ID: 967729098

View in Genome Browser
Species Human (GRCh38)
Location 3:192890780-192890802
Sequence GATCCTCCTCACATCCTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 405}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967729098 Original CRISPR GATCCTCCTCACATCCTCCA TGG Intronic
900820437 1:4882615-4882637 GGTCCTCCTCATTTACTCCAGGG + Intergenic
901100548 1:6715614-6715636 GATGCTCCTCACATCCCGGACGG + Intergenic
901649372 1:10734853-10734875 CATGCTCCTCAGATCCTCCGTGG - Intronic
902487350 1:16757907-16757929 GCCCCACCTCACATCCTCCCAGG + Intronic
903081301 1:20815362-20815384 GATGCTCCTCACTTCCTAGATGG - Intronic
904109890 1:28117542-28117564 CATCATCCTCACGTCCTACATGG - Intergenic
904375587 1:30080286-30080308 TATCATCCTCACGCCCTCCATGG - Intergenic
904375592 1:30080309-30080331 TATCATCCTCACGCCCTCCATGG - Intergenic
904409761 1:30318522-30318544 GATCCATCTCACGGCCTCCAGGG + Intergenic
904784838 1:32975296-32975318 GATGCTCCTCACTTCCTAGATGG + Intergenic
904857358 1:33509488-33509510 GATGCTCCTCACCTCCTAGACGG + Intergenic
904913805 1:33955070-33955092 GATCGTCCTCTCTTCCTCCTTGG - Intronic
906514797 1:46432524-46432546 GTTCCTCCTCACATTCCCCCAGG - Intergenic
907009790 1:50952647-50952669 GATGCTCCTCACTTCCTAGACGG - Intronic
907778073 1:57538361-57538383 GTTCCTCATCACATCCTGTAAGG + Intronic
909479077 1:76112794-76112816 GATGCTCCTCACTTCCTAGATGG + Intronic
910087030 1:83415739-83415761 GATACTCTTCACATGTTCCAGGG - Intergenic
910815779 1:91289318-91289340 GATGCTCCTCACTTCCTAGACGG + Intronic
910891709 1:92026342-92026364 GATGCTCCTCACTTCCTAGATGG + Intergenic
912371504 1:109177397-109177419 GACGCTCCTCACATCCTGGACGG + Intronic
912546561 1:110455490-110455512 GAACCACCTCACATTCCCCAAGG - Intronic
912844025 1:113063601-113063623 GACGCTCCTCACATCCTAGACGG + Intergenic
912844088 1:113063834-113063856 GATGCTCCTCACTTCCTAGACGG + Intergenic
912864888 1:113248137-113248159 GAGCCTCATCACTCCCTCCAGGG - Intergenic
914787900 1:150850821-150850843 GACCCTCCTCACTTCCTAGACGG - Intronic
914893896 1:151651658-151651680 GATGCTCCTCACTTCCTAGATGG + Intronic
915383325 1:155464186-155464208 GAGCCTCCACACATCCTTCCAGG - Intronic
915491198 1:156250929-156250951 GATCCTCCTCACCTGCCCCCTGG + Exonic
915861521 1:159449735-159449757 GATGCTCCTCACTTCCTAGATGG - Intergenic
916046163 1:161001247-161001269 GCTCACCCTCACACCCTCCATGG + Intronic
916131688 1:161616821-161616843 GATGCTCCTCACTTCCTAGATGG + Intronic
916208964 1:162343076-162343098 GCTCTTCCTCACAGCCTGCATGG + Intronic
916759898 1:167806578-167806600 GATGCTCCTCACTTCCTAGACGG + Intergenic
917126708 1:171694142-171694164 GATGCTCCTCACTTCCTAGACGG + Intergenic
917583173 1:176396943-176396965 GACGCTCCTCACATCCTGGACGG + Intergenic
918812547 1:189140069-189140091 GATGCTCCTCACTTCCTAGATGG + Intergenic
918818766 1:189225591-189225613 GATGCTCCTCACTTCCTAGACGG - Intergenic
919536212 1:198790950-198790972 GACCCACCTCCCAACCTCCAGGG - Intergenic
920053144 1:203175412-203175434 GCTGCTGCTCACATCATCCAGGG + Exonic
920152512 1:203920057-203920079 GACGCTCCTCACATCCTGGACGG + Intergenic
920508037 1:206530821-206530843 GATCATCCTCAGACCTTCCATGG - Intronic
920613947 1:207470748-207470770 GCCCCTCCTAACATCCTCAATGG + Exonic
920882300 1:209891620-209891642 GATTCTTCCCAGATCCTCCAGGG - Intergenic
921142746 1:212321644-212321666 GATGCTCCTCACTTCCTAGATGG + Intronic
922458458 1:225796405-225796427 GATGCTCCTCACTTCCTAGACGG + Intergenic
922503901 1:226115383-226115405 GACGCTCCTCACTTCCTACATGG + Intergenic
923048137 1:230370258-230370280 CATCCTCTTCACATTCCCCATGG + Intronic
1064018276 10:11789587-11789609 CATCCTGCTCACATCATCCAAGG - Intergenic
1065840322 10:29696531-29696553 GATGCTCCTCACTTCCTAGATGG - Intronic
1066390863 10:34976495-34976517 GATGCTCCTCACTTCCTAGATGG - Intergenic
1067534536 10:47099273-47099295 CACACGCCTCACATCCTCCAGGG - Intergenic
1067751870 10:48977033-48977055 CATTCTTCTCACTTCCTCCAGGG + Intronic
1068849204 10:61717077-61717099 CATCCTCCTAACATCCTGCAAGG + Intronic
1069649961 10:70039258-70039280 GATCCTGTTCACAACCTCCCAGG - Intergenic
1070135425 10:73689643-73689665 GACGCTCCTCACATCCTGGACGG - Intronic
1070730638 10:78825774-78825796 TACCCTACTCTCATCCTCCATGG + Intergenic
1070798658 10:79231996-79232018 GACCCTCCTCCCATCATTCATGG - Intronic
1071728382 10:88222382-88222404 GAGCCTCCTCCCAGACTCCAAGG - Intergenic
1072013501 10:91323706-91323728 GACCCTCCTCACTTCCTAGATGG + Intergenic
1072690976 10:97572295-97572317 GACCCTCCTCACAGCCAGCAGGG + Intergenic
1073187918 10:101628020-101628042 GATTCTCGTCACATCCCTCACGG + Intronic
1075053604 10:119201685-119201707 GAACCTCATCCAATCCTCCAAGG - Intergenic
1079492050 11:21000027-21000049 GATGTTCCTCAGATCCACCAAGG + Intronic
1079884605 11:25971354-25971376 GATCCTCCTCCCCTCCACCTGGG - Intergenic
1080052058 11:27868294-27868316 GCCCCACCTCTCATCCTCCAGGG - Intergenic
1080938431 11:36886533-36886555 AATCCTCCTAACAATCTCCAGGG + Intergenic
1080983140 11:37431442-37431464 GGTGCTCCTCACATCCCCGATGG + Intergenic
1082258975 11:50063176-50063198 GATGCTCCTCACTTCCTAGATGG + Intergenic
1083120746 11:60510142-60510164 GATGCTCCTCACTTCCTAGACGG - Intergenic
1083130663 11:60621994-60622016 GACCCTCCTCACTTCCTAGATGG - Intergenic
1084163222 11:67362407-67362429 GATCATCCTCACATCCTACATGG - Intronic
1084745753 11:71168165-71168187 GACGCTCCTCACATCCCGCACGG + Intronic
1084989468 11:72909574-72909596 GATGCTCCTCACTTCCTAGACGG - Intronic
1085315891 11:75544773-75544795 CAAGCACCTCACATCCTCCATGG + Intergenic
1085563163 11:77490107-77490129 GATGCTCCTCACTTCCTAGATGG - Intergenic
1085723421 11:78933037-78933059 GGTCCTGCTCCCAGCCTCCAGGG - Intronic
1089793423 11:120960924-120960946 GATCATCATCTCATCCTACACGG + Exonic
1090224355 11:125061163-125061185 GATCCTCTCCACATTCTGCAGGG + Intergenic
1090249369 11:125240692-125240714 GATCCTTCTCAAATCCTCAGAGG + Intronic
1092127475 12:6085088-6085110 GACCCTCCTCACCTTCTCCTTGG + Intronic
1092296089 12:7200306-7200328 GACGCTCCTCACTTCCTCGATGG + Intronic
1094376808 12:29799234-29799256 GATAACCCTTACATCCTCCAGGG - Intergenic
1096024652 12:48350680-48350702 GATCCTCCTCCCAGCCCCTATGG + Exonic
1096054752 12:48641903-48641925 GATGCTCCTCACTTCCTAGATGG - Intergenic
1097138433 12:56879159-56879181 GATGCTCCTCACTTCCTAGACGG - Intergenic
1097138463 12:56879275-56879297 GACCCTCCTCACTTCCTAGACGG - Intergenic
1097254711 12:57664894-57664916 GATGCTCCTCACTTCCTAGATGG - Intergenic
1099867895 12:88307187-88307209 CATCCTCCTCCCATCCTAGAGGG + Intergenic
1100807711 12:98304811-98304833 GATCCTCTTCCCATCCTCATGGG + Intergenic
1102186409 12:110951272-110951294 GATGCTCCTCACTTCCTAGATGG + Intergenic
1102656350 12:114485188-114485210 GATGCTCCTCACTTCCTAGACGG + Intergenic
1103733048 12:123041452-123041474 GGTCCTCCTCACTTTCTCCCTGG + Intronic
1103904024 12:124318309-124318331 GATTCTCCTCACCTCTTGCAGGG - Intergenic
1104018346 12:124975330-124975352 GATGCTGCTCACCTCCTCCTGGG + Intronic
1106104710 13:26723726-26723748 GATGCTCCTCACTTCCTAGATGG - Intergenic
1106400128 13:29421789-29421811 GCACCACCTCACCTCCTCCAGGG - Intronic
1106670131 13:31896480-31896502 GAGCCTCCTCAGCCCCTCCACGG - Intergenic
1108608491 13:52063612-52063634 GATGCTCCTCACTTCCTAGATGG - Intronic
1110506647 13:76295112-76295134 GATGCTCCTCACTTCCTAGACGG - Intergenic
1111901337 13:94202816-94202838 GCTCCTCCTCACCTACTCCCGGG - Intronic
1111937365 13:94570902-94570924 CATCATCTTCACCTCCTCCAAGG - Intergenic
1112077357 13:95928767-95928789 GATGCTCCTCACTTCCTAGACGG + Intronic
1112086667 13:96039391-96039413 GATCCTCCCCAGATCCTTCCTGG + Intronic
1112214505 13:97416550-97416572 GATAATCCTGAGATCCTCCAAGG + Intergenic
1113479029 13:110606626-110606648 GATGCTCCTCACATCCCAGACGG + Intergenic
1115540080 14:34411843-34411865 GATGCTCCTCACTTCCTAGATGG - Intronic
1116005419 14:39285901-39285923 GATGCTCCTCACTTCCTAGACGG + Intronic
1116565973 14:46444609-46444631 GAACCACCTCAGATCCTTCAGGG - Intergenic
1117763709 14:59059083-59059105 GATGCTCCTCACTTCCTAGATGG + Intergenic
1118148566 14:63165492-63165514 GATGCTCCTCACATCCCAGACGG - Intergenic
1118253328 14:64183372-64183394 GATGCTCCTCACTTCCTAGACGG + Intronic
1119051915 14:71377549-71377571 GACGCTCCTCACTTCCTACACGG + Intronic
1119089167 14:71764613-71764635 GATACTCATCACATCTGCCAGGG + Intergenic
1119939086 14:78621346-78621368 AATCCTCCTCTCAACCTACATGG - Intronic
1119968781 14:78946328-78946350 GTTCCTCTTCACATTCTTCATGG - Intronic
1120505839 14:85352926-85352948 GACCCTCCTCACTTCCTAGATGG + Intergenic
1120865249 14:89290899-89290921 CATCCTCCTCACCTCCTCCAGGG - Intronic
1123149900 14:106170649-106170671 GATGCTCCTCAGAACCACCAGGG - Intergenic
1124178181 15:27446986-27447008 GATGCTCCTCCCATGCACCAGGG + Intronic
1125566496 15:40682632-40682654 GATGCTCCTCACTTCCTAGATGG - Intergenic
1126743125 15:51798491-51798513 GCTCTTCTGCACATCCTCCATGG - Intronic
1127088618 15:55446474-55446496 GGTGCTCCTCACATCCTAGACGG + Intronic
1127159955 15:56171980-56172002 GTTCCTTCTCACACCCTTCAAGG - Intronic
1127483914 15:59402195-59402217 CATCCTCCTAACATTATCCACGG - Intronic
1127584196 15:60366385-60366407 GATGCTCCTCACTTCCTAGATGG - Intronic
1128236868 15:66073599-66073621 CATGGTCCTCACCTCCTCCAAGG + Intronic
1128765464 15:70248509-70248531 CCTCCTCCTCACTGCCTCCATGG + Intergenic
1129718969 15:77867308-77867330 CAGTCTCCTCACTTCCTCCAGGG + Intergenic
1132745169 16:1433453-1433475 GACTCTCCTCCCATCCTCCTGGG + Intergenic
1132999272 16:2840986-2841008 GAGCCTCCTCACAGCCACCAAGG + Intergenic
1133622231 16:7537376-7537398 GAGCATCATCACATCCTCAATGG - Intronic
1134128291 16:11631301-11631323 GACCCTCCCTAGATCCTCCAGGG - Intronic
1135190372 16:20349271-20349293 GATCCTTCCCTCATTCTCCAGGG + Intronic
1135891035 16:26357661-26357683 CATCCTCTTCCCACCCTCCACGG - Intergenic
1136593526 16:31232221-31232243 GATGCTCCTCACATCCCAGACGG - Intergenic
1136680154 16:31956143-31956165 GATGCTCCTCAGAACCACCAGGG + Intergenic
1136780496 16:32897687-32897709 GATGCTCCTCAGAACCACCAGGG + Intergenic
1136872044 16:33816487-33816509 GATGCTGCTCACAACCACCAGGG + Intergenic
1136889911 16:33961961-33961983 GATGCTCCTCAGAACCACCAGGG - Intergenic
1136919102 16:34246322-34246344 GATGCTCCTCACTTCCTAGATGG + Intergenic
1137523076 16:49210659-49210681 GATGCTCCTCACTTCCTAGATGG + Intergenic
1137943544 16:52712726-52712748 CAGCCTCCTCACATCCTTAAAGG + Intergenic
1138307265 16:55989178-55989200 GACCCTCCTCACTTCCTAGATGG - Intergenic
1138642636 16:58397226-58397248 GATGCTCCTCACATCCCAGACGG + Intronic
1139783413 16:69370425-69370447 GATTCCCCGCACATCCTCAAGGG + Intronic
1139963101 16:70729179-70729201 GATGCTGCTGACATCCTACAGGG + Intronic
1141858425 16:86700711-86700733 GCTCTTCCTCTCCTCCTCCATGG + Intergenic
1203083123 16_KI270728v1_random:1161653-1161675 GATGCTCCTCAGAACCACCAGGG + Intergenic
1203100128 16_KI270728v1_random:1299581-1299603 GATGCTGCTCACAACCACCAGGG - Intergenic
1142634337 17:1247467-1247489 GATGCTCCTCACATCCCAGACGG + Intergenic
1142825294 17:2506901-2506923 GATGCTCCTCACATCCCAGACGG - Intronic
1142939944 17:3372240-3372262 GATGCTCCTCACTTCCTAGATGG + Intergenic
1146361142 17:32178613-32178635 GATGCTCCTCACTTCCTAGACGG - Intronic
1146361189 17:32178803-32178825 GATGCTCCTCACTTCCTAGACGG - Intronic
1147736554 17:42642462-42642484 GATCCTCCCCTCATCCTCCTGGG + Intergenic
1147999735 17:44380691-44380713 GATCCTCATCTCATCTTCCCAGG + Intronic
1148135808 17:45290900-45290922 CATCCTCCAAACATCCTCAATGG + Intronic
1149024852 17:52015903-52015925 GATCCTCCCCACATCCAACGTGG - Intronic
1149511481 17:57245223-57245245 TGTCAGCCTCACATCCTCCATGG + Intergenic
1149625148 17:58074593-58074615 GATGCTCCTCACATCCCGGACGG + Intergenic
1151323333 17:73364488-73364510 GATTCTCATCAGATTCTCCAAGG + Intronic
1151378790 17:73710542-73710564 GGTCATGCTCACATCCTCCCTGG - Intergenic
1151968176 17:77443005-77443027 GAAACTACTCACATCTTCCAGGG + Intronic
1152403785 17:80085046-80085068 GAGCCCCCTCAGATCCCCCACGG + Intronic
1154290002 18:13098596-13098618 GATGCTCCTCACTTCCTAGATGG + Intronic
1154436056 18:14342312-14342334 CATCCTTATCACATCCTCCTGGG + Intergenic
1155281288 18:24242509-24242531 GCTCCTCCCCACAGCCCCCAAGG + Intronic
1155917706 18:31572506-31572528 GAACCTCCTCGCCTCCTCTAGGG - Intergenic
1157039835 18:44025170-44025192 GCTCCTCCTCAAATTTTCCAAGG + Intergenic
1157778588 18:50417887-50417909 GATGCTCCTCACTTCCTAGATGG + Intergenic
1157857806 18:51117654-51117676 GATGCTCCTCACTTCCTAGACGG + Intergenic
1158459383 18:57633252-57633274 GATGCTCCTCACATCCCGGACGG + Intergenic
1158486290 18:57868955-57868977 AGTCCTCCTCACATCCTCATGGG - Intergenic
1160702904 19:517249-517271 GATCTCCCTCACCTCCTCCCTGG - Intronic
1160817067 19:1041046-1041068 GATCATCCTCTAATCCTCCAGGG - Intronic
1161624740 19:5319783-5319805 GTTCCTCCTCACCTCCATCAGGG + Intronic
1162278922 19:9679920-9679942 GATGCTCCTCACTTCCTAGATGG - Intergenic
1162299012 19:9833457-9833479 GATGCTGCTAACATCCTTCAAGG - Intergenic
1162538237 19:11276945-11276967 GATGCTCCTCACTTCCTAGACGG + Intergenic
1162683188 19:12362259-12362281 GATGCTCCTCACTTCCTAGACGG - Intronic
1163298815 19:16430146-16430168 GCCCCTGGTCACATCCTCCAGGG - Intronic
1163945560 19:20530684-20530706 GATGCTCCTCACTTCCTAGATGG + Intergenic
1164043242 19:21511493-21511515 GATGCTCCTCACTTCCTAGATGG + Intronic
1164218623 19:23173180-23173202 GATGCTCCTCACATCCCAGACGG - Intergenic
1164256691 19:23533788-23533810 GATGCTCCTCACTTCCTAGACGG + Intronic
1164741735 19:30580839-30580861 GACCCCACTGACATCCTCCATGG + Intronic
1166115109 19:40648625-40648647 GATGCTCCTCACTTCCTAGATGG + Intergenic
1166206334 19:41271986-41272008 GATCCTGCTCACATCTCTCAAGG + Intronic
1167540805 19:50086178-50086200 GATGCTCCTCACTTCCCCGACGG - Intergenic
1167708664 19:51097407-51097429 CACCCTGCTCAGATCCTCCAGGG - Intergenic
1202703858 1_KI270713v1_random:6333-6355 GCCCCACCTCACATCCTCCCAGG - Intergenic
924970902 2:126744-126766 GATGCTCCTCACTTCCTAGATGG - Intergenic
925018961 2:553657-553679 AATCCTCCCCACCTCCTCCTGGG - Intergenic
925018971 2:553687-553709 GACCCTCCCCACCTCCTCCTGGG - Intergenic
925018985 2:553718-553740 GACCCTCCCCACCTCCTCCTGGG - Intergenic
925018998 2:553749-553771 AATCCTCCCCACCTCCTCCTGGG - Intergenic
925728817 2:6901930-6901952 GATCCTTCTCACTTTCTCCTGGG + Intergenic
925844284 2:8021163-8021185 GATCCTCCTGACAGCCTCTCAGG - Intergenic
926322719 2:11760136-11760158 GATGCTCCTCACTTCCTAGACGG + Intronic
927404653 2:22753766-22753788 GTTCTTCCTCACATCCTCCTTGG + Intergenic
927737416 2:25535585-25535607 GATGCTCCTCACTTCCTAGACGG + Intronic
927737575 2:25536160-25536182 GATGCTCCTCACTTCCTAGATGG + Intronic
927737608 2:25536276-25536298 GATGCTGCTCACTTCCTACACGG + Intronic
929238374 2:39628606-39628628 GATGCTCCTCACTTCCTAGATGG + Intergenic
929445151 2:41995471-41995493 GATGCTCCTCACTTCCTAGACGG - Intergenic
929517959 2:42621873-42621895 GATGCTCCTCACTTCCTAGACGG + Intronic
931428258 2:62190387-62190409 ATTCCTCCTCACATCCTGGATGG + Intergenic
932212334 2:69943072-69943094 AATCCTCATCACAGGCTCCAAGG - Intergenic
932710871 2:74061837-74061859 GACGCTCCTCACTTCCTACATGG + Intronic
933757003 2:85647551-85647573 GATCCTCCCCTCAGCCTCCCAGG - Intronic
933814333 2:86053478-86053500 AATCTTCCTAACATCCTCTAAGG + Intronic
934549034 2:95243429-95243451 GATGCTCCTCACTTCCTAGATGG - Intronic
935950509 2:108324350-108324372 GCACCCCCTCACCTCCTCCACGG - Intergenic
936807074 2:116347742-116347764 GGCCCTCCTCACTTCCCCCATGG - Intergenic
937289197 2:120771847-120771869 GGCCCTCCCCACTTCCTCCATGG + Intronic
937318371 2:120946488-120946510 GCTCCTCCTCCCATCCTGAAGGG + Intronic
937734936 2:125277356-125277378 GATGCTCCTCACTTCCTAGATGG + Intergenic
938101554 2:128501166-128501188 GAGCCTCCTCACCCACTCCAGGG - Intergenic
938253375 2:129833520-129833542 GATGCTCCTCACTTCCTAGATGG - Intergenic
940635571 2:156293557-156293579 GATGCTCCTCACCTCCTAGACGG - Intergenic
942144932 2:173017742-173017764 GATCATCTTCATTTCCTCCAAGG - Intronic
942351138 2:175054602-175054624 CATCCTCCTCACATCCTACTTGG + Intergenic
943740071 2:191398682-191398704 GATGCTCCTCACTTCCTAGATGG + Intronic
944669814 2:201985360-201985382 CATTCTCCTCGCATCCTCCCTGG + Intergenic
945164489 2:206928083-206928105 GATAATCCTCAGATTCTCCAAGG + Intergenic
946467760 2:219927616-219927638 GATTCTCCTCATATCATTCAAGG - Intergenic
946538887 2:220661921-220661943 AAGCCTCCTCAGATTCTCCAAGG - Intergenic
948261518 2:236607488-236607510 GATCCTCCCCTCACACTCCATGG + Intergenic
948776279 2:240290494-240290516 GCTCCTGCTCACATGCCCCAGGG - Intergenic
1169108897 20:3019454-3019476 GATGCTCCTCACATCCCGGACGG + Intronic
1169830533 20:9820429-9820451 TCTACTCCTCACCTCCTCCAAGG + Intronic
1170202466 20:13760334-13760356 GATGCTCCTCACTTCCTAGATGG - Intronic
1170520671 20:17181414-17181436 AATAGTCCTCAGATCCTCCAAGG + Intergenic
1170645639 20:18194369-18194391 GATGCTCCTCACTTCCTAGATGG - Intergenic
1170909416 20:20549834-20549856 AACCTTCCTCACAGCCTCCAGGG + Intronic
1172258199 20:33537060-33537082 GATGCTCCTCACTTCCTAGACGG + Intronic
1173664843 20:44756220-44756242 GCTCTTCCCCACCTCCTCCATGG - Exonic
1175050108 20:56147428-56147450 CATTCTCATCACATGCTCCAAGG - Intergenic
1175281450 20:57806719-57806741 GATCCTCTGCCCAGCCTCCAGGG + Intergenic
1175373460 20:58508595-58508617 GGCCCTCCTCAGCTCCTCCAGGG - Intronic
1175815507 20:61881303-61881325 GAGCCTCCTCTCAGACTCCATGG - Intronic
1176088572 20:63309049-63309071 GAGCTTCCTGGCATCCTCCAGGG + Intronic
1177958077 21:27625413-27625435 CACCCTCCTCACCTCCTTCATGG - Intergenic
1179431760 21:41326455-41326477 GATGTGCCTCATATCCTCCAGGG - Intronic
1180079102 21:45478162-45478184 GAGCCTCCTCACACCCACAAGGG - Intronic
1180125051 21:45785076-45785098 GATGCTCCTCACATCCCGGACGG - Intronic
1181301568 22:21884121-21884143 GACGCTCCTCACATCCTGGACGG + Intergenic
1182782249 22:32877503-32877525 GATGCTCCTAATATCCTACAAGG - Intronic
1182976339 22:34626315-34626337 GATGCTCCTCACATCCCAGATGG + Intergenic
1183714342 22:39525047-39525069 GACCCTCCTCACAGCCTCTCAGG - Intergenic
1183923683 22:41189895-41189917 GAACCTTCTCACATCCTCATTGG + Intergenic
949570037 3:5284140-5284162 GATGCTCCTCACTTCCTAGATGG + Intergenic
950944833 3:16934350-16934372 TATGTTCCTCACATTCTCCAGGG - Intronic
952697380 3:36283295-36283317 CATCCACCTCACTGCCTCCACGG + Intergenic
953959466 3:47256299-47256321 GATGCTCCTCACTTCCTAGATGG - Intronic
954147589 3:48641957-48641979 GAGACTCCTCTCCTCCTCCAAGG + Exonic
955626792 3:60927523-60927545 GACGCTCCTCACTTCCTACACGG - Intronic
956817815 3:72924412-72924434 CATACTCCTCACATACTCCTGGG + Intronic
957789284 3:84918842-84918864 GATGCTCCTCACTTCCTGGACGG - Intergenic
958794179 3:98689768-98689790 GACCCTCCTCCCACCCTCCTTGG + Intergenic
959054092 3:101551542-101551564 GATGCTCCTCACTTCCTAGACGG - Intergenic
959893838 3:111584957-111584979 AAGCCTCCTCCTATCCTCCAAGG + Intronic
960073597 3:113458751-113458773 GATGCTCCTCACTTCCTAGACGG - Intronic
960704021 3:120464749-120464771 CATCCTCCCCACATTCTCCCAGG - Intergenic
962791851 3:138818557-138818579 GATCCTTCCCACAGCCTACAAGG + Intronic
966206731 3:177413112-177413134 GATGCTCCTCACTTCCTAGAAGG + Intergenic
967094912 3:186169765-186169787 GCTCCTCCTCAAACCCTCCCAGG + Intronic
967729098 3:192890780-192890802 GATCCTCCTCACATCCTCCATGG + Intronic
968411627 4:395649-395671 GACGCTCCTCACATCCTGGACGG - Intergenic
968432891 4:569098-569120 TGCCCTCCTCCCATCCTCCAGGG - Intergenic
968467023 4:757670-757692 GAACCAACTCACATCCTCCATGG - Intronic
968607114 4:1540756-1540778 TCTCCTCCTCACTTGCTCCAGGG - Intergenic
968634274 4:1669869-1669891 GAACGTCCACACAACCTCCAGGG + Intronic
968852863 4:3094983-3095005 GATGCTCCTCACTTCCTAGATGG + Intronic
970216147 4:13761501-13761523 GATGCTCCTCACTTCCTAGATGG + Intergenic
972541532 4:40043444-40043466 CAACCTCGTCACAGCCTCCATGG - Intergenic
972640977 4:40924614-40924636 GCTCCTCCTCACGTCCTCCAGGG - Intronic
974848569 4:67380598-67380620 GATGCTCCTCACTTCCTAGATGG - Intergenic
975908705 4:79245050-79245072 GATGCTCCTCACTTCCTAGACGG - Intronic
976553630 4:86424944-86424966 GATGCTCCTCAAATCCACCCTGG - Intronic
977542232 4:98330870-98330892 GATGCTCCTCACTTCCTAGATGG + Intronic
978241328 4:106520226-106520248 CATTCTCCTCACCTCTTCCAGGG + Intergenic
978684570 4:111423982-111424004 GATCTTCTTCCCACCCTCCAGGG - Intergenic
980207606 4:129741393-129741415 GAGTCTCCTCACCTCATCCATGG + Intergenic
981635178 4:146869223-146869245 GTTCCTGCTGACATCCTTCATGG - Intronic
981993638 4:150953901-150953923 GATGCTCCTCACTTCCTAGACGG - Intronic
981994787 4:150963724-150963746 GATGCTCCTCACTTCCTAGACGG - Intronic
982709795 4:158747049-158747071 GATGCTCCTCACTTCCTAGACGG + Intergenic
983664506 4:170166543-170166565 GATGCTCCTCACTTCCTAGATGG + Intergenic
984694324 4:182764453-182764475 GATCCTCCTCTGTACCTCCACGG - Intronic
984813766 4:183819001-183819023 GACCCTCCTCACTTCCTAGATGG + Intergenic
985706237 5:1402981-1403003 GGTCATCGCCACATCCTCCATGG - Exonic
985736406 5:1586065-1586087 GATGCTCCTCACATCCCGGACGG - Intergenic
986104559 5:4647504-4647526 GATCCTGCTCCCATCCCCAAGGG + Intergenic
986769040 5:10955347-10955369 GATTCTTCTGACAACCTCCAAGG + Intergenic
986787080 5:11124349-11124371 GAACATCCTTACATCCTCGATGG + Intronic
988544301 5:32142259-32142281 GATGCTCCTCACATCCCGGACGG - Intronic
989656012 5:43746662-43746684 GATGCTCCTCACTTCCTATACGG + Intergenic
990498547 5:56372514-56372536 GATGCTCCTCACTTCCTAGATGG - Intergenic
991597922 5:68323894-68323916 GACGCTCCTCACATCCTGGATGG + Intergenic
991935417 5:71794839-71794861 GATGCTCCTCACTTCCTAGATGG + Intergenic
992289564 5:75270119-75270141 GATGCTCCTCACTTCCTAGATGG - Intergenic
992415865 5:76551311-76551333 GATGCTCCTCACTTCCTAGATGG + Intronic
992442930 5:76812184-76812206 GATGCTCCTCACTTCCTAGATGG - Intergenic
992463857 5:76985354-76985376 GATGCTCCTCACTTCCTAGATGG + Intergenic
995653877 5:114402701-114402723 GATCATTCCCACATCCACCATGG - Intronic
996057645 5:118998914-118998936 GATGCTCCTCACTTCCTAGACGG - Intergenic
997572430 5:134941199-134941221 TATCATCATCAAATCCTCCAAGG - Intronic
997636263 5:135409144-135409166 GATGCTCCTCACTTCCTAGATGG - Intergenic
997636305 5:135409297-135409319 GACGCTCCTCACTTCCTACACGG - Intergenic
997930668 5:138070073-138070095 GACCCTCCTCACTTCCTAGATGG - Intergenic
998204435 5:140148815-140148837 GCTCCTCCTCCCATGGTCCATGG - Intergenic
998686742 5:144535655-144535677 GATTGCCCTCACATCCTGCAGGG + Intergenic
998979970 5:147691291-147691313 TAACCTTCTCACCTCCTCCACGG + Intronic
999099571 5:149012327-149012349 GACTCCCCTCACATCCTCCCAGG + Intronic
999320601 5:150612652-150612674 GATCCTCATCACACCCTATAAGG - Intronic
999604209 5:153297122-153297144 GATGCTCCTCACATCCCAGACGG + Intergenic
999979012 5:156940495-156940517 GATGCTCCTCACTTCCTAGACGG - Intronic
1001924364 5:175625588-175625610 GTTCCTCCCTGCATCCTCCATGG - Intergenic
1002031503 5:176433701-176433723 GATGCTCCTCACTTCCTAGATGG - Intergenic
1003319504 6:5038302-5038324 GATGCTCCTCACTTCCTAGATGG + Intergenic
1005063625 6:21797711-21797733 GATGCTCCTCACATCCCAGACGG + Intergenic
1005069925 6:21852400-21852422 GATGCTCCTCACTTCCTAGATGG + Intergenic
1005360569 6:25027588-25027610 GATGCCCCTCTCATCCCCCAAGG - Intronic
1005852587 6:29832887-29832909 CATCCTTCCCACACCCTCCAGGG - Intergenic
1005946855 6:30601924-30601946 GAGCATCCTCACCTCCTCCATGG + Exonic
1006014209 6:31067468-31067490 GATGCTCCTCACTTCCTAGATGG + Intergenic
1006225285 6:32531966-32531988 GATGCTCCTCACTTCCTAGATGG - Intergenic
1007010291 6:38410365-38410387 GATCCTCCCCTCAGCCTCCCAGG - Intronic
1008280060 6:49586176-49586198 ACTCCACCTCACAACCTCCATGG + Intergenic
1008326751 6:50191613-50191635 GATCCTCCTGACTTTCTCCAGGG - Intergenic
1009049026 6:58257663-58257685 GATGCTCCTCACTTCCTAGACGG - Intergenic
1010691097 6:78911394-78911416 GATCCTTCTCTCCTGCTCCAGGG + Intronic
1011297183 6:85838489-85838511 GACGCTCCTCACTTCCTACATGG - Intergenic
1011928035 6:92672710-92672732 GATCCTCCGCCCAACCACCATGG + Intergenic
1015643721 6:135364232-135364254 GACGCTCCTCACATCCTGGACGG + Intronic
1015927269 6:138322948-138322970 GACACTGGTCACATCCTCCAAGG + Intronic
1016476503 6:144433759-144433781 GATGCTCCTCACTTCCTAGATGG + Intronic
1019723295 7:2586655-2586677 TGTCCTCCTCCCCTCCTCCATGG - Intronic
1021259128 7:18431980-18432002 CTTCCTCCTCACATCCTTCTGGG + Intronic
1021995710 7:26176939-26176961 GATGCTCCTCACTTCCTAGACGG + Intronic
1021995739 7:26177055-26177077 GATGCTCCTCACTTCCTAGACGG + Intronic
1023592466 7:41794561-41794583 GCTCATCCTCACCACCTCCAGGG + Intergenic
1024366076 7:48522022-48522044 GATCCTCCTCCCATCCCACAGGG + Intronic
1024625771 7:51208009-51208031 GATGCTCCTCACTTCCTAGATGG - Intronic
1024910663 7:54444022-54444044 GATGCTCCTCACTTCCTAGATGG - Intergenic
1025262465 7:57427808-57427830 GATGCTGCTCACATCTTGCAAGG - Intergenic
1025573047 7:62600065-62600087 GATGCTCCTCACTTCCTAGATGG + Intergenic
1025739816 7:64185049-64185071 GATGCTGCTCACATCCTGCCAGG - Intronic
1025757699 7:64360378-64360400 GATCCCCCACACATAATCCAGGG - Intergenic
1025821682 7:64968450-64968472 GACGCTCCTCACATCCCACACGG + Intergenic
1025852770 7:65257893-65257915 GATGCTCCTCACTTCCTAGACGG - Intergenic
1027303914 7:76872225-76872247 GATACTCTTCACATGTTCCAGGG - Intergenic
1028548075 7:92026755-92026777 GATGCTCCTCACTTCCTAGACGG - Intronic
1028548105 7:92026871-92026893 GATGCTCCTCACTTCCTAGACGG - Intronic
1028548168 7:92027100-92027122 GATGCTCCTCACTTCCTAGATGG - Intronic
1028595721 7:92545268-92545290 GACCCTCCTCACTTCCTAGACGG + Intergenic
1029279397 7:99426755-99426777 GATGCTCCTCACTTCCTAGATGG - Intronic
1029620851 7:101688925-101688947 GTTCCTCTTCACATCCTTCCAGG + Intergenic
1033013655 7:137649193-137649215 GATGATCCTCCCCTCCTCCATGG - Intronic
1033742368 7:144284801-144284823 GTGGATCCTCACATCCTCCATGG + Intergenic
1033751534 7:144364813-144364835 GTGGATCCTCACATCCTCCATGG - Exonic
1035458105 7:159022758-159022780 GATCCTCCCCAAAGCCTCCTTGG - Intergenic
1035954876 8:4066014-4066036 GCTCCTTCTGACTTCCTCCAAGG - Intronic
1036095947 8:5725298-5725320 GATGCTCCTCACTTCCTAGATGG - Intergenic
1036690336 8:10941029-10941051 GAGCCCCCTCACCTCCTCCCTGG - Intronic
1038821131 8:30952752-30952774 GATCCTAATTACATCCTTCATGG - Intergenic
1039948498 8:42150264-42150286 CCTCCTCCTCACCACCTCCATGG + Intergenic
1040052878 8:43033312-43033334 GATGCTCCTCACTTCCTAGACGG + Intronic
1040093429 8:43419948-43419970 GATGCTCCTCACTTCCTAGATGG + Intergenic
1040616337 8:49041864-49041886 GATGCTCCTCACTTCCTAGACGG + Intergenic
1040785435 8:51158990-51159012 GATGCTCCTCACTTCCTAGATGG - Intergenic
1041015624 8:53590721-53590743 GATCCCCCTCACCTCCACTAAGG + Intergenic
1041201295 8:55453571-55453593 GGTCCTCCTCCCAGCCTTCATGG + Intronic
1041920875 8:63180275-63180297 GATGCTCCTCACATCCCGGACGG + Intronic
1044928808 8:97232513-97232535 GTTTCTCCTCACTTCCTACAAGG - Intergenic
1044944283 8:97376242-97376264 TATCCTCCCCACAACCCCCAAGG + Intergenic
1044969387 8:97604893-97604915 GATGCTCCTCACTTCCTAGACGG - Intergenic
1045021986 8:98052090-98052112 GATGCTCCTCACTTCCTAGACGG + Intergenic
1046599192 8:116297478-116297500 GATGCTCCTCACTTCCTAGATGG - Intergenic
1046703544 8:117426705-117426727 GATGCTCCTCACTTCCTAGAAGG - Intergenic
1047959765 8:130002668-130002690 AAGTCTCCTCACAGCCTCCATGG + Intronic
1048977454 8:139680867-139680889 ACTCCTCCTCACAATCTCCATGG + Intronic
1049121078 8:140738480-140738502 GTTCCTCCTCACCTGCTGCAAGG - Intronic
1049481671 8:142827266-142827288 GATGCTCCTCACTTCCTAGATGG + Intergenic
1049545160 8:143227399-143227421 GCTCATCCTCACATCCTCCCAGG - Intergenic
1050417598 9:5433192-5433214 GATGCTCCTCACTTCCTAGACGG - Intronic
1051911326 9:22155532-22155554 GACGCTGCTCACATCCTGCACGG - Intergenic
1054462709 9:65474225-65474247 GGTCCTCTTCCCTTCCTCCACGG - Intergenic
1055197875 9:73618678-73618700 GCTCCTTCTCACATACTCAAAGG + Intergenic
1056702972 9:88925989-88926011 GATGCCCCTCACACCCTGCAGGG + Intergenic
1057630544 9:96715973-96715995 GATGCTCCTCACTTCCTAGACGG + Intergenic
1057674897 9:97130744-97130766 GATGCTCCTCACTTCCTAGATGG + Intergenic
1058244276 9:102603843-102603865 GATGCTCCTCACTTCCTAGATGG + Intergenic
1058800171 9:108538006-108538028 CCTCCTCAGCACATCCTCCAGGG + Intergenic
1058868939 9:109186026-109186048 GCCACTCCTCACTTCCTCCATGG - Intronic
1059237127 9:112770520-112770542 CATTCCCCTCAAATCCTCCATGG + Intronic
1060369706 9:123057469-123057491 GATGCTCCTCACTTCCTAGATGG + Intronic
1060688237 9:125631822-125631844 TAACCTCCTCCCATCCTTCAAGG + Intronic
1060920874 9:127419497-127419519 GCTCCTCCTCCCAGCCTCCTTGG + Intergenic
1061284666 9:129615311-129615333 GGTCAACCTGACATCCTCCAAGG + Intronic
1062545631 9:137062626-137062648 GACGCTGCTCACATCCTGCACGG + Exonic
1186871940 X:13782055-13782077 CATCTTCCTCACACCCTCCAAGG + Intronic
1187231926 X:17431597-17431619 CACACTCCTCACATTCTCCATGG - Intronic
1187929344 X:24279687-24279709 GTTCATCCTCACACCCTCCTGGG - Intergenic
1188086367 X:25905795-25905817 GATGCTCCTCACTTCCTAGACGG - Intergenic
1189210157 X:39277468-39277490 GATGCTCCTCACTTCCTAGATGG - Intergenic
1190174666 X:48138992-48139014 GACCCTCCTCACTTCCTAGACGG - Intergenic
1190778917 X:53578101-53578123 GATGCTCCTCACTTCCTAGATGG - Intronic
1192324779 X:70122982-70123004 GATGCTCCTCACTTCCTAGATGG - Intergenic
1192350099 X:70349589-70349611 GATGCTCCTCACATCCCAGACGG + Intronic
1192350154 X:70349786-70349808 GATGCTCCTCACATCCCAGACGG + Intronic
1193068019 X:77279279-77279301 GACCCTCCTCACTTCCTAGATGG - Intergenic
1193164673 X:78265856-78265878 GATGCTCCTCACTTCCTAGATGG + Intergenic
1193328939 X:80215039-80215061 GATGCTCCTCACTTCCTAGACGG - Intergenic
1193345310 X:80397346-80397368 GATGCTCCTCACTTCCTAGATGG + Intronic
1193372311 X:80712764-80712786 GATGCTCCTCACATCCCAGACGG - Intronic
1195257592 X:103104736-103104758 GATGCTCCTCACTTCCTATATGG + Intergenic
1195979004 X:110558603-110558625 GATGCTCCTCACATCCCAGATGG + Intergenic
1197452868 X:126641217-126641239 GGTGCTCCTCACTTCCTCGATGG - Intergenic
1199880005 X:151966563-151966585 GATCCTCATGACAGCCTGCATGG - Intronic
1200898795 Y:8406306-8406328 AATCCTCCCCACATAATCCAGGG + Intergenic