ID: 967752010

View in Genome Browser
Species Human (GRCh38)
Location 3:193125852-193125874
Sequence GCAACCTTATTATCTGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
967752007_967752010 15 Left 967752007 3:193125814-193125836 CCTAGAAACATGGGCATTTTTAA No data
Right 967752010 3:193125852-193125874 GCAACCTTATTATCTGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
967752010 Original CRISPR GCAACCTTATTATCTGGTGC AGG Intergenic
No off target data available for this crispr