ID: 967738130

View in Genome Browser
Species Human (GRCh38)
Location 3:192975477-192975499
Sequence TGTCCAACGCTGAAAGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967738130_967738134 12 Left 967738130 3:192975477-192975499 CCTCCCACTTTCAGCGTTGGACA No data
Right 967738134 3:192975512-192975534 AGAAAATCAACAGAGAAACATGG No data
967738130_967738135 13 Left 967738130 3:192975477-192975499 CCTCCCACTTTCAGCGTTGGACA No data
Right 967738135 3:192975513-192975535 GAAAATCAACAGAGAAACATGGG 0: 6
1: 180
2: 409
3: 1146
4: 1595

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967738130 Original CRISPR TGTCCAACGCTGAAAGTGGG AGG (reversed) Intergenic
No off target data available for this crispr