ID: 967730653

View in Genome Browser
Species Human (GRCh38)
Location 3:192903839-192903861
Sequence AATGCAGGAGCAAGCAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 509
Summary {0: 1, 1: 0, 2: 1, 3: 53, 4: 454}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967730653_967730658 22 Left 967730653 3:192903839-192903861 CCACTTTTGCTTGCTCCTGCATT 0: 1
1: 0
2: 1
3: 53
4: 454
Right 967730658 3:192903884-192903906 CATTTTACTTCCATCATGACTGG 0: 1
1: 0
2: 0
3: 17
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967730653 Original CRISPR AATGCAGGAGCAAGCAAAAG TGG (reversed) Intronic
901136833 1:7002797-7002819 AATGCAGGTTCTATCAAAAGAGG + Intronic
903019509 1:20384258-20384280 AAGGCAGGAGAAAGGAAAAAGGG - Intergenic
903059688 1:20661296-20661318 AGGGCAGCAGCAACCAAAAGAGG + Exonic
904994443 1:34620403-34620425 CATGCAAGATCAATCAAAAGAGG + Intergenic
906371442 1:45257327-45257349 AAAGCAGGAGCAAGAAAGAGAGG - Intronic
906504915 1:46371794-46371816 AAAGCAGGAGCAAGCAAGTGGGG + Intergenic
907757629 1:57326317-57326339 AAGACAGCAGGAAGCAAAAGAGG + Intronic
908190381 1:61697326-61697348 AAAGAAGGAGAAAGGAAAAGAGG - Intronic
908812767 1:68000816-68000838 AAAGCATGAGCAAGAAAGAGAGG - Intergenic
909104888 1:71394769-71394791 AAAGCAGGAGCAGGCAAGATAGG - Intergenic
909133571 1:71768915-71768937 AATGCTGGAGCAGGAGAAAGGGG - Intronic
909193697 1:72588408-72588430 AAGGCAGGAGGAAGGGAAAGAGG + Intergenic
909900380 1:81127341-81127363 AATGCATTAGAAAGCAAAAAAGG - Intergenic
910118933 1:83762555-83762577 AATGCAGAAGCAAGTAAATTAGG - Intergenic
910304579 1:85748418-85748440 AATCTAGGAGACAGCAAAAGTGG + Intronic
910738112 1:90484647-90484669 AAAGCAGGAGCAAGAGAGAGTGG - Intergenic
911406929 1:97452734-97452756 AAATCAGGAGCAAGAGAAAGAGG - Intronic
911538600 1:99130627-99130649 ATTGGAGGAGCTAGCAAAAATGG - Intergenic
912021714 1:105114394-105114416 ACTGCAGAAGCCATCAAAAGGGG + Intergenic
912471335 1:109909135-109909157 AAGGAAGGAGCAAGTAAAACTGG + Intergenic
913216032 1:116621131-116621153 AAAGCAGGAGCAAGAGAGAGAGG - Intronic
915694278 1:157723075-157723097 AGAGCAGGAACAAGAAAAAGAGG + Intergenic
915888050 1:159744590-159744612 AGTGCAGAAGTAAGGAAAAGAGG + Intergenic
917391116 1:174538239-174538261 AAAGCAGGAGAAAGCCTAAGAGG - Intronic
917617552 1:176761621-176761643 AATTCAGGAGCTAGCAGCAGAGG - Intronic
917956123 1:180100788-180100810 AAATGAGGAGGAAGCAAAAGTGG + Intronic
918049050 1:180958678-180958700 AAATGAGGAGGAAGCAAAAGTGG + Intergenic
918049338 1:180960602-180960624 AAATGAGGAGGAAGCAAAAGTGG + Intergenic
918231321 1:182535391-182535413 AAAACAGAAGCAATCAAAAGAGG + Intronic
918331496 1:183465404-183465426 AATACAAGAGTAAGCAAAATAGG + Intergenic
919362376 1:196611262-196611284 AAATGAGGAGCATGCAAAAGCGG - Intergenic
919530613 1:198714651-198714673 GATGAAGGAGAAAACAAAAGCGG - Intronic
921133469 1:212239438-212239460 AGGGCAGGAGCAGGCAACAGTGG - Intergenic
921443934 1:215222029-215222051 AAAGCAGGAGCAAGAGAGAGTGG + Intronic
922401275 1:225259356-225259378 AATGCAGAATCATTCAAAAGAGG + Intronic
922639911 1:227219342-227219364 AAGGCTGGAGCAGGCAGAAGCGG + Intronic
922689369 1:227675832-227675854 AATGCAGCTGAAAGCCAAAGTGG + Intronic
924591981 1:245412947-245412969 AATACAGGTGGCAGCAAAAGGGG - Intronic
1063661690 10:8038510-8038532 AATGCAGGGGGAAACAAAAGGGG + Intergenic
1063845829 10:10125811-10125833 AAAGGAAGAGGAAGCAAAAGCGG + Intergenic
1063935750 10:11076313-11076335 AATTCAGCAGCAAGCAAAAAGGG + Intronic
1064214799 10:13391336-13391358 AAAGCAGGAGCCAGCGAAGGGGG - Intergenic
1064418491 10:15169758-15169780 AATGCAGTAGCAAATAAGAGAGG - Intergenic
1064716980 10:18186609-18186631 AGAGCAGGAGCAAGCAAGAGAGG + Intronic
1065057447 10:21861310-21861332 AATCCAAAAGAAAGCAAAAGAGG + Intronic
1065113706 10:22464195-22464217 AAGGAAGGAGAAAGGAAAAGGGG + Intergenic
1065180642 10:23121306-23121328 AAAGCAGGAGCAAGAGAGAGTGG + Exonic
1065997603 10:31073778-31073800 AACGAAGGAGCTAGCAAAATAGG + Intergenic
1067719908 10:48720291-48720313 AATGCAGGAGGAGGGAAGAGGGG + Intronic
1067911598 10:50351640-50351662 AAATGAGGAGCAAGCAAAAATGG - Intronic
1068152400 10:53149918-53149940 ATTTCAGGAGCAAGAAAATGAGG - Intergenic
1068364798 10:56033680-56033702 AAATGAGGAGGAAGCAAAAGTGG - Intergenic
1068461349 10:57333645-57333667 AGAGCAGGAGCAAGCTAGAGAGG - Intergenic
1069524112 10:69152586-69152608 AATCAAGGAACAAGAAAAAGAGG - Intronic
1070407566 10:76110681-76110703 AAATGAGGAGGAAGCAAAAGTGG - Intronic
1070634803 10:78116713-78116735 CATGGAGGAGCAGGCAGAAGGGG + Intergenic
1070853065 10:79583524-79583546 AATGCAGAAGAAATAAAAAGGGG + Intergenic
1070888021 10:79921785-79921807 AATGCAGAAGAAATAAAAAGGGG - Intergenic
1071028733 10:81146351-81146373 AAGGCAGGAGCAAGAGAGAGAGG - Intergenic
1071033402 10:81212778-81212800 AATGCAGTATTAAGCAAAGGAGG - Intergenic
1071531237 10:86391671-86391693 AATCCAGGAGCAAACTGAAGAGG + Intergenic
1072039577 10:91594281-91594303 AATATAGGAGGAAGCAATAGGGG - Intergenic
1072972296 10:100027905-100027927 AAAGCAGGAGCAAGAGAGAGTGG + Intergenic
1073153588 10:101328753-101328775 AAATGAGGAGGAAGCAAAAGTGG - Intergenic
1073169548 10:101492261-101492283 AATGTGGGAGCAAGCCAAAAGGG + Intronic
1074991497 10:118712554-118712576 AGTGGAGGAGCAAGACAAAGAGG + Intronic
1075194867 10:120347809-120347831 GATACAGCAGCAAGCAAAACTGG + Intergenic
1075431670 10:122388837-122388859 TATGGATGAGCAAACAAAAGTGG - Intronic
1075815522 10:125261727-125261749 AATGAGAGACCAAGCAAAAGGGG - Intergenic
1077547345 11:3180233-3180255 AAATGAGGAGGAAGCAAAAGTGG + Intergenic
1077575635 11:3380945-3380967 AAATGAGGAGAAAGCAAAAGTGG - Intergenic
1077729029 11:4708557-4708579 CATGCATGAGTAAGTAAAAGGGG + Intronic
1078319648 11:10322736-10322758 AATGTAGGGGCAAAAAAAAGTGG - Intronic
1078916571 11:15783959-15783981 AATGCAGGCTCAGGCAGAAGAGG + Intergenic
1079077167 11:17391109-17391131 AGTGCAGGATGGAGCAAAAGGGG - Intergenic
1079270074 11:18976261-18976283 AAAGCAGGAGCAAGAGAGAGAGG + Intergenic
1079546975 11:21644148-21644170 AATGATGGAGGAAGCAAAGGAGG - Intergenic
1079737156 11:24011808-24011830 AAAGCAGGAGCAAGAGAGAGTGG - Intergenic
1079915882 11:26367840-26367862 AAAGCAGGAGCAAAATAAAGTGG + Intronic
1080196889 11:29621837-29621859 AGAGCAGGAGCAAGCAAGAGAGG + Intergenic
1081662887 11:44899166-44899188 AATGCAGGAGTCAGCATCAGAGG - Intronic
1081939297 11:46927296-46927318 AAATGAGGAGGAAGCAAAAGCGG - Intergenic
1082101319 11:48175658-48175680 AGGGCAGGAGCAAGAAAGAGAGG + Intergenic
1082877533 11:58003195-58003217 AAGGCAGGAGGAAGGAAATGAGG + Intergenic
1083012906 11:59421184-59421206 AAAGCAGGAGCAAGAGAGAGAGG + Intergenic
1084435643 11:69137745-69137767 CATCAAGGAGCAAGCAGAAGTGG + Intergenic
1086721700 11:90128924-90128946 AAATGAGGAGGAAGCAAAAGCGG + Intergenic
1087283800 11:96242734-96242756 AAAGCAGGAGCATGATAAAGGGG + Intronic
1087466451 11:98512824-98512846 AATGCAAGTGTAAGGAAAAGGGG - Intergenic
1087835012 11:102864481-102864503 AAAGCAGGACCAAGCACTAGAGG - Intronic
1088325466 11:108596291-108596313 GATGCAGGAGAAAGGGAAAGAGG + Intergenic
1088342431 11:108783806-108783828 AATGCGGGAGAGAGGAAAAGGGG - Intronic
1089149469 11:116353812-116353834 AGTGAAGGAGCAAGGAAGAGGGG - Intergenic
1089388998 11:118087181-118087203 AAAGCAGGGGCACACAAAAGAGG - Intronic
1090544541 11:127748340-127748362 AAAGCAGAAGCAAGAAAAAGTGG + Intergenic
1090599243 11:128353346-128353368 AAAGCAGGAGAGAGCAAGAGGGG - Intergenic
1091506892 12:1080670-1080692 AAATCAGGAAGAAGCAAAAGCGG - Intronic
1092006234 12:5072779-5072801 AAAGCAGGAGAAAGAAACAGAGG + Intergenic
1092014095 12:5142631-5142653 AAAGCAGGAGCAAGAAAGACAGG + Intergenic
1092103059 12:5902014-5902036 ACTGCATGAGCGAGCAAAAGAGG + Intronic
1093023994 12:14230064-14230086 AAAGCAGGAGCAAGAGAAGGTGG - Intergenic
1093943657 12:25083366-25083388 GGGGCAGGAGCAAGTAAAAGAGG - Intronic
1094065888 12:26360252-26360274 AATGAAGGAGGAAGCGAGAGAGG - Intronic
1094128145 12:27045333-27045355 AGAGCAGGAGCAAGAAAATGAGG + Intronic
1095101456 12:38189284-38189306 AAAGCAGGAGCAAAAAACAGGGG - Intergenic
1095267499 12:40177234-40177256 GATGCAGAAAGAAGCAAAAGAGG + Intergenic
1095781686 12:46067139-46067161 AAAGCAGGAGCCAGCAAATGAGG + Intergenic
1096905279 12:54929978-54930000 AATGGAGGAGCAAGGAAAAAAGG + Intergenic
1096915783 12:55031304-55031326 AATGCTGGAGCCAGCGAAAGTGG + Intergenic
1096928500 12:55176217-55176239 AAGGCACAAGCAAGCAAAAGTGG + Intergenic
1097125591 12:56771944-56771966 AAAGCAAAAGCAAGCAAGAGAGG - Intronic
1098034268 12:66286487-66286509 AATGCTGTAGGAAGCAAAATTGG + Intergenic
1099360622 12:81695416-81695438 AAAGTAGGAGCAAGCAAGAGGGG - Intronic
1099439542 12:82684657-82684679 CATGCAGGAGGAAGAGAAAGTGG + Intergenic
1099507913 12:83501177-83501199 AAATGAGGAGAAAGCAAAAGGGG - Intergenic
1100170470 12:91969847-91969869 AGAGCAGGAGCAAGAGAAAGAGG + Intergenic
1100899990 12:99227248-99227270 AATGTAGGAGCAAGCGAGAGAGG - Intronic
1101402095 12:104397343-104397365 AATACAGCAGCAAACAAAACAGG + Intergenic
1102448436 12:113022244-113022266 AAAGCAGGAGCAAGAGAATGAGG + Intergenic
1102523336 12:113493091-113493113 AAATGAGGAGGAAGCAAAAGTGG - Intergenic
1102615631 12:114151746-114151768 AATTGAGAGGCAAGCAAAAGGGG - Intergenic
1105513732 13:21073020-21073042 AATTCAGGAAAAAGCAAAGGGGG - Intergenic
1106766302 13:32917126-32917148 AATGACAAAGCAAGCAAAAGGGG - Intergenic
1107605941 13:42056868-42056890 AAGGCAGGAGCAGGAAGAAGGGG - Intronic
1107653540 13:42569032-42569054 AACCCAGGGGCCAGCAAAAGTGG + Intronic
1108841463 13:54621825-54621847 AAAGCAGGAGCAATGAAAAAAGG - Intergenic
1109176553 13:59164981-59165003 AAAGTAGAAGCAAGGAAAAGTGG - Intergenic
1110302571 13:73946218-73946240 AAGGAAGGCCCAAGCAAAAGAGG + Intronic
1110380180 13:74841363-74841385 AATGCTGGAGCAAGGGAAATGGG - Intergenic
1110960313 13:81613831-81613853 AATGCAGGATCCAGCAAAGAAGG - Intergenic
1111937415 13:94571234-94571256 AAAGCAGGAGCAAGAGAGAGAGG + Intergenic
1111937740 13:94573695-94573717 AAAGAAGGAGGAAGCAAAATTGG - Intergenic
1111972326 13:94929770-94929792 AAATGAGGAACAAGCAAAAGTGG + Intergenic
1112523539 13:100120683-100120705 AGGGCAGGAGAAAGCAAAATGGG + Intronic
1112975778 13:105315295-105315317 AAATGAGGAGGAAGCAAAAGTGG - Intergenic
1113811538 13:113145733-113145755 AATGAGAGAACAAGCAAAAGGGG + Intronic
1115069720 14:29306297-29306319 AATGAAGAACCAAGCGAAAGGGG - Intergenic
1115116198 14:29883123-29883145 AAAGCAGGAGCAAGAGAGAGTGG + Intronic
1115879139 14:37895142-37895164 AAGGAAGCAGCAAGAAAAAGGGG - Intronic
1116262739 14:42652664-42652686 ACTGTAGGAGACAGCAAAAGAGG - Intergenic
1116755371 14:48941419-48941441 AAGGAAGGAGCAAGAAAAAAAGG - Intergenic
1117262608 14:54051772-54051794 GATGCAGGAGGAAGCCAATGTGG + Intergenic
1117873753 14:60228096-60228118 AATCCAGCAGCATGCAAAAATGG - Intergenic
1118282089 14:64438684-64438706 AATGCAGGAGCCATCAAATCAGG - Intronic
1118559041 14:67057647-67057669 AAAGAAGGAGAAAGAAAAAGAGG - Intronic
1118907585 14:70033781-70033803 AATGCAGGGGAAGGCAGAAGAGG - Intergenic
1119103354 14:71900903-71900925 TGAGCAGGAGCAAGCAAGAGAGG + Intergenic
1119159042 14:72438042-72438064 AAGACAGGAGCAGGAAAAAGGGG + Intronic
1120005914 14:79357902-79357924 AAAGAAGGAGCAAGGAACAGAGG - Intronic
1120464076 14:84833689-84833711 AAAGCAGGAGCAAGAGAGAGAGG + Intergenic
1121147154 14:91593986-91594008 AAATGAGGAGAAAGCAAAAGTGG - Intronic
1121152868 14:91653598-91653620 AAATGAGGAGGAAGCAAAAGCGG + Intronic
1121594626 14:95151300-95151322 AATGGAGGATGAAGGAAAAGAGG - Intronic
1121913465 14:97814152-97814174 AATTCAGCTGCAAGCAATAGGGG + Intergenic
1122162941 14:99799462-99799484 ACTGCATGAGAATGCAAAAGAGG - Intronic
1122180165 14:99949125-99949147 AAAGCAGGAGCAAGAGACAGCGG + Intergenic
1202918873 14_KI270723v1_random:12562-12584 TATGCCGGTGCAGGCAAAAGAGG + Intergenic
1123842874 15:24267163-24267185 TATGCAGGAGCATGCAGAGGGGG - Intergenic
1123852432 15:24373150-24373172 TATGCAGGAGCATGCAGAGGGGG - Intergenic
1123857911 15:24433189-24433211 TATGCAGGAGCATGCAGAGGGGG - Intergenic
1123862544 15:24483734-24483756 TATGCAGGAGCATGCAGAGGGGG - Intergenic
1124351049 15:28955891-28955913 CCTGCAGGAGCAAGCAACCGAGG - Intronic
1124443737 15:29709768-29709790 AAATCAGGAACTAGCAAAAGAGG + Intronic
1124554666 15:30713204-30713226 AATGTGGGAGCAAAAAAAAGTGG - Intronic
1124676582 15:31692476-31692498 AATGTGGGAGCAAAAAAAAGTGG + Intronic
1126080072 15:44951862-44951884 AAATGAGGAGGAAGCAAAAGCGG - Intergenic
1126369340 15:47929173-47929195 AATGCAAAAGAAAGCCAAAGGGG - Intergenic
1126512910 15:49500902-49500924 AAAGCAGGATCAAGCAAGAGGGG - Intronic
1131075753 15:89493981-89494003 AATGGAGCAGGAAGCAACAGAGG - Intronic
1133635541 16:7661561-7661583 ACTGCAGGAGACAGCAACAGAGG - Intronic
1138055925 16:53833143-53833165 AAATGAGGAGGAAGCAAAAGCGG - Intronic
1138499993 16:57435199-57435221 AAAGCAGGATCAAGAAAGAGAGG - Intronic
1138715114 16:59012218-59012240 CATGCAAGATCTAGCAAAAGCGG + Intergenic
1139084086 16:63562761-63562783 AAAGCAGGAGCAAGAGAGAGTGG - Intergenic
1139240608 16:65388278-65388300 AATGGAGCAGGTAGCAAAAGAGG + Intergenic
1139356680 16:66371059-66371081 AAACCAGGAGGAAGCAGAAGGGG + Intronic
1139680462 16:68557906-68557928 ACTGCAGGAGCTATCAGAAGTGG - Intronic
1140022446 16:71251355-71251377 AAGGGAGGAGAAAGAAAAAGAGG + Intergenic
1140139719 16:72244117-72244139 AATGCAGAAGAAATAAAAAGAGG + Intergenic
1140248979 16:73277887-73277909 AAGGCAGGAGCAAGAGAGAGAGG + Intergenic
1140321673 16:73958452-73958474 AATGCAAAAGCAAGGCAAAGGGG - Intergenic
1141188684 16:81807828-81807850 AAAGCAGGAGCAAGAGAGAGAGG + Intronic
1141725384 16:85784743-85784765 AATGCAGGAGCAGGCAGAGGTGG - Intronic
1141791715 16:86241337-86241359 AATGAAGCAACAAGTAAAAGTGG + Intergenic
1143427379 17:6850781-6850803 AAGGCAGGAGCAAGGAAGAGGGG - Intergenic
1144413523 17:15023904-15023926 TATGCAGGGGCACCCAAAAGGGG - Intergenic
1145899538 17:28481251-28481273 AGTGCTGGAGAAAACAAAAGTGG - Intronic
1146204764 17:30893651-30893673 AATGCAGAAGAAAGCAAAACCGG + Exonic
1146562636 17:33884375-33884397 CATCCAGGAACAAGCAACAGTGG - Intronic
1148013859 17:44506908-44506930 AATTCAGGAGAAAGTAAAGGTGG - Intergenic
1149596974 17:57869955-57869977 AATTCAGGATCAAGGACAAGAGG + Intronic
1150604570 17:66679790-66679812 AATACATCAGCAAGCGAAAGTGG + Intronic
1150625468 17:66838395-66838417 AGTGTGGGAGCAAGCAGAAGGGG + Intronic
1153539215 18:6136045-6136067 AATGAGGAAGAAAGCAAAAGTGG + Intronic
1155069400 18:22300655-22300677 AATGCTGGAGTAAGAGAAAGAGG - Intergenic
1155688100 18:28580562-28580584 AAAGCAGGAGCAAGAGAGAGAGG + Intergenic
1156115343 18:33780718-33780740 AAAGCAGGAGCAAGCAAGAGTGG + Intergenic
1156913092 18:42434445-42434467 AATTTAGGAGCAATCAACAGAGG + Intergenic
1157837298 18:50917527-50917549 AATACAGGAGGAAGATAAAGGGG - Intronic
1158447114 18:57531220-57531242 AAACGAGGAGGAAGCAAAAGTGG + Intergenic
1160016481 18:75145062-75145084 AAAGGAGGAAGAAGCAAAAGTGG + Intergenic
1162809393 19:13155038-13155060 AATGCCCGGGCAAGGAAAAGGGG - Intergenic
1163219082 19:15901488-15901510 AAAGCAGGAGCAAGAGAGAGAGG - Intergenic
1163331594 19:16642021-16642043 AATGGTGGAGGAAGCAAAATGGG + Intronic
1163447002 19:17352801-17352823 TGAGCAGGAGCAGGCAAAAGAGG - Intronic
1164489210 19:28691339-28691361 AAAGCAGGAGCAAGTGAAAGGGG - Intergenic
1164788021 19:30952212-30952234 AAGGAAGGAAGAAGCAAAAGAGG - Intergenic
1165502247 19:36199158-36199180 GTTTCAGGAGCAAGGAAAAGTGG - Intronic
1165868576 19:38954216-38954238 CATGCAGGAGGAAGCCAAAGTGG + Intronic
1166153119 19:40889251-40889273 AAAGTAGAAGCAAGCTAAAGAGG - Intronic
1166953508 19:46446327-46446349 AATCCAGGAGACAGCAGAAGAGG + Intergenic
1167529292 19:50004963-50004985 CAAGCAGGAGCAAGAGAAAGAGG - Intronic
1168264422 19:55214351-55214373 AAAGCAGGAGCAAGAGAGAGAGG + Intergenic
924963061 2:51340-51362 AAGGCAGGAGCAAGAGAGAGAGG - Intergenic
925539763 2:4953813-4953835 AAAGCAGGAGCAAGTAAACAAGG + Intergenic
925758326 2:7156778-7156800 AAAGCAGGAGCAAGAAAGAGAGG - Intergenic
926493819 2:13558911-13558933 AAAGCAGGAGCAAGAGAAAGTGG + Intergenic
926951504 2:18248477-18248499 AAGGCAGGAGCAAGAGAAAGAGG + Intronic
927672164 2:25077833-25077855 AATTCAGAAGCAAGGAAAAGGGG + Intronic
928696193 2:33852543-33852565 AAAGCAGGAGCAAGCAGGAGAGG + Intergenic
929643392 2:43604028-43604050 AAAGCAGGAGCAAGAGAGAGTGG + Intergenic
929920171 2:46166103-46166125 CATGCAGGAGCATGCAGGAGAGG - Intronic
930383469 2:50661512-50661534 AAGGCACAAGCAAGGAAAAGTGG - Intronic
931315827 2:61130128-61130150 AATGCAAAAGAAAGTAAAAGAGG - Intronic
931693241 2:64852951-64852973 AAGGGAGGAGGAAGAAAAAGAGG + Intergenic
932754767 2:74399662-74399684 AATGCAAAAGCAAGCAAGAAAGG + Intergenic
933183331 2:79251562-79251584 AATGAGAGAGAAAGCAAAAGAGG - Intronic
933398016 2:81755869-81755891 AAATCAGGAAGAAGCAAAAGTGG + Intergenic
933948420 2:87308227-87308249 AAGGCAATAGCAATCAAAAGAGG - Intergenic
935300412 2:101688870-101688892 AAAGCAGGAGCAAGAGAGAGTGG - Intergenic
935469910 2:103446124-103446146 AAGGAAGGAGCAAAGAAAAGAGG + Intergenic
935475335 2:103514125-103514147 AAATGAGGAGGAAGCAAAAGTGG + Intergenic
935484454 2:103636060-103636082 GAGGCAGGAGCAAGGAGAAGTGG + Intergenic
936331779 2:111553368-111553390 AAGGCAACAGCAATCAAAAGAGG + Intergenic
936787285 2:116108824-116108846 GATCTAGGAACAAGCAAAAGAGG - Intergenic
936850626 2:116893696-116893718 AATGCAGAAGCAAAGAAAAATGG + Intergenic
938057409 2:128226565-128226587 AGAGCAGGAGCAAGAAAGAGAGG - Intergenic
938757744 2:134396391-134396413 ACTTCAGGAGCAAGCAGATGAGG + Intronic
939739058 2:145883863-145883885 AAAGCAGGAGCAAGAGAGAGGGG - Intergenic
939779733 2:146430918-146430940 AAAGCAGGAGCAAGAGAGAGTGG - Intergenic
939847177 2:147261432-147261454 AGTGCAGGAGCAAGAGGAAGGGG - Intergenic
940026199 2:149211080-149211102 GTTGCAGGAGCAAGAAAGAGAGG + Intronic
940943079 2:159584896-159584918 AAAGCAGGAGCAAGCGAGAGAGG - Intronic
940977093 2:159958260-159958282 ATGGCAAGAGCAAGCACAAGAGG - Intronic
941536117 2:166723879-166723901 AAATGAGGAACAAGCAAAAGTGG + Intergenic
942073356 2:172335164-172335186 AATCCAGGAGCCACCAGAAGAGG - Intergenic
942533762 2:176941191-176941213 AATGCAGGATTCAGAAAAAGGGG - Intergenic
944156344 2:196611260-196611282 AAAGGAGGATGAAGCAAAAGTGG - Intergenic
944803529 2:203259462-203259484 AAAGCAGGAGCAAGAGAGAGGGG - Intronic
945539197 2:211062824-211062846 AATGAAGGAGCAAGAACATGTGG - Intergenic
945558658 2:211310682-211310704 CATGAAGGAGGAAGCAAGAGAGG - Intergenic
946899117 2:224355363-224355385 GATGGAGGAGGAAGAAAAAGAGG - Intergenic
947005659 2:225508547-225508569 AAAGAAGGAGGAAGCAGAAGAGG + Intronic
947093485 2:226540356-226540378 AAAGAAAGAGAAAGCAAAAGGGG + Intergenic
948451753 2:238079875-238079897 AGGGCAGGAGCAAGAGAAAGGGG - Intronic
948732375 2:239975178-239975200 AAGGCAGGAGCAAGAGAATGGGG - Intronic
1168844954 20:938024-938046 GAAGCAGGAGCAAGAGAAAGAGG - Intergenic
1168860545 20:1043345-1043367 AATGCAGGAGTGAGGAAAACAGG + Intergenic
1169120303 20:3091941-3091963 ACTGCAGGACCAAGTAAAAAAGG + Intergenic
1169437023 20:5601812-5601834 AATGCAGGAGCACCTATAAGAGG - Intronic
1170506778 20:17034793-17034815 GATGCTGGGGGAAGCAAAAGTGG - Intergenic
1170635160 20:18098131-18098153 AATGAAGGATCCAGCAATAGCGG + Intergenic
1171317609 20:24209335-24209357 AATGCAGGGGCAAACGGAAGAGG - Intergenic
1171898985 20:30839285-30839307 AAAGCAGGAGCAAGAAACAGAGG - Intergenic
1171901787 20:30865310-30865332 AAGGAAGGAGGAAGAAAAAGAGG + Intergenic
1172865536 20:38094109-38094131 ATTCCAGGAGAAAGTAAAAGAGG - Intronic
1173485008 20:43434671-43434693 AATTCAGGACCAAGGTAAAGAGG + Intergenic
1173674506 20:44822091-44822113 AATGCAGGAGAATGTCAAAGAGG - Intergenic
1174240638 20:49131864-49131886 AAGGAAGGAGCAAGCAAATATGG + Intronic
1174445720 20:50589793-50589815 AATGGAGGGGTAAGCAGAAGTGG + Intronic
1174861013 20:54090970-54090992 CAGTCAGGAGCAGGCAAAAGGGG + Intergenic
1174937589 20:54888426-54888448 AATGCAACAGCAAGCTGAAGAGG - Intergenic
1177206727 21:18018493-18018515 AAAGCAGGAGCAAGAGAGAGTGG - Intronic
1177228265 21:18285327-18285349 AATGCAGTAGAAAGCAAATATGG + Intronic
1177570072 21:22875654-22875676 AATGCAGGAGCAAGCAAGGCAGG - Intergenic
1178019075 21:28388758-28388780 TATTTAGGAGTAAGCAAAAGAGG - Intergenic
1178457344 21:32767667-32767689 AAATGAGGAGGAAGCAAAAGCGG - Intronic
1178631228 21:34263208-34263230 ACTGCAGGAGCAACTAAAATAGG - Intergenic
1179533694 21:42037916-42037938 AATCAAGGAACAAACAAAAGTGG + Intergenic
1179963836 21:44788645-44788667 AATGCAAAAGCAAACATAAGGGG + Intronic
1180322806 22:11338616-11338638 AAAGCAGGAGCAAAAAACAGAGG + Intergenic
1180582601 22:16854854-16854876 TATGCAAGAGAAAGAAAAAGAGG + Intergenic
1180817374 22:18799499-18799521 AAAGCAGGAGCAAGAGAGAGAGG - Intergenic
1181203564 22:21233820-21233842 AAAGCAGGAGCAAGAGAGAGAGG - Intergenic
1181720850 22:24773268-24773290 AAGGCAGGAGTATGGAAAAGGGG - Intronic
1182034491 22:27186996-27187018 AAGGGAGGAGAAAGAAAAAGAGG - Intergenic
1182388491 22:29968991-29969013 AATGCAGGAGCAAGTATAAATGG - Intronic
1183049923 22:35252663-35252685 GATGCATGAGCTGGCAAAAGTGG + Intergenic
1184984031 22:48117296-48117318 AATGAAGGAGGAAAGAAAAGAGG + Intergenic
1203223357 22_KI270731v1_random:61594-61616 AAAGCAGGAGCAAGAGAGAGAGG + Intergenic
1203267472 22_KI270734v1_random:25226-25248 AAAGCAGGAGCAAGAGAGAGAGG - Intergenic
950127699 3:10520289-10520311 AGTGCTGGAGCAAGCAGCAGGGG + Intronic
950705989 3:14782122-14782144 AAAGCAGGAGCAAGAGAGAGTGG - Intergenic
951169169 3:19519097-19519119 AACCAAGGAGCAAGGAAAAGTGG + Intronic
951457702 3:22911080-22911102 GGAGCAGGAGCAAGGAAAAGGGG - Intergenic
951902836 3:27673907-27673929 GAAGAAGAAGCAAGCAAAAGAGG - Intergenic
952632702 3:35488801-35488823 AAAGGAGGAGGAAGAAAAAGAGG + Intergenic
954080290 3:48209579-48209601 ACTGCAGGAGAAGGCATAAGGGG - Intergenic
954329589 3:49882518-49882540 CATCCAGAAGCCAGCAAAAGTGG + Intergenic
955714849 3:61818421-61818443 AATGCAAGAGCAAGTAGAGGAGG + Intronic
956051310 3:65251391-65251413 AATGCAGGAGCTAGGGATAGAGG - Intergenic
956185816 3:66560916-66560938 AAATGAGGAGGAAGCAAAAGCGG + Intergenic
956584012 3:70844827-70844849 AAAGCAGGAGCAAGAGAAAGTGG - Intergenic
957273114 3:78056520-78056542 AAATGAGGAGGAAGCAAAAGCGG - Intergenic
957627337 3:82670710-82670732 AATGCAGAACCAAGTAAAAGAGG + Intergenic
957922898 3:86770165-86770187 AATGCAGGAAAAAGAAAAGGCGG + Intergenic
958824188 3:99009850-99009872 AGAGCAGGAGCAAGAAAGAGAGG + Intergenic
958883817 3:99703435-99703457 AATGCAGAGGCAAGGAAAATTGG + Intronic
959015083 3:101124656-101124678 AATGGAGGGGCAACCACAAGTGG + Intergenic
959804429 3:110533774-110533796 AAAGCAGGAACAAGAAAAAGTGG - Intergenic
960304231 3:116041531-116041553 AATACAGGAACAAGCAGAAGAGG - Intronic
960503668 3:118467544-118467566 AAAGCAAGAGCAAGAAAGAGAGG + Intergenic
960833824 3:121882495-121882517 AATTCAGGAACAAGACAAAGAGG + Intronic
961498607 3:127314407-127314429 AATACAGGAGCAAGGAAAATAGG + Intergenic
962100238 3:132334198-132334220 AATGCAGGTGCTAGTAGAAGAGG + Intronic
962162320 3:133012722-133012744 AAATGAGGAGGAAGCAAAAGTGG + Intergenic
962971572 3:140406465-140406487 AATGCACAAGCAAGTAAAGGAGG + Intronic
963261479 3:143195905-143195927 AAAGCAGGAACAAGAGAAAGTGG - Intergenic
963865400 3:150355354-150355376 AAGACAGGAGCAAGAACAAGTGG - Intergenic
963919190 3:150889401-150889423 TATGGAAGAGGAAGCAAAAGAGG - Intronic
964016593 3:151954717-151954739 ATTGCAGGAGCAAGCAATCAGGG + Intergenic
964361985 3:155908192-155908214 GATGCAGGAGGAAGATAAAGGGG + Intronic
964426553 3:156560479-156560501 AAATCAGAAGGAAGCAAAAGCGG - Intergenic
964669209 3:159206812-159206834 AATGAAGAATCAAACAAAAGGGG - Intronic
964978291 3:162646645-162646667 AAATGAGGAGGAAGCAAAAGTGG - Intergenic
965616889 3:170603099-170603121 AAAGCAAGAGCAACCATAAGTGG - Intronic
965690048 3:171346102-171346124 AGTGAAGGAACAAGCAACAGAGG + Intronic
966495702 3:180578029-180578051 AATGAATGAGCAAGTAAACGTGG + Intergenic
966904835 3:184514478-184514500 AAGGCAAGGGGAAGCAAAAGAGG + Intronic
967345853 3:188454711-188454733 AAATGAGGAGGAAGCAAAAGCGG + Intronic
967730653 3:192903839-192903861 AATGCAGGAGCAAGCAAAAGTGG - Intronic
967806115 3:193715885-193715907 AACGCAGGAGCAAGAGAGAGTGG - Intergenic
969203635 4:5625175-5625197 AATGCAGCAGCAAGTCAATGGGG - Intronic
969376330 4:6765842-6765864 AATGCAGGAGGAAGAAGAAATGG - Intergenic
969970504 4:11042576-11042598 AATTCAGAAAGAAGCAAAAGAGG + Intergenic
970281080 4:14456427-14456449 AAAGCAGGAGCAAGAGAGAGAGG + Intergenic
970441679 4:16085440-16085462 TAGGCTGGAGCTAGCAAAAGAGG + Intergenic
971216995 4:24671155-24671177 AAAGCAGGAACAAGAAAGAGTGG - Intergenic
972557723 4:40197208-40197230 AAAGCAGGTGAAAACAAAAGCGG - Exonic
972684848 4:41342097-41342119 AAAGCAGAAGCAAGCAAGAGAGG - Intergenic
972833690 4:42843113-42843135 AAACCAGGAGCAGGCAAGAGTGG + Intergenic
974209183 4:58747298-58747320 AAAGCAGGAGCAAGGAAGAGAGG - Intergenic
974522155 4:62995875-62995897 AATGCAGAAACAACAAAAAGAGG + Intergenic
975380488 4:73694949-73694971 AATGCAGGAGAAAAGAGAAGAGG + Intergenic
975919814 4:79371566-79371588 AAATGAGGAGGAAGCAAAAGCGG + Intergenic
977588949 4:98805544-98805566 AAGGGAAGAGGAAGCAAAAGTGG - Intergenic
977996396 4:103501605-103501627 AAATGAGGAGGAAGCAAAAGTGG - Intergenic
978448273 4:108801866-108801888 AATGCAGCTGCAATCAAAACTGG + Intergenic
979682496 4:123477236-123477258 AAAGCAGGAGCAAGAAAGAGTGG - Intergenic
980025211 4:127758029-127758051 AAATGAGGAGGAAGCAAAAGTGG + Intronic
980259630 4:130432040-130432062 AATGCAGAAGCAGGCACAAGGGG + Intergenic
980877821 4:138679674-138679696 AAGGGAGGAGGAAGCAAAATAGG + Intergenic
982376524 4:154696875-154696897 AATGGAGAAGCAATGAAAAGGGG + Intronic
982900006 4:160986866-160986888 AATGCACGAGCAAGAGAAACTGG + Intergenic
983802246 4:171947205-171947227 AATGTGGGAGAAAGCAAAAGAGG - Intronic
984880294 4:184404840-184404862 AGTGCAGGAGGAGGCAAGAGTGG + Intronic
985133141 4:186759116-186759138 AAATAAGGAGCAAGCAAACGTGG + Intergenic
985720319 5:1485440-1485462 AATGCAGGAACAAGGCAGAGGGG + Intronic
985889727 5:2706022-2706044 AAACCAGGAGCAAGGAAGAGTGG + Intergenic
986078672 5:4366070-4366092 AATGGAGGAGAAAGCAGTAGTGG - Intergenic
987182334 5:15380848-15380870 AAAGCAGGAGCAAGGAAGGGGGG - Intergenic
987814715 5:22885097-22885119 CATGCATGAGCAAGGGAAAGAGG + Intergenic
989127538 5:38071676-38071698 AATGCAGAAGCATGCAGGAGTGG + Intergenic
989475622 5:41870074-41870096 ACTGCAGAACCAAGCAAAGGCGG + Intronic
989701949 5:44278618-44278640 AATGTGGCAGCAAGCCAAAGAGG - Intergenic
989788637 5:45363759-45363781 AAATGAGGAGGAAGCAAAAGCGG - Intronic
990799808 5:59587742-59587764 CAAGTAAGAGCAAGCAAAAGGGG + Intronic
991346130 5:65670432-65670454 AATGTAGGAGCTACCTAAAGGGG + Intronic
991678535 5:69113941-69113963 AATTAAGTGGCAAGCAAAAGAGG - Intronic
993256152 5:85592365-85592387 AAAAGAGGAGGAAGCAAAAGTGG + Intergenic
993844172 5:92919716-92919738 AATGAAGGAGAAAGGAACAGAGG - Intergenic
995019004 5:107346262-107346284 GATACAGGAGCAATCAGAAGAGG - Intergenic
995461778 5:112410988-112411010 AATCCAGGGGCAAGGAAAGGAGG - Intronic
996048396 5:118903415-118903437 ATTGCAAGAAAAAGCAAAAGTGG - Intronic
996227463 5:121018097-121018119 AAAGCAGGAGCAAGAGATAGAGG + Intergenic
996258885 5:121441046-121441068 AAGGCAAGAGCAAGCAAGTGTGG - Intergenic
996354319 5:122579477-122579499 ATTGAAGGACCAAGCAGAAGTGG - Intergenic
997409289 5:133678856-133678878 AGAGCAGGAGCCAGCAAAGGAGG + Intergenic
997629098 5:135353223-135353245 GATGCGGGAGCAAGCAAACTAGG + Intronic
997790607 5:136756707-136756729 AAAGCAGGAGCAAGAGAGAGAGG + Intergenic
998467949 5:142360946-142360968 AACGCAGCAGCAAACAAGAGCGG + Intergenic
998588903 5:143456672-143456694 ACTGCAGGAGAAAGCCAAAGGGG - Intergenic
998713815 5:144857622-144857644 AATGCAAGAGGCAGCCAAAGGGG - Intergenic
999067114 5:148699725-148699747 AAATGAGGAGAAAGCAAAAGCGG + Intergenic
999341092 5:150773540-150773562 AAAGCAAGAGCAAGAAAGAGAGG - Intergenic
1001767365 5:174261177-174261199 AGAGCAGGAGCAAGAAAGAGAGG + Intergenic
1002810639 6:624701-624723 AATGCAGGAGAGTGCGAAAGGGG + Intronic
1003344209 6:5251514-5251536 AGAGCAGGAGCAAGCAAGCGAGG + Intronic
1003572753 6:7266828-7266850 AATGCTGTACCAAGCAAGAGAGG - Intergenic
1003856489 6:10281242-10281264 AAATGAGGAGGAAGCAAAAGCGG + Intergenic
1004130453 6:12914361-12914383 AGTGAAGGAGCCAGCAAAAGAGG - Intronic
1004284486 6:14308071-14308093 AAAGCAGGAGCCAGAGAAAGAGG - Intergenic
1005777471 6:29151471-29151493 TATGCAGGAGCTAAAAAAAGTGG - Intergenic
1006067928 6:31475720-31475742 AAATGAGGAGGAAGCAAAAGCGG + Intergenic
1006623118 6:35381005-35381027 AAGGCAGGAGCAAAGGAAAGTGG - Intronic
1008097184 6:47351093-47351115 AAAGCAGAAGCAAGCAAGCGGGG + Intergenic
1008682420 6:53887099-53887121 AATGCAGGAACAGGCTAAAGTGG - Intronic
1008796159 6:55305464-55305486 AAAGCAGGAGCAAGTGAGAGAGG - Intergenic
1009769004 6:68121086-68121108 ATTGCAGCAGAAGGCAAAAGAGG + Intergenic
1009944203 6:70323995-70324017 AGGGGAGGAGAAAGCAAAAGTGG + Intergenic
1010132087 6:72506253-72506275 GATACTGGAGCAAGAAAAAGTGG - Intergenic
1010994841 6:82521200-82521222 AATGTAGGAGAAAGCAAAAAAGG - Intergenic
1010999236 6:82568946-82568968 AATGCTAAAGCAATCAAAAGTGG - Intergenic
1011495990 6:87937068-87937090 AAATGAGGAGGAAGCAAAAGCGG + Intergenic
1012242665 6:96891676-96891698 ATTGCCAGAGCAAGCAGAAGCGG - Intronic
1013080919 6:106811876-106811898 AAATGAGGAGGAAGCAAAAGTGG + Intergenic
1015794064 6:136993251-136993273 AAATGAGGAGGAAGCAAAAGTGG + Intergenic
1018218442 6:161553374-161553396 AATGAAGGAGGAAGGAAAAAAGG - Intronic
1018645182 6:165941634-165941656 AAAGCAGGAGCAAGGGAGAGTGG - Intronic
1019470634 7:1218744-1218766 AATGCTGATGAAAGCAAAAGAGG + Intergenic
1020220045 7:6229403-6229425 ACTCCAGGAACAAGCAACAGTGG + Intronic
1020649109 7:10853778-10853800 AGAGAAGGAACAAGCAAAAGGGG + Intergenic
1020743658 7:12054211-12054233 AATGAAAGAGCAAAGAAAAGAGG - Intergenic
1022654455 7:32306076-32306098 AATGAAGGATCAAGTGAAAGGGG - Intergenic
1023077475 7:36498441-36498463 AAAGCAGAAGAAAGCTAAAGTGG + Intergenic
1023095896 7:36659437-36659459 AATGCAGGAGAGAGCAACAGTGG - Intronic
1023698175 7:42868465-42868487 AAAGCAGGAGCAAGACAGAGGGG - Intergenic
1023856162 7:44185620-44185642 AGGGCAGGAGCAAGCCAAAGGGG - Intronic
1024394532 7:48850348-48850370 AATGTTGGATCAAACAAAAGGGG + Intergenic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1024846320 7:53647404-53647426 AGAGCAGGAACAAGAAAAAGAGG - Intergenic
1024895040 7:54249209-54249231 AAAGCAGGAGCAAGAGAACGAGG + Intergenic
1025640016 7:63357733-63357755 AATGCAGTAGGAAGCCAAGGAGG - Intergenic
1025642683 7:63390359-63390381 AATGCAGTAGGAAGCCAAGGAGG + Intergenic
1025711943 7:63919890-63919912 AATGCAGTAGGAAGCCAAGGAGG + Intergenic
1026651809 7:72222401-72222423 AAAGCAGGAGCAAGAGAGAGGGG + Intronic
1027798191 7:82719756-82719778 AAATAAGGAGGAAGCAAAAGCGG + Intergenic
1028367345 7:90049047-90049069 AAAGGAGGAGGAAGCAAAAGTGG + Intergenic
1028618731 7:92800409-92800431 TTTGCAGGAGCAAGAAAATGAGG - Intronic
1029184726 7:98730393-98730415 AATGCAGGAGAAAGAGACAGAGG + Intergenic
1030917273 7:115330950-115330972 AAAGCAGGAGCAAGAGAAAGAGG + Intergenic
1031438127 7:121758321-121758343 GATGGAGAAGCCAGCAAAAGAGG - Intergenic
1031613525 7:123855049-123855071 AATGGAGGAATAAGCAAAAAAGG - Intronic
1033019421 7:137707619-137707641 AGAGCAGGAGGAAGAAAAAGAGG - Intronic
1034235887 7:149569048-149569070 AATGGAGAAGAAAGGAAAAGAGG - Intergenic
1034236359 7:149573497-149573519 AATGGAGAAGAAAGGAAAAGAGG - Intergenic
1034255750 7:149723859-149723881 AATCCAGGAGCCTGGAAAAGGGG + Exonic
1034699497 7:153083956-153083978 AAAGCAGGAGCAAGCAAGGAGGG + Intergenic
1034819761 7:154205910-154205932 TGTGCAGGAGCAGGCACAAGTGG + Intronic
1036497336 8:9281143-9281165 AAGGCTGGAGCAAGTAGAAGGGG + Intergenic
1037046235 8:14307788-14307810 AAAGCAAGGGCAAGAAAAAGAGG + Intronic
1037582651 8:20254777-20254799 AACGCAGGAGAAAGCAAAATGGG - Intronic
1038795353 8:30704615-30704637 CATGCAGGGGCATGCAAATGTGG + Intronic
1038798338 8:30728250-30728272 AAAGCAAGAACAAACAAAAGTGG - Intergenic
1039611418 8:38922350-38922372 AATGAATGAGCCAGCTAAAGAGG + Intronic
1040505917 8:48047504-48047526 AAAGCAAGAGCAAAAAAAAGAGG - Intronic
1041262603 8:56034877-56034899 GATGCAGCAGCAAGCCCAAGGGG + Intergenic
1041548904 8:59078466-59078488 AAAGCAGGAGCAAGAGAATGTGG - Intronic
1042210257 8:66372952-66372974 AATGAAGGAGAAAGTAAATGAGG + Intergenic
1043141324 8:76593600-76593622 AAATGAGGAGGAAGCAAAAGCGG - Intergenic
1045419004 8:101995539-101995561 AAAACAGGAGCAAGAGAAAGGGG + Intronic
1045517975 8:102877590-102877612 AGGGCAGGAGCAAGCAGCAGTGG - Intronic
1045616113 8:103913735-103913757 AAAGCAGGAGCAAGAGAGAGTGG + Intronic
1045648214 8:104319836-104319858 GAAGCAGGAGCAGGCAAAGGGGG + Intergenic
1046050309 8:109014032-109014054 GATGCAGGAGCCAGCTGAAGAGG + Intergenic
1046129407 8:109947640-109947662 AAATCAGGAAGAAGCAAAAGCGG - Intergenic
1046962464 8:120125386-120125408 CATTCATGAGCAAGGAAAAGTGG + Intronic
1047041451 8:121001372-121001394 AAGGCAGTAGAAAGCAAAGGAGG + Intergenic
1047487050 8:125340964-125340986 AATTCAGGAGCAAATAAAGGAGG - Intronic
1047558172 8:125956436-125956458 GATTCAAGAGCAAGCAAATGTGG - Intergenic
1050128391 9:2383469-2383491 AAAGCAGGAGCAAGAAAATGAGG + Intergenic
1050442651 9:5681826-5681848 AATACAGGAGCACGCAATACAGG - Intronic
1051059382 9:13028500-13028522 AATGAAGGAGTTAGGAAAAGAGG - Intergenic
1051460166 9:17303997-17304019 AATGTAAGGGCAAGAAAAAGGGG - Intronic
1051902806 9:22060813-22060835 AAATGAGGAGGAAGCAAAAGTGG + Intergenic
1052060295 9:23952538-23952560 AAAGCAGGAACAAGAGAAAGAGG - Intergenic
1052090327 9:24319886-24319908 AGAGCAGGAGCAAGAGAAAGAGG + Intergenic
1053384019 9:37672783-37672805 AAATAAGGAGGAAGCAAAAGTGG + Intronic
1055891395 9:81128022-81128044 GATGCAGGAGAAAGAAAAAAAGG + Intergenic
1056021144 9:82439698-82439720 AAAGCAGGAGCAAGAGAGAGAGG - Intergenic
1056194551 9:84216633-84216655 ATTTCAGGAGGGAGCAAAAGTGG + Intergenic
1056790365 9:89621428-89621450 GGAGCAGAAGCAAGCAAAAGAGG - Intergenic
1056829115 9:89900033-89900055 AAATCAGGAAGAAGCAAAAGCGG - Intergenic
1057553701 9:96071070-96071092 GAGGCAGGAGAAAGGAAAAGGGG - Intergenic
1058369617 9:104250304-104250326 AGTGGAGGGGAAAGCAAAAGGGG - Intergenic
1060620422 9:125060677-125060699 AAATGAGGAGGAAGCAAAAGCGG - Intronic
1061528495 9:131189786-131189808 AATAAAGGAGCCAACAAAAGGGG - Intronic
1061780281 9:132991857-132991879 GAGCCAGGAGCAAGCAGAAGGGG + Intergenic
1062496538 9:136834128-136834150 AATCCAGGGGCAAGACAAAGAGG - Intronic
1062739897 9:138165650-138165672 AAAGCAGGAGCAAAAAACAGAGG - Intergenic
1203370496 Un_KI270442v1:299196-299218 AAAGCAGGAGCAAAAAACAGAGG + Intergenic
1186349382 X:8727634-8727656 GGTGCAGCAGCAGGCAAAAGAGG + Intronic
1187083413 X:16015587-16015609 AAAGCAGGAGCAAGAGAGAGCGG + Intergenic
1187333628 X:18363025-18363047 AGAGCAGGAGCAAGAAAGAGAGG - Intergenic
1187429513 X:19209414-19209436 AATTGAGAACCAAGCAAAAGGGG - Intergenic
1188435839 X:30157565-30157587 ATTGGAGGAGGAAGCAAATGGGG + Intergenic
1189668979 X:43387646-43387668 AGAGCAGGAGCAAGAGAAAGTGG - Intergenic
1189707421 X:43772847-43772869 AAAGCAGGAACAAGCAAGTGTGG - Intronic
1189710512 X:43806746-43806768 AATGAATAAGCAAGTAAAAGGGG - Intronic
1191089086 X:56601415-56601437 AAATCAGGAAGAAGCAAAAGTGG + Intergenic
1191211196 X:57886544-57886566 AAAGCAGGAGCAAGAGGAAGTGG + Intergenic
1193008238 X:76644735-76644757 AAGGCAGAAGCAAGGAGAAGTGG - Intergenic
1193042049 X:77014436-77014458 AATGCAGGAGCAAGCCACTGAGG + Intergenic
1194195916 X:90892711-90892733 AAGGCAGGAGGAAGCAAAATTGG - Intergenic
1194402240 X:93452779-93452801 AAAGCAGGAGCAAGAGAGAGAGG - Intergenic
1195309319 X:103615485-103615507 AATTCAGGAGTAGTCAAAAGGGG - Intronic
1196294893 X:113986148-113986170 AAATCAGGAGGAAGCAAAAGTGG + Intergenic
1197173048 X:123455783-123455805 AGTGCTAAAGCAAGCAAAAGAGG + Intronic
1197572374 X:128165015-128165037 AAAGCAAGAGAAAACAAAAGGGG - Intergenic
1197705376 X:129630933-129630955 AATGAAGGGGGAAGCAAGAGGGG - Intergenic
1198064041 X:133078119-133078141 AGAGCAGGAGCAAGCAAGGGAGG - Intronic
1198176115 X:134156636-134156658 AGTGCAGGAGCAGAGAAAAGGGG + Intergenic
1198297279 X:135300302-135300324 AGTGCAGGGGCAAGGACAAGGGG - Intronic
1198392593 X:136191246-136191268 AATGCAGGAGTAACCACAGGTGG - Intronic
1198927739 X:141817921-141817943 AATCCAGGAGCAAGTAACACAGG + Intergenic
1199393314 X:147306753-147306775 AAAGCAGAAACAAGCAAGAGAGG + Intergenic
1200541764 Y:4466904-4466926 AAGGCAGGAGGAAGCAAAATTGG - Intergenic
1201067816 Y:10115886-10115908 AAAGCAGGAGCAAAAAACAGAGG - Intergenic
1201452488 Y:14131155-14131177 AAAAGAGGAGAAAGCAAAAGCGG - Intergenic