGG - Intronic
1042525824 8:69763505-69763527 TGCTGGGTGGGAGGCTGAGGTGG + Intronic
1047411000 8:124624586-124624608 TTGTTGGTGGGACTCCCAGGTGG - Intronic
1048179233 8:132180108-132180130 AGGTGGGTGGGAAGCCCATGTGG + Intronic
1048736565 8:137508573-137508595 TGTTGGGTTGGAGGCCCAGGTGG - Intergenic
1049471620 8:142777383-142777405 GGCTTGGTGAGTAGCCCAGGAGG - Intronic
1050301657 9:4264917-4264939 AGCACGGTGGGATGCCCAGGTGG + Intronic
1050476501 9:6046297-6046319 TGCTTCTTGGGCAGACCAGGAGG - Intergenic
1051263316 9:15287181-15287203 TGCTTGGAGGGGAGCCCAAAGGG + Intronic
1051535469 9:18152544-18152566 TGTTGGGTTGGAGGCCCAGGAGG + Intergenic
1051638788 9:19205118-19205140 AGCTATTTGGGAAGCCCAGGAGG - Intergenic
1052941367 9:34133971-34133993 TGCTTGTTGGGAATCCTTGGAGG + Intergenic
1054823514 9:69547840-69547862 GGGTTGGTAGGAACCCCAGGTGG - Intronic
1055476465 9:76667946-76667968 GGCTTGGTGGGTAGCGTAGGGGG + Intronic
1056813492 9:89782519-89782541 TGCTTGGGAGGCAGCCCAGAGGG - Intergenic
1056855347 9:90123797-90123819 TGCATTGTGGGAAGCCTAGAAGG - Intergenic
1057064852 9:92039032-92039054 AGCTAGTTGGGAAGCTCAGGTGG + Intronic
1057214621 9:93220954-93220976 GGATGGGTGGGCAGCCCAGGAGG - Intronic
1057884505 9:98819723-98819745 TGGTAGGAGGGAAGGCCAGGTGG + Intronic
1058872889 9:109217818-109217840 AGCATTTTGGGAAGCCCAGGAGG - Intronic
1058931401 9:109722904-109722926 TGCTTGGTGGGCAGAGCAGACGG - Intronic
1060343940 9:122800625-122800647 CACTTGGTGGGAAGCACAGAAGG - Exonic
1060520105 9:124289512-124289534 TGTGTGTTGGGGAGCCCAGGAGG + Intronic
1060645522 9:125275637-125275659 TGCTCGGTGGGAGGCTGAGGAGG + Intronic
1060789319 9:126475232-126475254 CGCCTGATGGGAAGCCGAGGTGG - Intronic
1060941627 9:127545982-127546004 CGCTGGGAGGGCAGCCCAGGGGG + Intronic
1062643039 9:137531452-137531474 TGGATGCTGGGAAGCCCAGGTGG + Intronic
1062707579 9:137953911-137953933 TGCCTGGTGGGAAGCCTGGCAGG + Intronic
1203746280 Un_GL000218v1:42144-42166 TCCTTGGTGAGGATCCCAGGAGG + Intergenic
1185763070 X:2703034-2703056 AGCATTTTGGGAAGCCCAGGCGG - Intronic
1186717613 X:12269215-12269237 AGTTTGGGGAGAAGCCCAGGAGG + Intronic
1188328866 X:28843780-28843802 TGCTTGGTGGCAAGAACAAGGGG + Intronic
1191179168 X:57540932-57540954 GAATTGGTGGGAACCCCAGGAGG - Intergenic
1192770549 X:74185311-74185333 TGGATGGTGGGAGGCCAAGGAGG + Intergenic
1194740522 X:97567865-97567887 TGGTTGGAGGGAGGCCGAGGTGG + Intronic
1194753377 X:97708512-97708534 TGCTTTCTGGGAGGCCGAGGTGG - Intergenic
1194915210 X:99698591-99698613 TGCGTGGTGGCAACCCCAGGAGG + Intergenic
1195130380 X:101845193-101845215 GGCCTGATGGGAAACCCAGGTGG - Intronic
1195740682 X:108061919-108061941 TTCTTGGTGGGAAGACCTGTGGG - Intronic
1196842085 X:119868366-119868388 TGCATGTTGGGAAGCTGAGGCGG + Intergenic
1198720007 X:139606604-139606626 AGCATGTTGGGAGGCCCAGGCGG - Intronic
1202026196 Y:20526480-20526502 TTCTGGGTGGGATGCCCATGTGG - Intergenic