ID: 967734109

View in Genome Browser
Species Human (GRCh38)
Location 3:192934035-192934057
Sequence AGATATTTACAGAAGGAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967734101_967734109 20 Left 967734101 3:192933992-192934014 CCCTTGTCAGTCCTTCCTCCACC No data
Right 967734109 3:192934035-192934057 AGATATTTACAGAAGGAGTATGG No data
967734106_967734109 -1 Left 967734106 3:192934013-192934035 CCTTCTTTAACCACGTAAATCAA No data
Right 967734109 3:192934035-192934057 AGATATTTACAGAAGGAGTATGG No data
967734105_967734109 2 Left 967734105 3:192934010-192934032 CCACCTTCTTTAACCACGTAAAT No data
Right 967734109 3:192934035-192934057 AGATATTTACAGAAGGAGTATGG No data
967734103_967734109 9 Left 967734103 3:192934003-192934025 CCTTCCTCCACCTTCTTTAACCA No data
Right 967734109 3:192934035-192934057 AGATATTTACAGAAGGAGTATGG No data
967734102_967734109 19 Left 967734102 3:192933993-192934015 CCTTGTCAGTCCTTCCTCCACCT No data
Right 967734109 3:192934035-192934057 AGATATTTACAGAAGGAGTATGG No data
967734104_967734109 5 Left 967734104 3:192934007-192934029 CCTCCACCTTCTTTAACCACGTA No data
Right 967734109 3:192934035-192934057 AGATATTTACAGAAGGAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967734109 Original CRISPR AGATATTTACAGAAGGAGTA TGG Intergenic
No off target data available for this crispr