ID: 967729745

View in Genome Browser
Species Human (GRCh38)
Location 3:192896354-192896376
Sequence CAAAAAAAGGCGAAGGACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967729745_967729748 -9 Left 967729745 3:192896354-192896376 CCAGCGTCCTTCGCCTTTTTTTG 0: 1
1: 0
2: 0
3: 7
4: 144
Right 967729748 3:192896368-192896390 CTTTTTTTGTTTCAGAGATGAGG 0: 1
1: 8
2: 171
3: 2144
4: 10407

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967729745 Original CRISPR CAAAAAAAGGCGAAGGACGC TGG (reversed) Intronic
900786284 1:4652820-4652842 CATTAAGAGGCGAAGGAGGCAGG - Intergenic
901330342 1:8402895-8402917 CAAAAAAAAGCGAAAGAAACTGG - Intronic
901597258 1:10395603-10395625 AAAAAAAAGGCCAAGCACGGTGG - Intergenic
903309152 1:22439164-22439186 TAAAAATAGGCAAAAGACGCAGG - Intergenic
903843567 1:26262500-26262522 CAAAAAAAGGCGGGGGGCGGGGG + Intronic
905050647 1:35048052-35048074 CAAAAAAAGGCCAGGCACGGTGG + Intergenic
905409155 1:37756340-37756362 CAAAAATAGGGGAAGAATGCTGG + Intronic
906431847 1:45761562-45761584 CAAAAAAAGGCTGAGCACGGTGG - Intergenic
914726095 1:150328977-150328999 CACAATAAGGCGAGGCACGCTGG - Intronic
921986535 1:221318580-221318602 CATAAAAAGGCCAAAGAGGCTGG - Intergenic
923245841 1:232131193-232131215 CAAAAAAAGGGGATGCAGGCAGG - Intergenic
1065058962 10:21877400-21877422 CAAAAAAAGGCCAAGCACAATGG + Intronic
1069078450 10:64063325-64063347 AAAAAAAAGGGGAAGGAAGGAGG - Intergenic
1069531353 10:69221932-69221954 AAAAAAAAGGCCAAGGATGGTGG + Intronic
1070600916 10:77865714-77865736 CAACAACAGGCGCAGGAAGCGGG + Intronic
1071230121 10:83576639-83576661 TAAAAAATGGCAAAGGAGGCTGG - Intergenic
1071952758 10:90723746-90723768 CAAAAAAATGTGCAGGAAGCTGG - Intergenic
1073254600 10:102142699-102142721 CAAAAACAGGCCAAGGGCGGTGG - Intronic
1073780306 10:106830905-106830927 CAAAAAAAGGCCAGGCACACTGG + Intronic
1075708417 10:124517106-124517128 CAAAAAAAGATGAAGGAGCCCGG + Intronic
1077344343 11:2039463-2039485 CAGGCAAAGGCGAAGGCCGCAGG - Intergenic
1078106761 11:8362777-8362799 GAAAAAAAGGAGAAGGAAGCTGG - Intergenic
1078615907 11:12865979-12866001 AAAAAAAAGTCGAAGGACTTTGG - Intronic
1081842512 11:46213297-46213319 TAAAAAAAGGAGAAGGACAGAGG - Intergenic
1083768504 11:64853690-64853712 CAAAAAAAGACCAAGGTGGCTGG + Exonic
1084308145 11:68299868-68299890 CAAAAAAAGGCGGAGCGCGATGG - Intergenic
1085859205 11:80212309-80212331 AAAAAAAAGGCAAAGGACTGAGG - Intergenic
1086898439 11:92339767-92339789 CAAAAAAAGGCCAGTGTCGCTGG + Intergenic
1087973739 11:104517890-104517912 AAAAAAAAGGAGTAGGAAGCAGG - Intergenic
1088330918 11:108650541-108650563 AAAAAAAAGGAGCAGGAGGCAGG + Intergenic
1090395646 11:126416394-126416416 CAGAAAAAGGCGACAGAGGCTGG - Intronic
1202827329 11_KI270721v1_random:94652-94674 CAGGCAAAGGCGAAGGCCGCAGG - Intergenic
1091751852 12:3027260-3027282 CAAAGAAAGGAGCAGGAGGCTGG - Intronic
1092883379 12:12905270-12905292 CAAAACAAGAGGAAGGACTCGGG - Intronic
1096371039 12:51069269-51069291 AAAAGAAAGGAGAAGGAAGCCGG - Intronic
1100979292 12:100152247-100152269 CACAAAAAGGCTAAGGATGCTGG - Intergenic
1101361344 12:104030713-104030735 TAAAAATAGGCAAAGGACTCCGG + Intronic
1101990077 12:109477260-109477282 CATGAAAAGTCGGAGGACGCAGG + Exonic
1102095509 12:110237433-110237455 TAAAAGTAGGCGAAGGAGGCTGG - Intergenic
1103107808 12:118246078-118246100 CAACAAATGGCGGATGACGCCGG + Intronic
1103473726 12:121202584-121202606 CAAAAAAACGAAAAGGACGTTGG + Intergenic
1110552816 13:76827616-76827638 AAAAAAAAGGGAAAGGATGCTGG - Intergenic
1112187598 13:97142911-97142933 CAAAAAAATGAGAAGGTAGCAGG + Intergenic
1112617447 13:101019744-101019766 CAAAAATAGGCGACGGACGATGG - Intergenic
1114411483 14:22504684-22504706 CAAAAAAAGAAGAAGGAAGCTGG + Intergenic
1114754118 14:25239817-25239839 CATAAAAAGGCCAAGGGGGCTGG + Intergenic
1123821133 15:24031522-24031544 CAGAAAAAGGAAAAGGACTCAGG + Intergenic
1127750150 15:62029953-62029975 ACAAAAAAGGCAAAGGACCCAGG + Intronic
1129754513 15:78089081-78089103 CACAAAAAGGCTAAGGATGCTGG - Intronic
1131102859 15:89707263-89707285 CAAAAATAGGCCAGGCACGCTGG + Intronic
1135731303 16:24897248-24897270 CTTAAAAAGGCAAAGGAGGCTGG - Intronic
1139334444 16:66221391-66221413 CAAAGAAAGGCGAGGCACCCAGG + Intergenic
1139568436 16:67794965-67794987 CAAAAAAAGGCCAAGTACAGTGG + Intronic
1140580320 16:76223759-76223781 CATAGAAAGGGGAAGGACTCTGG - Intergenic
1141457916 16:84156494-84156516 CAACAAAAGGAGAAGCAAGCAGG - Intronic
1142052492 16:87967906-87967928 CAAAAAAAGGCCAGGCACGGTGG - Intronic
1143982286 17:10880328-10880350 CAAAAAAGGCTGAAGGATGCTGG + Intergenic
1144306104 17:13970843-13970865 AAAAAAAAGGGAAAGGACTCAGG - Intergenic
1147709428 17:42451782-42451804 CAAAAATAGGCCAAGGACAGTGG + Intergenic
1148097824 17:45066006-45066028 GAAAAAAAGGGGCAGGAGGCTGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1151949213 17:77340114-77340136 CAAAAAAGGGCCAAGCACGGTGG - Intronic
1152426534 17:80221176-80221198 GAAAAAAAGGCAAAGGAAGTCGG + Intronic
1152711936 17:81875717-81875739 CAAAAAAAGGCCAAGTGCGGTGG + Intergenic
1154242868 18:12668293-12668315 CAAAAAAAGTGGATGGAGGCTGG + Intronic
1160146127 18:76366496-76366518 CAAAACAAAGAGAAGCACGCTGG + Intronic
1161187008 19:2927795-2927817 AAAATAGAGGCCAAGGACGCTGG + Intergenic
1163602320 19:18256604-18256626 CAAAAAAAGGCCAGGCACGGTGG - Intergenic
1164370375 19:27638251-27638273 CAAAAACTGGGGAAGGCCGCAGG - Intergenic
1164631764 19:29766507-29766529 CAAAAAAAGAAGAAGGAAGAAGG - Intergenic
1166875890 19:45897054-45897076 AAAAAAAAGGCCATGGACTCTGG - Intronic
926229094 2:10989383-10989405 GAAACAAAGGAGAAGGACCCCGG - Intergenic
929204844 2:39279014-39279036 CAAAAAAATGGAAAGGACGATGG - Intronic
935451465 2:103214423-103214445 CCAAAAAAGAAGAAGGATGCTGG - Intergenic
937301420 2:120844974-120844996 GAAAAAAAGGAGAAAGAAGCTGG + Intronic
937413278 2:121694982-121695004 CAGAAAAAGGCCAGGGACTCTGG + Intergenic
940332468 2:152490178-152490200 CAAAAAAAGGGGAAAGAGGAGGG + Intronic
943100466 2:183479853-183479875 CAAACACAGGGGAAGGCCGCAGG + Intergenic
943308127 2:186292529-186292551 CAAAAAAAGAAAAAGGATGCAGG + Intergenic
943577136 2:189643072-189643094 AAAAAAAAGGAGAAGGAGGGAGG - Intergenic
947780207 2:232753409-232753431 CAAAAAATGGCCAAGGATGGTGG - Intronic
1169211677 20:3769165-3769187 CAGAAAGAGGCGGAGGAGGCAGG - Intergenic
1172437327 20:34938621-34938643 CAAAAAGAGGCGGAGGAGGAAGG + Intronic
1174873824 20:54207437-54207459 CCAAAAACGGGGAAGGAGGCAGG + Intergenic
1176721412 21:10396801-10396823 AAAAAAAAGGAGAAGAAGGCTGG + Intergenic
1177159296 21:17530259-17530281 GAAAAAAGGGTGAAGGAGGCCGG - Intronic
1178321950 21:31612676-31612698 CAAAAGAAGGGGAACGAGGCAGG - Intergenic
1182146923 22:28002214-28002236 CAGAACAAGGCTAAGGGCGCGGG + Intronic
1182745352 22:32601571-32601593 TAAAAAATGGCAAAGGAGGCTGG - Intronic
1184485273 22:44774807-44774829 CAAAAAAAGGCCAGGCACGGTGG - Intronic
953243629 3:41171039-41171061 AAAAAAAAGGCCAAGGAAACAGG + Intergenic
953604746 3:44404433-44404455 CAGAAAAAGGCTAAGGAAGCAGG - Intronic
953833220 3:46320949-46320971 TAAAAAATGGCAAAGGAGGCCGG + Intergenic
959275109 3:104268908-104268930 CAAAGAAAGGCGAAGAACAATGG - Intergenic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
961235443 3:125362528-125362550 CAAAAAAAGGGTAAGGACTTTGG - Intronic
962772640 3:138627466-138627488 CAAAAAAAGGCCAGGCACGGTGG - Intronic
963861008 3:150310287-150310309 CAAAAAATGGCCAAGTACGGTGG - Intergenic
964589461 3:158343978-158344000 CAAAAAAAGATGAATGAGGCTGG + Intronic
967179714 3:186893504-186893526 CAAAAACTGCCGAAGGCCGCAGG + Intergenic
967729745 3:192896354-192896376 CAAAAAAAGGCGAAGGACGCTGG - Intronic
967937478 3:194740417-194740439 CAAAAAAAGCAGAGGGACGTGGG - Intergenic
968186375 3:196635710-196635732 CAAAGAAAGGAGGAGGAGGCCGG - Intergenic
969289925 4:6232120-6232142 CCAAATAAGGAGAAGGCCGCAGG - Intergenic
973785458 4:54328602-54328624 CAAGAAAAGGCAAATGACCCTGG + Intergenic
974463760 4:62226042-62226064 CAAAAAAAAGAGGAGGACGAAGG - Intergenic
975735549 4:77377431-77377453 GAAAAGAAGGACAAGGACGCTGG - Intronic
980774108 4:137417013-137417035 CAAAAAAGTGCGTAGGAGGCTGG + Intergenic
980912564 4:139006891-139006913 CAAAAAAAGGAGGAGGATGGGGG - Intergenic
984324371 4:178233270-178233292 AAAAAAAAAGCGAAGGGGGCAGG + Intergenic
984443455 4:179803552-179803574 CAAAAAGAGGCTAATGACGTGGG + Intergenic
984599195 4:181706654-181706676 AACAAACAGGCGAAGGAAGCTGG + Intergenic
987047919 5:14124828-14124850 AAAAAAATGGAGAAGGAGGCCGG + Intergenic
988785119 5:34559731-34559753 CAAAAAAAAGCAAAAGAAGCTGG - Intergenic
990779012 5:59337107-59337129 CAAAAAGAGGAGAAGGATGAAGG + Intronic
991909885 5:71551253-71551275 CAAAAACAGCGGAAGGCCGCAGG - Intronic
993092062 5:83438319-83438341 CAAACACAGCCGAAGGCCGCAGG + Intergenic
993649493 5:90501917-90501939 CCCAAAAAGGCAAAAGACGCAGG + Exonic
994357502 5:98810436-98810458 CAAAGAAAGTCGCAGGAGGCTGG + Intergenic
996013417 5:118505446-118505468 AAAAAAAAAGAGAAGGACTCAGG - Intergenic
997319304 5:132964102-132964124 AGCAAAAAGGCAAAGGACGCAGG + Intergenic
998145779 5:139727391-139727413 CAAAAAAAGGCTAGGCACGGTGG - Intergenic
1003009114 6:2409787-2409809 CAAAAAATGGCCAAGTACGGTGG - Intergenic
1005478785 6:26234851-26234873 AAGAAAAAGGCGAAGAAGGCAGG - Exonic
1011443267 6:87409507-87409529 AAAAAAAAGGCTAAGCAGGCTGG - Intronic
1017288449 6:152706054-152706076 CTAAAAAAAGAGAAGGACCCTGG + Intronic
1017757920 6:157545378-157545400 AAAAAAAAGGAGGAGGAGGCCGG + Intronic
1017804198 6:157929209-157929231 CAAACAAAGGAGAAGGAGGGAGG - Intronic
1019741135 7:2674670-2674692 CAACAGAAGTCGGAGGACGCTGG - Intergenic
1022834079 7:34097178-34097200 CAAAAAGAGGAGCAGGAGGCTGG + Intronic
1026937770 7:74268798-74268820 CAAAAAAAGGCCAGGCACGGTGG + Intergenic
1027505229 7:79009006-79009028 AAAAAAAAGGAGAAGGAAGAGGG - Intronic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1033190938 7:139278473-139278495 AAAAAAAGGGAGAAGGAGGCTGG - Intronic
1036409563 8:8486679-8486701 CAAGAAAAGAAGAAGGACGATGG - Intergenic
1037344634 8:17885779-17885801 CAAAAACAGAGGAAGGACTCTGG + Intronic
1040506815 8:48056561-48056583 CAAAAAAAGGAAAAGGAGACAGG + Intronic
1041333835 8:56757671-56757693 CACAAAAAGGGGAAGGAGTCAGG + Intergenic
1047187220 8:122644888-122644910 CAATAAAAGGCCCAGGAGGCAGG + Intergenic
1048085819 8:131178332-131178354 TAAAAAAAGTAGAAGGAGGCTGG + Intergenic
1050683883 9:8145621-8145643 CAAAGAAAGGCAAAGGACCGAGG - Intergenic
1053485010 9:38445794-38445816 CAAAAAAAGCAGAAGGATGTGGG + Intergenic
1059014820 9:110504415-110504437 GAAGAAAAGGAGAAGGAAGCAGG - Intronic
1061375763 9:130223370-130223392 AAAAAAAAGGCTAAGGACTCTGG - Intronic
1062706436 9:137946608-137946630 AAAAAAAAGGGAAAGGACTCAGG + Intronic
1190161740 X:48036735-48036757 CAAAAAAAGGCCAGGCACGGTGG + Intronic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1192474600 X:71429277-71429299 AAAAAAAAGCAGAAGGAAGCAGG + Intronic
1197257861 X:124283384-124283406 AAAAAAAGGGCAAAGGAGGCCGG - Intronic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1202029094 Y:20553108-20553130 CAAACACAGCCGAAGGCCGCAGG + Intergenic