ID: 967724377

View in Genome Browser
Species Human (GRCh38)
Location 3:192848005-192848027
Sequence AGCTGTAACATTAACATTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 229}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967724374_967724377 2 Left 967724374 3:192847980-192848002 CCAACCAAAATACATTTATGTCT 0: 1
1: 0
2: 1
3: 35
4: 327
Right 967724377 3:192848005-192848027 AGCTGTAACATTAACATTGGTGG 0: 1
1: 0
2: 0
3: 5
4: 229
967724375_967724377 -2 Left 967724375 3:192847984-192848006 CCAAAATACATTTATGTCTACAG 0: 1
1: 0
2: 1
3: 26
4: 326
Right 967724377 3:192848005-192848027 AGCTGTAACATTAACATTGGTGG 0: 1
1: 0
2: 0
3: 5
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967724377 Original CRISPR AGCTGTAACATTAACATTGG TGG Intronic
900858937 1:5210843-5210865 TGCTGGAAGAATAACATTGGTGG - Intergenic
906989975 1:50727093-50727115 AGCTGAGACATTAAAAATGGAGG - Intronic
907793494 1:57691562-57691584 AGCTGTAACATTCACTGTGAAGG + Intronic
907805021 1:57810228-57810250 AGCTGTATCATTAAGAAGGGGGG + Intronic
910195682 1:84637457-84637479 ATCTGTAACATTATTATTTGAGG - Intergenic
910397515 1:86807248-86807270 AGCTGTAACATTCACCGTGAAGG + Intergenic
910397841 1:86809456-86809478 AGCTGTAACATTCACTGTGAAGG - Intergenic
914327208 1:146631029-146631051 AGCTGGAACATTAAAATGGAAGG - Intergenic
915183388 1:154082904-154082926 AGCTGTAACACTAACTGTGAAGG - Intronic
915435125 1:155899281-155899303 AGCTTTAAAATTCACATAGGTGG - Intronic
916974952 1:170066182-170066204 AGCTATAACATAAAGAATGGGGG - Intronic
920946762 1:210536537-210536559 TGCTGTATCATTTACAGTGGAGG + Intronic
921566704 1:216730130-216730152 AATTGTGACACTAACATTGGTGG - Intronic
921757457 1:218875523-218875545 ACCTGAAACATTAACGTTGGTGG + Intergenic
924391915 1:243570176-243570198 CGCTGTCTCATTCACATTGGAGG - Intronic
924646774 1:245885115-245885137 AGCTGTAACATTCACTGTGAAGG + Intronic
1063199888 10:3777900-3777922 AGCAAATACATTAACATTGGGGG + Exonic
1063541047 10:6934207-6934229 AGCTGTAACACTAACTGTGAAGG - Intergenic
1064579785 10:16782538-16782560 AGCTGAAGCAATAACACTGGCGG - Intronic
1064892674 10:20195950-20195972 AGCTGTAACTTTTACTTTGTTGG - Intronic
1064921576 10:20525184-20525206 AGCAGTAACAATAAGATTGATGG + Intergenic
1066045015 10:31587253-31587275 AGCTGTAACACTCACCTTGAAGG - Intergenic
1066575627 10:36821090-36821112 AACTGTAACACTAACAGTGAGGG + Intergenic
1067532268 10:47082769-47082791 AGCTGTAACACTAACTGTGAAGG + Intergenic
1071313058 10:84362114-84362136 AGGAGTAACATTAACATGGATGG - Intronic
1074314724 10:112350670-112350692 AGCTGTAACATTTACCGTGAAGG + Intergenic
1078553605 11:12299702-12299724 AGCTGTAGGCTTAACATTTGCGG - Intronic
1080706748 11:34702160-34702182 AGCTGTAACACAAACAGTGCTGG + Intergenic
1082675158 11:56089941-56089963 AGATGAAACATTGACATTGCAGG + Intergenic
1084240563 11:67817097-67817119 AGCTGTAACACTCACCTTGAAGG - Intergenic
1084440556 11:69170300-69170322 AGCAGTGATCTTAACATTGGCGG + Intergenic
1084831860 11:71775615-71775637 AGCTGTAACACTCACCTTGAAGG + Intergenic
1085999373 11:81962233-81962255 AGATTTACCATTAATATTGGGGG - Intergenic
1086724767 11:90168061-90168083 AGCTGTAACACTCACCTTGAAGG + Intronic
1087437196 11:98136271-98136293 AGCTGTAACATTCACCATGAAGG + Intergenic
1087445330 11:98243897-98243919 AGCTGTAACAGTCACCTTGAAGG - Intergenic
1094199550 12:27781594-27781616 ACCTGTAACACTGACTTTGGGGG + Intronic
1094238487 12:28194913-28194935 AGCTGTAACACTCACAGTGAAGG - Intronic
1094385371 12:29888265-29888287 AGCTGTAACACTCACCTAGGTGG - Intergenic
1094405190 12:30109656-30109678 AGCTGTAACACTCACCGTGGAGG - Intergenic
1094736535 12:33240957-33240979 AGCTGTAACATTCACCGTGAAGG - Intergenic
1094833328 12:34310612-34310634 AGCTGTAACATTTACAGCGAAGG + Intergenic
1097017772 12:55999583-55999605 AGCTGTAACATTCACTGTGAAGG - Intronic
1100076155 12:90786188-90786210 AGCTGTAACATTCACCGTGAAGG + Intergenic
1103462375 12:121115274-121115296 ATCTGTAAAGTGAACATTGGTGG - Intergenic
1103668712 12:122593142-122593164 AGCTGTAACACTCACCTCGGGGG + Intronic
1105796768 13:23861925-23861947 AACTGCAACATTAACACTGATGG + Intronic
1105883328 13:24622578-24622600 AGCTGTAACATTCACCTCGAAGG - Intergenic
1105953615 13:25257425-25257447 TGCTGTGACATTATCATTGCAGG - Intronic
1106643228 13:31607787-31607809 AGCTGTAACACTCACTGTGGGGG - Intergenic
1107032860 13:35870928-35870950 ATCTGAAAGATTAACTTTGGTGG + Intronic
1107713984 13:43180457-43180479 AGCTGTAACACTCACAGGGGAGG + Intergenic
1107853686 13:44594125-44594147 AGCTGTAACAATAACTGTGAAGG - Intergenic
1108157075 13:47596258-47596280 AGCTGTAACATTCACCATGAAGG + Intergenic
1108867298 13:54938997-54939019 AGCTGTAACATTCACTGTGAAGG + Intergenic
1108958311 13:56188272-56188294 AGCTGTAACACTCACCTTGAAGG + Intergenic
1111221061 13:85205853-85205875 AGCTGTAACACTAACCATGAAGG + Intergenic
1112077003 13:95925572-95925594 AACTGAAACATTAACATGGAGGG + Intronic
1114183860 14:20385703-20385725 AGCAATGACATTGACATTGGAGG - Intronic
1116571261 14:46518758-46518780 AACTGTAACATTAAAAAAGGAGG - Intergenic
1116762213 14:49027844-49027866 AGCTATAAGATTAAATTTGGTGG - Intergenic
1117924153 14:60758722-60758744 AAAAGTAACATTAACAATGGAGG + Intronic
1119300522 14:73567823-73567845 AGCTGTAACACTCACCTTGAAGG + Intronic
1121613437 14:95296662-95296684 AGCCGTTACATTAACATTTCAGG - Intronic
1122813655 14:104301625-104301647 AGCGGTAACAGTAGCAGTGGGGG - Intergenic
1124951354 15:34323963-34323985 AGATGTAGCACAAACATTGGTGG + Intronic
1131506189 15:93021887-93021909 AGATGTAACATTTACCTTGTTGG + Intronic
1132308671 15:100838686-100838708 AGCAGTTTCAATAACATTGGCGG - Intergenic
1135377158 16:21957257-21957279 AGCTGTGGCTTTAACTTTGGGGG - Exonic
1137502875 16:49024789-49024811 AGGTGTCACATTAGCATCGGAGG + Intergenic
1138876325 16:60955125-60955147 AGTTGTAAAATTTACATTGATGG - Intergenic
1140006352 16:71079910-71079932 AGCTGGAACATTAAAATGGAAGG + Exonic
1140170848 16:72602472-72602494 AACTATAACTTTAACATTGCTGG + Intergenic
1144550886 17:16240008-16240030 AACTGTAATCCTAACATTGGAGG + Intronic
1145822070 17:27846378-27846400 AGCTGTAACATTAACTGCGAAGG - Intronic
1150642719 17:66960471-66960493 AGCAGTAACATTTATATGGGCGG + Intergenic
1152866833 17:82729178-82729200 AGCTGTAGAATTACCTTTGGGGG + Intronic
1153934742 18:9911888-9911910 AGCTGTAACATTCACCGTGAAGG - Intergenic
1156223613 18:35079932-35079954 ATCTGTAACATTAAAATTCAAGG + Intronic
1156324832 18:36064968-36064990 AGCTGTAACACTCACAGTGAAGG + Intronic
1158282164 18:55840064-55840086 AGCTGTAACACTCACCTTGAAGG - Intergenic
1159346621 18:67215062-67215084 AGCTGTAACACTCACAGTGAAGG - Intergenic
1160135141 18:76265250-76265272 AGCTGTAACAGGAACTATGGGGG + Intergenic
1162232931 19:9282657-9282679 AGCTGTAACACTCACAGTGAAGG - Intergenic
1168405775 19:56109591-56109613 ACCTGTAAAAATAACATTTGTGG + Intronic
925947627 2:8880353-8880375 AGCAGTACCATTATCACTGGTGG - Intronic
927407944 2:22793569-22793591 AGCTGCAATATGAACAGTGGTGG + Intergenic
927960854 2:27239856-27239878 AGCTTGAACATTTTCATTGGTGG + Intronic
929885640 2:45875269-45875291 AGTTTTACCATTAACATTGCTGG - Intronic
929955358 2:46454103-46454125 AGCTGTACCATCAACATTCCTGG + Intronic
931583355 2:63801379-63801401 AGCTGTAACACTCACAGTGAAGG - Intronic
933342546 2:81040590-81040612 AGCTGTAACACTCACTTTGAAGG + Intergenic
933730864 2:85455381-85455403 AGCTGTAACACTCACAGTGAAGG - Intergenic
935922719 2:108032814-108032836 AGCTGTAACATTCACTGTGAAGG + Intergenic
936631474 2:114207732-114207754 AGCTGTAACATTCACTGTGAAGG + Intergenic
937771903 2:125729154-125729176 AGCTGTAACACTCACAGTGAGGG + Intergenic
938936586 2:136132759-136132781 ATCAGTATCATCAACATTGGTGG + Intergenic
939339649 2:140877752-140877774 ATATGTAAGATGAACATTGGTGG - Intronic
939486712 2:142822399-142822421 AGCTGTGACATTAACTTTCAGGG + Intergenic
939538260 2:143460781-143460803 AGCTGAAACATTACCATTTTAGG + Intronic
939743409 2:145938245-145938267 CGCTGTAACATGGAAATTGGAGG - Intergenic
942299449 2:174547897-174547919 AGCTGTAACATTCACCGTGAAGG - Intergenic
943134590 2:183893626-183893648 AGCTGTAACATTCACTGTGAAGG + Intergenic
944252322 2:197590731-197590753 AGCTGTAACACTCACCGTGGAGG - Intronic
944812858 2:203345151-203345173 AGTTGTAACACTCACATTGAAGG + Intronic
946929349 2:224656739-224656761 AGCTGTAACATTCACCGTGAAGG + Intergenic
947737069 2:232460798-232460820 AGCTGTCACAAAAATATTGGAGG + Intergenic
948185459 2:236018194-236018216 AGCTGTAACTTTAACATCTCAGG + Intronic
1169655601 20:7919313-7919335 ATCTGTAACATTAAAAGTGTAGG - Intronic
1171304519 20:24093879-24093901 AGGTGTGACATTTACATGGGGGG - Intergenic
1173266703 20:41490108-41490130 ACCTGTAAGATTATCATTGAAGG + Intronic
1177978768 21:27884871-27884893 AGCTGTAACACTCACAGTGCAGG - Intergenic
1178372233 21:32036017-32036039 GGCTGTTACATCAACCTTGGAGG + Intronic
1181441569 22:22938652-22938674 AGGTGTGACCTTAGCATTGGAGG + Intergenic
1182553078 22:31112077-31112099 AGCTGTAACACTCACAGTGAAGG - Intronic
1182592705 22:31394323-31394345 AGCTGTAACATTGACTGTGAAGG + Intergenic
1182594812 22:31410991-31411013 AGCTGCAAGATTAAGAATGGGGG - Exonic
949791058 3:7792603-7792625 AGTTTTAACATTAATTTTGGAGG - Intergenic
950203747 3:11062369-11062391 AGCTGTAACATTCACTGTGAAGG + Intergenic
951239155 3:20270010-20270032 AGCTGTAACATTAACTGCGAAGG + Intergenic
953832409 3:46311870-46311892 AGCTGTGGCTTTAACTTTGGGGG + Intergenic
955417846 3:58709357-58709379 AGCTGTAACACTCACAGTGAAGG + Intergenic
956451829 3:69382480-69382502 ATCTGTGACATTAAAATGGGAGG - Intronic
956851194 3:73229706-73229728 AGATGTAACACTTACATTGTAGG + Intergenic
957056017 3:75443772-75443794 AGCTGTAACACTCACTTTGAAGG - Intergenic
957824853 3:85427613-85427635 AGCTGTTACATTACAATTGAAGG - Intronic
957970522 3:87376134-87376156 AGCTGTAACACTCACAGTGAAGG + Intergenic
960271315 3:115677410-115677432 AGCTGTAACTTGAAAGTTGGAGG + Intronic
961298360 3:125904813-125904835 AGCTGTAACACTCACCTTGAAGG + Intergenic
961700634 3:128742146-128742168 AGCTGTAACACTCACCGTGGAGG - Intronic
962802508 3:138902398-138902420 AGATGTAACATCACCAATGGTGG - Intergenic
963553911 3:146761179-146761201 GGATGTAACCTTAACATTAGCGG - Intergenic
963673365 3:148279959-148279981 AGCTGTAACACTCACCGTGGAGG - Intergenic
964665608 3:159168668-159168690 AGCTGTTTCATTAACAATGGGGG - Intronic
965172735 3:165288918-165288940 TACTCTAACATCAACATTGGGGG - Intergenic
967601434 3:191394089-191394111 AGCTGAAACACTAACATTCCTGG - Intronic
967724377 3:192848005-192848027 AGCTGTAACATTAACATTGGTGG + Intronic
967951050 3:194840935-194840957 AGCTGTAACATTGACTGTGAAGG + Intergenic
969755173 4:9144580-9144602 AGCTGTAACACTCACCTTGAAGG + Intergenic
971668131 4:29519774-29519796 AGCTGAATCATTAAAATTTGGGG - Intergenic
971820942 4:31554460-31554482 ATGTGTAACATAAGCATTGGTGG - Intergenic
972874225 4:43338629-43338651 AGCTTTATCATGAACATGGGTGG - Intergenic
973046742 4:45542797-45542819 AGCTGTAACACTCACAATGAAGG + Intergenic
973283410 4:48386860-48386882 TCCTGTTACATTAACATTGTGGG - Intronic
973908232 4:55551903-55551925 AGCTGTAACACTCACTGTGGGGG - Intergenic
974839172 4:67282005-67282027 AGCTGTAACACTCACCTTGAAGG - Intergenic
975048137 4:69828336-69828358 AGCTGTAACACTCACAGTGAAGG + Intronic
977449942 4:97182539-97182561 AGCTGTAACACTCACTGTGGAGG + Intergenic
977479065 4:97550905-97550927 AGCTGTAACACTAACTGTGAAGG - Intronic
978868707 4:113548112-113548134 AGCTGTCACATTAACAGTCAGGG + Intronic
980365532 4:131799458-131799480 ATCTGTAACATTAATGTTGCAGG - Intergenic
980774630 4:137421939-137421961 AGCTGTAACACTCACTGTGGAGG + Intergenic
980867373 4:138568822-138568844 ATCTGTAACAGTAACAATTGAGG + Intergenic
981280730 4:142955141-142955163 AGCTGTAACACTCACAGTGAAGG + Intergenic
981664252 4:147203994-147204016 AGCTGAAATGTTAACATTAGTGG - Intergenic
982544674 4:156719349-156719371 AGCTGTGAAATAAACTTTGGTGG + Intergenic
982772468 4:159409920-159409942 AGCTATAACATCAACAATGAAGG - Intergenic
984240533 4:177214067-177214089 AGCTGAAATATTAATTTTGGGGG - Intergenic
985804096 5:2027678-2027700 AGCTGTAACACTCACTGTGGAGG + Intergenic
986000360 5:3626418-3626440 AGCTGTAACATTAGAATGGAAGG - Intergenic
986781684 5:11072221-11072243 GACTGCAACATTAACATTAGAGG - Intronic
986882043 5:12186036-12186058 AGTTTTAACATGAATATTGGAGG - Intergenic
987467215 5:18286046-18286068 AGCTGTAACACTCACAGTGAAGG + Intergenic
987929571 5:24387497-24387519 AGCTGTAACACTCACAGTGAGGG + Intergenic
988386485 5:30572729-30572751 AGATGTTGCATTAAAATTGGAGG + Intergenic
989314327 5:40059746-40059768 AGCTGTAACATTCACCGTGAAGG + Intergenic
990446362 5:55897355-55897377 GTCTGAAACATTAACATTCGGGG + Intronic
991132111 5:63134319-63134341 TAATGTAACATTAACAATGGAGG + Intergenic
992544381 5:77797059-77797081 AACTGTAACATTAATGTGGGAGG - Intronic
993934143 5:93980303-93980325 AGCTGAAACATTAACAACTGTGG - Intronic
994384946 5:99120290-99120312 AGCTGGAGCATAAACATTGTAGG - Intergenic
994449220 5:99919919-99919941 AGCTGTAACACTCACAGTGAAGG + Intergenic
994503928 5:100616104-100616126 AGCTGTAAAAGTCACAATGGTGG - Intergenic
994702561 5:103155285-103155307 AGCTGTAACAGGAATATTGGTGG - Intronic
995332364 5:110959250-110959272 TGATGCAACATTAAAATTGGGGG - Intergenic
995335594 5:110995496-110995518 AGTTTTAACATTAATATTGGAGG - Intergenic
996182173 5:120432438-120432460 AGCTTTAACAAGAACTTTGGAGG - Intergenic
997457892 5:134031000-134031022 AGCTGTAACATTACTGTTGTTGG - Intergenic
999818638 5:155201854-155201876 AGCTGTAACACTCACAGTGAAGG - Intergenic
1000432216 5:161165446-161165468 AGCTGTAACATTCACCATGAAGG - Intergenic
1002615619 5:180453504-180453526 AGCTGTAACACTCACCTTGAAGG + Intergenic
1003168752 6:3703848-3703870 AGCTGTAACACTCACAGTGAAGG - Intergenic
1005482351 6:26266666-26266688 AGCTGTAATTTTAAAAATGGTGG - Intergenic
1005718498 6:28577005-28577027 AGCTATTACATCAACATTTGAGG + Intronic
1006968384 6:38013747-38013769 AGGTGTAACCTGGACATTGGAGG - Intronic
1007352653 6:41285094-41285116 ATCTGTAACATTAACTTCAGAGG - Intronic
1007990752 6:46253219-46253241 AGCTGTGGAATTCACATTGGTGG + Intronic
1008218285 6:48822907-48822929 AGCTGTAACACTCACTGTGGAGG + Intergenic
1011790539 6:90893879-90893901 ATTTGTAACATTAACAGAGGAGG + Intergenic
1012789598 6:103676610-103676632 AGCTGTAACACTCACCTTGAAGG - Intergenic
1014935546 6:127380864-127380886 AGCTGTAACACTCACAGTGAAGG + Intergenic
1017581041 6:155865945-155865967 AGCTGTAACACTCACCTTGAGGG - Intergenic
1021395693 7:20145225-20145247 ACCTGTAACATCAACAATGTGGG + Intronic
1026667774 7:72358648-72358670 AGATGTAAAAATAACATTGGCGG + Intronic
1027561838 7:79740340-79740362 AGCTGTAACAGTCACCGTGGAGG + Intergenic
1028060244 7:86304375-86304397 AGCTGGAACATTACGATTTGAGG - Intergenic
1028245097 7:88467732-88467754 ATCTTTATCATTAACATGGGTGG - Intergenic
1028294340 7:89108976-89108998 AGCTGTGTCATTAGTATTGGAGG + Intronic
1028784613 7:94777704-94777726 AGCTGTAACACTCACCATGGAGG + Intergenic
1028795954 7:94904588-94904610 AGCTATAAAATTAACATTAAAGG - Intergenic
1029671530 7:102035720-102035742 AGATGTAACATTTATATTGAAGG + Intronic
1030174313 7:106635415-106635437 AGCAGTATCAGTAACATTGTGGG + Intergenic
1031903026 7:127430307-127430329 AGCTGTAACATTCACTGTGAAGG + Intronic
1032873659 7:136013000-136013022 AGCTGTAACACTCACCTTGATGG - Intergenic
1035131417 7:156657771-156657793 ATCTGTTACATAAACATTTGTGG - Intronic
1035891054 8:3343630-3343652 ATCTTTACCATTAACACTGGAGG + Intronic
1037957406 8:23070227-23070249 AGCTGTAACACTCACCTTGAAGG - Intergenic
1038370191 8:26981321-26981343 ATCTGTACTATTAACAATGGAGG + Intergenic
1040026698 8:42787788-42787810 AGCTGTAACACTCACAGTGAGGG + Intronic
1040667256 8:49649771-49649793 AGCTGTAACACTCACCTTGTAGG - Intergenic
1043266893 8:78278130-78278152 AGCTTTAACATATAAATTGGGGG - Intergenic
1045157682 8:99495637-99495659 AGCTGTAAGATTAACAGTATAGG - Intronic
1045407242 8:101879464-101879486 AGCTGTAACACTCACAGTGAAGG - Intronic
1046325532 8:112639864-112639886 GGCTGTACCATTTACATTTGTGG - Intronic
1046397459 8:113658742-113658764 AGCTGTAACACTAACTATGAAGG - Intergenic
1050467531 9:5945161-5945183 AGCTGAAATTTCAACATTGGTGG + Intronic
1050734712 9:8749558-8749580 AGCTGTCACATAGAGATTGGTGG - Intronic
1050797405 9:9561353-9561375 AGCTGTAACCTAAACAGTGTGGG + Intronic
1051935915 9:22441653-22441675 AGCTGTAACACTCACAGTGAAGG + Intergenic
1052377269 9:27731602-27731624 AGCTCTCACATTAAGATTGTTGG + Intergenic
1057308082 9:93924152-93924174 TGCTGTAACAGTCACAGTGGCGG - Intergenic
1185976384 X:4725336-4725358 AGCTGTAACACTCACCGTGGAGG - Intergenic
1187005672 X:15230807-15230829 AGCTGTAACATTCACCGTGAGGG - Intergenic
1188176919 X:27002241-27002263 AGCTGTAACACTCACAGTGAAGG - Intergenic
1188665574 X:32816245-32816267 TGTTGAAACATTAACATTAGCGG - Intronic
1192027436 X:67469167-67469189 AGCTGTAACATTCACTGTGAAGG - Intergenic
1193145716 X:78073652-78073674 AGCTGTAACACTCACTTTGAAGG - Intronic
1193667278 X:84337117-84337139 AACTGTATCCTTAACAATGGAGG + Intronic
1199556335 X:149113487-149113509 AGCTGTAACATTCACTGTGAAGG - Intergenic
1199832782 X:151561947-151561969 AGCTGTAACACTCACCGTGGAGG - Intergenic
1199993915 X:153007137-153007159 AGCTGAAAAATTCACCTTGGGGG + Intergenic
1201254322 Y:12092066-12092088 AGCTGTTACACTCACATTTGTGG - Intergenic
1201505940 Y:14700137-14700159 ATCTGTATTATTAACAATGGAGG + Intronic
1202332258 Y:23767212-23767234 AGCTTTAACTTTAGAATTGGAGG + Intergenic
1202538511 Y:25902851-25902873 AGCTTTAACTTTAGAATTGGAGG - Intergenic