ID: 967736617

View in Genome Browser
Species Human (GRCh38)
Location 3:192959766-192959788
Sequence AGACTAATACAGATGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967736617_967736622 15 Left 967736617 3:192959766-192959788 CCCTACTCCATCTGTATTAGTCT No data
Right 967736622 3:192959804-192959826 ATAAAAACATACCTGAGACTGGG 0: 126
1: 3098
2: 6669
3: 11803
4: 13878
967736617_967736624 28 Left 967736617 3:192959766-192959788 CCCTACTCCATCTGTATTAGTCT No data
Right 967736624 3:192959817-192959839 TGAGACTGGGTAATTTATAAAGG 0: 1925
1: 3198
2: 4070
3: 3254
4: 1860
967736617_967736621 14 Left 967736617 3:192959766-192959788 CCCTACTCCATCTGTATTAGTCT No data
Right 967736621 3:192959803-192959825 AATAAAAACATACCTGAGACTGG 0: 58
1: 1271
2: 3947
3: 7760
4: 12306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967736617 Original CRISPR AGACTAATACAGATGGAGTA GGG (reversed) Intergenic
No off target data available for this crispr